ortho 12 - Société Algérienne de Nutrition et de Médécine
Transcription
ortho 12 - Société Algérienne de Nutrition et de Médécine
ISSN 2170-1539 BULLETIN ORTHO الجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئِي 12 www.orthomoleculaire.org [email protected] www.sanmo.skyblog.com الجمعية الجزائرية للتغذّي والطّ بّ الجزيئي ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE SOCIETE ALGERIENNE DE NUTRITION ET DE MEDECINE ORTHOMOLECULAIRE 43ème Orthomolecular Medicine Conference Fairmont Hotel VANCOUVER April 25-27, 2014 Remise par le Pr Atsuo Yanagisawa au Dr Ilyes Baghli, le 23/03/2014 du titre: Certificate of Board Member of Japenese College of Intravenous Therapy. Mr Steven Carter - Dr Tahar Naili - Dr Ron Hunninghake Tahar NAILI et la famille Yanagisawa à Vancouver والطّبّ الجُزَيْئِي الجمعيّة الجزائريّة للتّغذّي BN 2777-2011 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE SOCIETE ALGERIENNE DE NUTRITION ET DE MEDECINE ORTHOMOLÉCULAIRE ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE PHOTOS ORTHO-COURSES C3S1 ALGER 28-29 Mars 2014 Dr Ilyes Baghli- Pr George Birkmayer - Mme Nor El Houda Ouzegaou - Mr Yazid Ait-Mahiddine Participation studieuse des membres de la SANMO. Mme Isabel Weicken - Pr George Birkmayer - Mr Mahmoud Taleb - Dr Ilyes Baghli. Pr George Birkmayer - Mme Isabel Weicken - Mr Mahmoud Taleb 2 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ Pr George Birkmayer - Mme Lilia Bekhaled - Dr Ilyes Baghli Dr Ilyes Baghli - Mme Amel el Eulmi - Pr George Birkmayer. ORTHO 12 3 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE SOMMAIRE ORTHO 12 Pages 2 PHOTOS ORTHO-DZ COURSE C3S1 ALGER 28-29 Mars 2014 4 Edito 5 PROTOCOLE 1 de la SANMO 6 dřAVICENNE à AVERROES et de Linus PAULING à Abram HOFFER 7 PROGRAMME DE FORMATION SANMO ORTHO-PRESSBOOK 5 APS Mer. 26 Fév. 2014 UNE CONSOMMATION QUOTIDIENNE DE VITAMINE C PRÉVIENT L'APPARITION DES CANCERS 8 Santé MAG N°27 Fev.2014 p.2 : UN APPAREIL DE MESURE DU TAUX DE TOXINES DANS LE CORPS PRESENTE EN PREMIERE MONDIALE A ALGER 8 DK-NEWS 1er Avril 2014 : TRAITEMENT DU CANCER : UNE NOUVELLE APPROCHE MEDICALE CONÇUE PAR DES MEDECINS ALGERIENS par Sonia BELAIDI 11 APS 30 Mars 2014 : VITAMINE C ASSOCIEE A LA NADH, TRAITEMENT EFFICACE CONTRE LES MALADIES DEGENERATIVES 12 Santé MAG N°28-Mars 2014 INTERVIEW DU Dr. Ilyès BAGHLI 15 Pr.Hafida MERZOUK à Santé MAG : ETRE MEMBRE DE LřACADEMIE AFRICAINE DES SCIENCES EST UN HONNEUR POUR MOI ; POUR LA FEMME ALGERIENNE ET POUR NOTRE PAYS 17 PROGRAMME SANMO C3S1 DU 28-29 MARS 2014 17 PARTICIPANTS AU SEMINAIRE C2S6 ET 1ERE CISANMO ORTHOŕGUEST COURSE 19 NADH ET SES APPLICATIONS THERAPEUTIQUES Pr. Dr. Dr. George BIRKMAYER 26 COENZYMZ1 NADH EST UNE THERAPIE EFFICACE CONTRE LE CANCER Pr. Dr. Dr. George BIRKMAYER ORTHOŕDZ COURSE 33 MEDECINE ORTHOMOLECULAIRE POUR UN EQUILIBRE ALIMENTAIRE Pr. Hafida MERZOUK 76 LES PATHOLOGIES DENTAIRES : PEUT-ON CONTROLER LES FACTEURS DE RISQUE ? Pr. Chafika MEHDID ORTHOŕDZ RESEARCH 89 FORMULATION WITH CPG OLIGODEOXYNUCLEOTIDES PREVENTS INDUCTION OF PULMONARY IMMUNOPATHOLOGY FOLLOWING PRIMING WITH FORMALIN-INACTIVATED OR COMMERCIAL KILLED BOVINE RESPIRATORY SYNCYTIAL VIRUS VACCINE M. OUMOUNA and Allied ORTHO-DZŕGUEST COURSE 102 LřOBJECTIF DE LřINSTITUT EUROPEEN DES ANTIOXYDANTS EST DřIMPLANTER UNE ANTENNE EN ALGERIE Dr. Smail MEZIANI ISOM-PRESS 104 NOT TAKING SUPPLEMENTS CAUSES MISCARRIAGE, BIRTHING PROBLEMS, INFANT MORTALITY by Andrew W. Saul, Editor (OMNS Jan 27, 2014) 107 A TIMELINE OF VITAMIN MEDICINE BY ANDREW W. SAUL, EDIT OR (OMNS FEB 15, 2014 109 A CASE REPORT AND BIOCHEMICAL RATIONALE BY W. TODD PENBERTHY , PHD AND ANDREW W. SAUL (OMNS MARCH 18, 2014 ) ORTHO-DZ PAPERS 112 HYPERCALCIMIE MEDICAMENTEUSE Dr. Fatima El Zahra AMIA 117 LA PRISE EN CHARGE NUTRITIONNELLE DES STEATOPATHIES HEPATIQUES NON ALCOOLIQUE (METABOLIQUE) Dr Lotfi RAHAL 124 HYGIENE DE VIE DřUNE GASTRECTOMIE Mohamed Rachad BOUMOKOHLA 129 RHODIOLA ROSEA OU LA RACINE DřOR Dr. Zohra SIDENNAS 132 LřAluminium dans les emballages alimentaires et les ustensiles de cuisine, quel risque pour la santé ? Nesrine SEDJELMACI 136 DE HIROSHIMA À HAMOUDIA ! DU JAPON À L'ALGÉRIE POUR DES RECOMMANDATIONS VIS À VIS DES RADIATIONS NUCLÉAIRES ! Dr. ILYES BAGHLI. 137 El Watan - Dimanche 4 mai 2014 – 5 SÉMINAIRE SUR LA TRAGÉDIE NUCLÉAIRE DE LA FRANCE DANS LE HOGGAR 139 JAPANESE COLLEGE OF INTRAVENOUS THERAPY (JCIT) 141 DR. ILYÈS BAGHLI À LA JAPANESE COLLEGE OF INTRAVENOUS THERAPY (JCIT) 146 Pr Takuji SHIRASAWA et Daniela Chan seront parmi nous pour le séminaire du 26 au 27 décembre 2014. 152 LES NOMS DES VARIÉTÉS DE LA FLORE NORDAFRICAINE EN TAMAZIGHT,ARABE, FRANÇAIS ET LATIN Ourida AIT ALI 156 HALL OF SANMO FAME 161 PROGRAMME FORMATION SANMO C3S2 DU 30-31 MAI 2014 163 Drs ORTHO-DZ SANMO 165 MEMBRES DE LřISOM 166 ORTHOMOLECULAR MEDECINE HALL OF FAME 167 PROGRAMME ET EDITORIAL CONGRES ISOM VANCOUVER 2014 168 2 0 1 4 R I O R D A N I V C & C A N C E R S Y M P O S I U M OCTOBER 2-4 175 INTERVENTION Dr Tahar NAILI AU CONGRES ISOM VANCOUVER 2014 ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 3 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ŖSAMNO is a great success model of orthomolecular medicine. ŗ Dr. Atsuo Yanagisawa 30/09/2013 Atsuo YANAGISAWA Chef de file de la thérapie intraveineuse par la vitamine C au JAPON Président de lřISOM www.orthomoleculaire.org https://www.facebook.com/ilyes.baghl i 4 Dr. Ilyès BAGHLI Le premier semestre de 2014 a été marqué par l'organisation de la première Conférence Internationale de la SANMO en marge du dernier séminaire du second cycle du 24 au 25 janvier 2014 avec la participation du Pr Atsuo Yanagisawa, du Pr Thomas Edward Levy, du Pr Gilbert Henri Crussol, du Pr Smail Meaziani, du Pr Mustapha Oumouna et du Pr Hafida Merzouk. Cette Conférence a vu la remise des Awards de l'Institut Antoine Bechamp par le Pr Giltbert Henri Crussol, Président de cet Institut au Pr Atsuo Yanagisawa, au Pr Thomas Edward Levy, Pr Chafika Mehdid, Pr Mustapha Oumouna, Pr Hafida Merzouk et Dr Ilyes Baghli. En marge cette Conférence Internationale, il a été annoncé la création du Conseil Scientifique de la SANMO, composé du Pr Atsuo Yanagisawa, du Pr Thomas Edward Levy, du Pr Gilbert Henri Crussol, du Pr George Birkmayer, du Pr Chafika Mehdid, du Pr Mustapha Oumouna, du Pr Hafida Merzouk, du Dr Heidi Thomasberger et du Dr Ilyes Baghli. Le Pr Atsuo Yanagisawa a invité Dr Ilyes Baghli a participé à la conférence internationale de la JCIT le 23/03/2014 à Tokyo durant laquelle un stand de la SANMO a été élaboré avec présentation de toutes les publications de la SANMO, ainsi que les résultats de l'étude sur l'association du NADH et de la vitamine C. Une cérémonie a été organisée à cet effet pour la remise de la Certification of Board Member of the Japan College of Intravenous Therapy au Dr Ilyes Baghli, qui rejoint la liste des experts internationaux de la JCIT. Du 28 au 29 mars 2014 a été organisé le premier séminaire du troisième cycle de la SANMO auquel a participé en plus de nos professeurs algériens, le Pr George Birkmayer. Du 25 au 27 avril 2014 a participé Dr Tahar Naili, vice-Président de la SANMO au 43' congrès international de l'ISOM à Fairmount Hôtel à Vancouver au Canada où il a fait le premier discours officiel de la SANMO, après celui du Pr Atsuo Yanagisawa au nom de la SANMO au 42' congrès de l'ISOM à Toronto en avril 2013. Enfin, la SANMO s’apprête a organisé le second séminaire du troisième cycle avec la participation exceptionnelle du Pr Smail Meziani, Président de l'Institut Européen des Anti-oxydant pour présenter en première mondiale le PAOT SKIN TECHNOLOGY en workshop, du Pr Mustapha Oumouna, du Pr Hafida Merzouk, du Dr Tahar Naili avec un compte rendu de sa mission à Vancouver au Canada et enfin du Dr Ilyes Baghli pour présenter les protocoles de la SANMO. Dr Ilyes BAGHLI. Président de la SANMO.-Société Algérienne de Nutrition et de Médecine Orthomoléculaire. ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 5 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE PROTOCOLE 1 SANMO Selon une démarche scientifique ayant combiné le protocole de RIORDAN utilisant la vitamine C, appliqué aux USA et au Japon et la méthode du Pr George BIRKMAYER appliqué en Autriche utilisant le NADH ! Suite à l'étude réalisée au Laboratoire de Biologie de l'Université de Tlemcen combinant le NADH et la vitamine C dans la protection d'une culture de cellules lymphocytaires vis à vis des pesticides. Suite aux dernières études présentant l'intérêt du sélénium combiné à la méthionine, la cystéine ou à des vitamines dans la prévention du cancer du sein et des ovaires réalisée aux USA. Suite à l'application du PROTOCOLE 1 de la SANMO combinant ces trois méthodes: - Méga-dose de NADH: 160 mg par jour ! - Méga-dose de vitamine C: 5 grammes/jour pour la forme lypo-sphérique ou 75 grammes deux fois par semaine pour la forme injectable par voie intra-veineuse. - Une dose quotidienne de 200 ug de sélénométhionine, suite à l'absence d'effets secondaires pour ces trois produits thérapeutiques. Tout ce protocole est proposé durant 03 trois mois comme traitement d'attaque. Des cas de guérison totale sont enregistrés, avec preuves par IRM. Disponibilité de ces patients pour témoigner Ce protocole, dénommé PROTOCOLE 1 de la SANMO, dans le traitement du cancer et certaines maladies chroniques dégénératives tel que la maladie d'Alzheimer et la sclérose en plaque est proposé pour le bien des patients et de l'évolution de l'approche thérapeutique. Respectueusement. Dr Ilyes BAGHLI. Président de la SANMO. °°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°° Membres du Conseil Scientifique de la SANMO ayant apporté leur approbation à ce protocole: Pr Thomas Edward LEVY Pr Glibert Henri CRUSSOL Pr Smail MEZIANI Pr Mustapha OUMOUNA Pr Chafika MEHDID Pr Hafida MERZOUK Pr George BIRKMAYER لسانمتللل1بروتوتول وفقا لمنهج علمي وضعت جنبا إلى جنب ، "البروتوكول ريوردان" المستخدم للفيتامين سالمطبق في الواليات المتحدة األمريكية وفي وأسلوب بيركمايير جورج المطبق في- ،اليابان !NADH النمسا باستخدام وبعد دراسة أجريت في مخبر البيولوجيا من وفيتامينNADH بالجمع بين،جامعة تلمسان (س) في الحفاظ على زراعة خالية لمفاوية ضد وفي أعقاب اىتمام أحدث دراسات- .المبيدات نفذت السيلينيوم جنبا إلى جنب مع الميثيونين أو السيستين أو الفيتامينات في الوقاية من سرطان .الثدي والمبيض في الواليات المتحدة األمريكية سنمو الجمع بين ىذه بعد تنفيذ بروتوكول ا :األساليب الثالثة ملغ فيNADH: 160 جرعة من-ميجا!اليوم الواحد يوم ليبو/ جرام5 :) جرعة فيتامين(س-ميجا جرام مرتين في أسبوع75 كروية الشكل أو .للنموذج القابلة للحقن عن طريق الوريد - ميكروغرام من سيلينو200 جرعة يومية منميثيونين بعد غياب اآلثار لجانبية لهذه المنتجات .العالجية الثالث ثالثة أشهر03 ويقترح ىذا البروتوكول خالل يتم تسجيل حاالت الشفاء التام مع.كعالج أولى ويقترح. األدلة بالتصوير بالرنين المغناطيسي شهادات لهؤالء المرضى لإلدالء بشهادتهم لهذا في، سانمو1 يشار إلى البروتوكول،البروتوكول عالج السرطان وبعض األمراض التنكسية المزمنة مثل مرض الزىايمر ومرض التصلب ىو لصالح والسالم عليكم.المرضى وتطوير النهج العالجية -رئيس جمعية سانموا- إلياس باغلي.د ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ PROTOCOL 1 SANMO According to a scientific approach combined with the RIORDAN protocol using vitamin C, applied in the USA and Japan And the method of Pr. George BIRKMAYER applied in Austria using NADH! Following the study conducted in the Laboratory of Biology at the University of Tlemcen combining NADH and vitamin C in protecting a culture of lymphocytes with respect to pesticides. Following recent studies showing the benefit of combined selenium methionine, cysteine or vitamins in the prevention of breast cancer and ovarian cancer conducted in the USA. Following the application of the PROTOCOL SANMO combining these three methods: - Mega-dose of NADH: 160 mg per day! -Mega-dose vitamin C: 5 grams / day for lypo-spherical or 75 grams twice a week to see the injectable form by intravenous. - A daily dose of 200 ug of selenomethionine Following the lack of side effects for these three therapeutic products. Whatever this PROTOCOL is proposed for three 3 months as an initial treatment. Cases of complete recovery are registered with MRI evidence. Availability of these patients to testify. The following protocol, called PROTOCOL 1 of the SANMO, in the treatment of cancer and certain diseases such as chronic degenerative Alzheimer's disease and multiple sclerosis, is proposed for the benefit of patients and the development of therapeutic approach. Respectfully. Dr Ilyes BAGHLI. Président of SANMO 5 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Récépissé d’enregistrement N°15/DGLPA/DVA/SDA/10 du 04/01/2011 de Déclaration de Création d’une Association Nationale dénommée: ًت الجزٌئ ّ ّالجوعٍة الجزائزٌة للتّغ ّذي والط ' Société Algérienne de Nutrition et de Médecine Orthomoléculaire' du 13/10/ 2010 Ojectifs principaux. - Recherche.- Formation médicale continue.- Information et sensibilisation.- Participation à des activités de prévention. Objectifs secondaires. - Formation post-universitaire pour tout Linus PAULING ابن سينا AVICENNE 1037-980م/هـ428-370 La Médecine Orthomoléculaire est la préservation de la santé et le traitement de toutes les maladies, par la modification de la concentration des substances, qui sont normalement présentes dans l'organisme et qui sont nécessaires pour la santé. médecin. - Promouvoir le bien-être physique et mental des patients. - Amélioration de l'état de santé des patients présentant des carences en vitamines, micro-nutriments et oligo-éléments, - Amélioration de la performance sportive. SOCIETE ALGERIENNE DE NUTRITION ET DE MEDECINE ORTHOMOLÉCULAIRE 7 Rue des Frères Khanouche Ŕ Kouba- ALGER ALGERIE Abram HOFFER, M.D., Ph.D. ِ اعةَ أَح ُّق اعة يَنْ ِز ُل ِّ إِ َّن َى ِذ ِه َ َصن َ َ َالصن ِ .الج ْزئِيَّ ِة َما أ َْم َك َن ُ ف َيها إِلَى األ ُُموِر ابن رشد AVERROES 1198-1126 م/ هـ595-520 6 "Orthomolecular treatment does not lend itself to rapid drug-like control of symptoms, but patients get well to a degree not seen by tranquilizer therapists who believe orthomolecular therapists are prone to exageration. Those who've seen the results are astonished." ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ Dépôt légal : ISSN 2170-1539 BN 2777-2011 Tous droits réservés par Société Algérienne de Nutrition et de Médecine Orthomoléculaire Pour toute correspondance avec la Société Algérienne de Nutrition et de Médecine Orthomoléculaire [email protected] www.orthomoleculaire.org En marge de l'Assemblée Générale Extraordinaire de la SANMO organisée le 11/01/2014 pour la mise en conformité avec la nouvelle loi sur les associations du 12/01/2012, le Bureau de la SANMO a été reconduit à l'unanimité des voix pour un nouveau mandat de cinq ans avec adoption du bilan moral et financier çi-joint. Dr Ilyes BAGHLI.assumant la Présidence de la SANMO du 11/01/2014 au 10/01/2019. ORTHO 12 7 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE LA SOCIETE ALGERIENNE DE NUTRITION ET DE MEDECINE ORTHOMOLECULAIRE ORGANISE DES CYCLES DE FORMATION CONTINUE CYCLE I C1S1 27-28 Oct. 2011 C1S2-S3 26-27-28 Avril 2012 C1S4 01-02 Juin 2012 Chaque CYCLE de formation se C1S5 12-13 Oct. 2012 déroulera sous forme de séminaires repartis sur 06 modules et totalisant un volume horaire de 96 heures C1S6 25-26 Janv. 2013 Objectif de la formation Il s‟agit d‟initier en priorité les praticiens à la compréhension des grands mécanismes physiologiques et biochimiques qui gèrent le fonctionnement de l‟organisme. Le but de cette formation en médecine ortho-moléculaire est d‟arriver à comprendre le rôle des micronutriments et d‟identifier les anomalies biochimiques liées à leur carence ou leur excès. Avec ces bases, le praticien sera capable de comprendre la relation existante entre une alimentation inadéquate et le développement de nombreuses pathologies telles que la dépression, les maladies cardio-vasculaires, les maladies dégénératives, les maladies autoimmunes ou les cancers. Au bout de cette formation, il saura ainsi faire un bilan de terrain et pourra reconnaître cliniquement les désordres liés aux manques et conseiller, à titre curatif ou préventif, une administration appropriée en vitamines, en minéraux et oligo-éléments, en acides gras essentiels et en acides aminés. CONDITION D'INSCRIPTION: ETRE MEDECIN / BIOLOGISTE / MICROBIOLOGISTE / PHARMACIEN / AGRONOME / VETERINAIRE / BIOCHIMISTE / CHIMISTE / PSYCHOLOGUE / DENTISTE / DIETETICIEN. DOSSIER D'INSCRIPTION : COPIE DU DIPLOME - COPIE DřUNE PIECE D'IDENTITE PHOTO D'IDENTITE A ADRESSER PAR MAIL [email protected] www.orthomoleculaire.org FORMATION ET PERFECTIONNEMENT EN NUTRITION ET EN MEDECINE ORTHOMOLEUCLAIRE Il est possible de s'inscrire directement au prochain séminaire, car il s'agit d'un cycle de formation médicale continue. CYCLE II C2S1 22-23 Mars 2013 C2S2 24-25 Mai 2013 C2S3 28-29 Juin 2013 C2S4 20-21 Sept. 2013 C2S5 25-26 Oct. 2013 C2S6 24-25 Janv. 2014 CYCLE III C3S1 28-29 Mars 2014 C3S2 30-31 Mai 2014 C3S3 10-11 Oct. 2014 C3S4 28-29 Nov. 2014 C3S5 26-27 Dec. 2014 C3S6 23-24 Janv. 2015 ORTHO DEFINITIONS Le radical "ortho" signifie "juste", "correct", "ajusté". Le mot exprime que nous interférons avec les processus physiologiques et pathologiques du corps humain au niveau moléculaire, pour ainsi dire que l'on ajuste les molécules. La définition de l'expression "Médecine Ortho-Moléculaire" remonte à Linus Pauling -Prix Nobel- et a été créée en 1968. Au sujet de la Médecine OrthoMoléculaire, Linus Pauling a dit que c'était: "La préservation de la bonne santé et le traitement de la maladie en variant les concentrations dans le corps humain des substances qui sont normalement présentes dans le corps et sont nécessaires pour la santé. L'adjectif "orthomoléculaire" est utilisé pour exprimer l'idée des molécules justes dans la bonne concentration". ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ CYCLE III C3S1 28-29 Mars 2014 - La médecine orthomoléculaire ou médecine des micro nutriments. - Diététique - Alimentation - Compléments alimentaires. - Les Vitamines: * La vitamine A. * La vitamine E. * La vitamine D. * La vitamine K. - * La vitamine C. * La vitamine B12. - Coenzyme Q10. –Radicaux libres, stress oxydatif et antioxydants. C3S2 30-31 Mai 2014 - Les vitamines hydrosolubles : - Vitamines du groupe B : * B1 thiamine * B2 riboflavine * B3 Niacine * B5 acide pantothénique * B6 pyridoxine * B9 acide folique - Acide alpha-lipoïque. - Trace éléments : sélénium, le fer, le zinc. - Cryptopyrrolurie - Nutriments accessoires : biotines dřinositol, acide para-amino-benzoïque. C3S3 10-11 Oct. 2014 - Les acides gras insaturés. - Maladie cardio-vasculaire. - Lřhomocystéine. - Le diagnostic en micronutriments : * Analyse des oligo-éléments * Les minéraux et vitamines - Trace éléments : chrome, le manganèse, le cuivre, le molybdène: - Les possibilités orthomoléculaires en dermatologie. C3S4 28-29 Nov. 2014 Le milieu interieur. - L'équilibre acido-basique. - Le glutathion. - Les acides aminés. - Le magnésium et le calcium. - Le système cytochrome P450 . - Les métaux lourds et le mécanisme de détoxification. - Les interactions dans la micronutrition. C3S5 26-27 Dec. 2014 - Les Possibilités orthomoléculaires dans: * Le diabète sucré. * Le syndrome métabolique. * Lřostéoporose. * Lřarthrite rhumatoide. * Les infections récurrentes. * La dégénérescence maculaire * Les autres maladies des yeux. * Le syndrome du Burn-out. - La sérotonine et la mélatonine. C3S6 23-24 Janv. 2015 - Potentiel dans le traitement du cancer. - Micro-nutriments dans l'hormonothérapie. - Enzymes. - Médecine dentaire et oligo-éléments. - Intra-veinotherapie. 7 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO-PRESSBOOK APS Mer. 26 Février 2014 SANTE - SCIENCE & TECHNOLOGIE UNE CONSOMMATION QUOTIDIENNE DE VITAMINE C PRÉVIENT L'APPARITION DES CANCERS ALGER - La vitamine C, consommée régulièrement, protège des cancers et s'avère une bonne prévention pour les personnes exposées aux radiations nucléaires, a indiqué, mercredi à Alger, le Dr. Ilyes Baghli, le président de la Société algérienne de nutrition et de médecine ortomoléculaire (SANMO). La vitamine C est un puissant antioxydant et est à la fois efficace comme thérapeutique et prévention contre les maladies non transmissibles, notamment le cancer, a souligné le Dr. Baghli à l'APS. Le Dr. Baghli a estimé qu'une consommation quotidienne de 3 gr de vitamine C protégerait de diverses pathologies comme le cancer, les maladies neuro-dégénératives (Alzheimer), les maladies autoimmunes, les anomalies congénitales et les troubles cardiovasculaires. Il a aussi souligné dans ce sens que la consommation de cinq fruits et légumes par jour n'était pas suffisante et qu'une supplémentation médicale se révélait plus efficace pour éviter les carences et les pathologies. Le Dr. Baghli a également préconisé aux habitants des régions touchées par les essais nucléaires une 8 alimentation plus riche en vitamine C (12 gr/jour) pour une protection optimale. S'agissant des manipulateurs en radiologie, la vitamine C apparaît aussi comme une bonne protection contre les effets secondaires des radiations ionisantes. En outre, la vitamine C n'est pas le seul nutriment aux vertus préventives car d'autres molécules ont des effets tout aussi prophylactiques comme la vitamine E, la vitamine B3 et le sélénium. Ces nutriments sont retrouvés principalement dans les aliments suivants: légumes frais, légumes secs, levure de bière, les huiles, poissons, jaunes d'œufs, champignons, ail, oignons et autres. Le Pr. Atsuo Yanagisawa, président de la société internationale de médecine orthomoleculaire (ISOM) et partenaire de la SANMO a à ce titre mis en évidence l'avantage de l'association de la vitamine C et de la vitamine B3 pour une meilleure protection contre les maladies chroniques. A ce propos, le Dr. Mohamed Nait Djoudi, chargé de l'homologation des dispositifs médicaux au ministère de la Santé a estimé que la vitamine C pouvait être une bonne méthode de traitement et de prévention contre les cancers. Il a ajouté que la vitamine C avait des intérêts nutritionnels incontestables et qu'elle pourrait à fortes doses prévenir et traiter les tumeurs. ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 9 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO-PRESSBOOK ORTHO-PRESSBOOK Santé MAG N°27 Fév. 2014 p.2 DK-NEWS 1' Avril 2014. TRAITEMENT DU CANCER Une nouvelle approche médicale conçue par des médecins algériens Par Sonia Belaidi Une nouvelle thérapeutique médicale innovante et donnant de bons résultats contre le cancer et d‟autres maladies dégénératives a été mis au point par la Société algérienne de nutrition et de médecine orthomoléculaire (Sanmo). Cette thérapeutique a été testée «efficacement»sur des malades atteint de cancer et a permis une rémission totale de ces patients. Le Dr Ilyes Baghli, président de la Sanmo a expliqué que cette technique consiste en la consommation de doses importantes de vitamines par voie orale ou par intraveineuse.Il a ajouté à ce propos que la vitamine C associée à la NADH est un traitement efficace contre les maladies dégénératives comme le cancer. «L'association de la vitamine C et de la NADH s'avère être un traitement efficace contre les maladies dégénératives à l'instar du cancer, de l'Alzheimer et du Parkinson.Cette combinaison a donné de bons résultats chez des malades atteints de cancer», a précisé le Dr Baghli. La même combinaison est aussi efficace à titre préventif contre les maladies cardiovasculaires (hypertension artérielle) et les maladies métaboliques (obésité, diabète), a ajouté le Dr Baghli. Ce traitement a été testé par l'équipe de la Sanmo, dans le laboratoire de biologie de l'Université de Tlemcen, sur une culture de cellules imprégnées de pesticides. Les cellules infectées par ces toxines ont été préservées grâce à l'inoculation de doses importantes de NADH et de vitamine C. Etant donné que cette thérapeutique associe des produits naturels et des nutriments sains, elle n‟a donc aucun effet secondaire et indésirable contrairement aux médicaments synthétiques. Les effets relatifs à la chimiothérapie comme les nausées, les chutes de cheveux et les fatigues ne sont pas ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 9 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE observés dans ce nouveau type de traitement. La vitamine C associée à la NADH prévient aussi les maladies Ce même remède a été testé sur des malades atteints de cancer à différents stades et dont la pathologie est en «rémission totale», selon le président de la Sanmo. La vitamine C associée à la NADH joue aussi un rôle préventif chez les personnes travaillant dans les zones radioactives et chez le personnel soignant manipulant des appareils radiologiques.Parmi les avantages de cette nouvelle méthode thérapeutique, le spécialiste a cité l'absence d'effets secondaires contrairement aux traitements classiques. Appel à la généralisation de cette thérapeutique en Algérie Cette nouvelle thérapeutique, intitulée «protocole 1 de la Sanmo», a été présentée au collège japonais de la thérapie intraveineuse et au Pr Birkmayer en 10 retraite, ancien consultant de l'université de Graaz, qui l'ont «favorablement adoptée», selon Dr Baghli. Il a indiqué que ces résultats scientifiques lui ont valu le «titre d'expert international au collège japonais de la thérapie intra-veineuse». Le Dr Ilyes Baghli a appelé à la généralisation du protocole de la Sanmo à travers tout le territoire nationale pour pallier les insuffisances médicales liées au retard dans les rendez-vous de radiothérapie pour les malades atteints de cancer.Il a aussi précisé que ces produits pharmaceutiques ne coûtent pas cher étant donné que ce sont des produits naturels. “Ces produits sont efficaces et accessibles à tous les citoyens”, a-t-il estimé. Le protocole 1 de la Sanmo a été transmis au ministère de la Santé, de la Population et de la Réforme hospitalière qui l'a accueilli favorablement, a précisé son concepteur. Le prochain séminaire de la Sanmo sera organisé les 30 et 31 mai prochains a Alger, a annoncé le Dr Baghli. ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 11 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO-PRESSBOOK APS , 30 Mars 2014 SANTE - SCIENCE & TECHNOLOGIE ŖVitamine C associée à la NADH, traitement efficace contre les maladies dégénérativesŗ ALGER- La vitamine C associée à la NADH est un traitement efficace contre les maladies dégénératives comme le cancer, l'Alzheimer et le Parkinson, ont estimé lundi à Alger des nutritionnistes. "L'association de la vitamine C et de la NADH s'avère être un traitement efficace contre les maladies dégénératives à l'instar du cancer, de l'Alzheimer et du Parkinson. Cette combinaison a donné de bons résultats chez des malades atteints de cancer", a précisé à l'APS le Dr. Ilyes Baghli, président de la Société algérienne de nutrition et de médecine orthomoléculaire (SANMO), lors du 13e séminaire de la Société. La même combinaison est aussi efficace à titre préventif contre les maladies cardiovasculaires (hypertension artérielle) et les maladies métaboliques (obésité, diabète), a ajouté le Dr Baghli. Ce traitement a été testé par l'équipe de la SANMO, dans le laboratoire de biologie de l'université de Tlemcen, sur une culture de cellules imprégnées de pesticides. Les cellules infectées par ces toxines ont été préservées grâce à l'inoculation de doses importantes de NADH et de vitamine C. Ce même remède a été testé sur des malades atteints de cancer à différents stades et dont la pathologie est en "rémission totale", selon le président de la SANMO. La vitamine C associée à la NADH joue aussi un rôle préventif chez les personnes travaillant dans les zones radioactives et chez le personnel soignant manipulant des appareils radiologiques. Parmi les avantages de cette nouvelle méthode thérapeutique, le spécialiste a cité l'absence d'effets secondaires contrairement aux traitements classiques. Cette nouvelle thérapeutique, intitulée "protocole 1 de la SANMO", a été présentée au collège japonais de la thérapie intraveineuse et au Pr Birkmayer en retraite, ancien consultant de l'université de Graz en Autriche, qui l'ont "favorablement adoptée", selon Dr Baghli. Il a indiqué que ces résultats scientifiques lui ont valu le "titre d'expert international au collège japonais de la thérapie intraveineuse". Le protocole 1 de la SNAMO a été transmis au ministère de la Santé, de la Population et de la Reforme hospitalière qui l'a accueilli favorablement, a précisé son concepteur. Le prochain séminaire de la SANMO sera organisé les 30 et 31 mai prochains à Alger, a annoncé le Dr Baghli. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 11 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO-PRESSBOOK L'interview du Dr Ilyes BAGHLI avec la revue médicale Santé-Mag Santé-MAG N°28 - Mars 2014 "Nous avons présenté des solutions, à la tutelle, pour contrecarrer les effets néfastes des poussières radioactives, sur la santé" Dr Ilyes Baghli*, à Santé Mag, Propos recueillis par Tanina Ait La presse française du 14 février 2014 a révélé l'étendue de la contamination nucléaire, en Algérie, suite à l'essai nucléaire du 13 février 1960, à Reggane ! La contamination radioactive et son impact sur la santé sont bien démontrés, par les spécialistes, dans le domaine, qui précisent, en outre, que les effets de la radioactivité persistent plus de 100 ans après les essais nucléaires. La population du Sud algérien est la plus exposée au risque de maladies graves que celle des autres regions ; en raison des poussières radioactives, toujours répandues dans les eaux souterraines et la flore. Cela représente, inévitablement, un danger pour la santé humaine et animale. Le Docteur Ilyes Baghli, président de la Société algérienne de nutrition et de médecine ortho-moléculaire, y revient, dans cet entretien, accordé à Santé Mag et surtout, propose des solutions, pour contrecarrer ces effets néfastes, pour la santé humaine. Santé Mag: Existe-t-il un réel impact de la radioactivité sur notre santé? Dr Ilyes Baghli: Oui, les études ont montré que l'atteinte directe 12 n'est que de 20%, alors que l'atteinte indirecte; par l'eau, particulièrement, l'air, le bétail, les aliments et les matériaux de construction représentent 80%. Quelles sont, géographiquement, les zones de l'Algérie les plus touchées par ces irradiations ? Toute l'Algérie est touchée par les radiations nucléaires; mais, surtout, les zones où ont eu lieu les essais nucléaires français: Reggane, dans la wilaya d'Adrar ! A noter que le 1" essai du 13/02/2014 appelé „‟Gerboise bleue‟' était de 70 kilo-tonnes, alors que celle de Hiroshima du 06/08/1945 était de 15 kt et celle de Nagazaki était de 17 kt. Trois autres explosions furent effectuées, en ce lieu, par la suite: 01/04/1960 Gerboise blanche, moins de 5 kt 27/12/1960 Gerboise rouge, moins de 5 kt 25/04/1961 Gerboise verte, moins de 5 kt. In Ecker dans la wilaya de Tamanrasset ! Après le dernier essai atmosphérique Gerboise verte, les 13 tirs souterrains, qui suivirent, furent effectués plus au sud, près d'In Ecker, dans le massif du Hoggar. Quatre essais souterrains, sur treize, n'ont pas été totalement contenus, ou confinés: Béryl du 01/05/1962, Améthyste du 30/03/1963, Rubis du 20/10/1963 et Jade du 30/05/1965. Les essais Béryl et Améthyste ont conduit à une irradiation ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ dépassant le seuil réglementaire. La France procédera, finalement, à 17 essais nucléaires dans le Sahara, de 1960 à 1966. Sans oublier, les essays chimiques réalisés dans le champ de tir B2-Namous à Hamaguir, dans la wilaya de Bechar ! Quelle a été l'étendue de la conta mination radioactive, en Algérie et dans les pays limitrophes, suite à l'explosion nucléaire "Gerboise bleue" du 13/02/1960 ? Il faut savoir que, selon la cartographie, déclassée, du secret-défense, par l'armée française, démontre les données suivantes: Le 14/02/1960: In Salah en Algérie, Agadez au Niger et N'Djamena au Tchad furent contaminées, en raison d'un vent sud-est, le jour de l'explosion de la Gerboise bleue. Le 15/02/1960: Yaoundé, au Cameroun, fut contaminée. Le 16/02/1960: Tamanrasset en Algérie, Niamey au Niger, Ougadougou au Bukina Fasso furent contaminées. Le 17/02/1960: Bamako du Mal, Abidjan en Côte d'Ivoire, Accra au Ghana et Lagos au Nigéria furent contaminées. Le 18/02/1960: Conakry de la Guinée fut contaminée. Le 19/02/1960: Tindouf en Algérie, Nouakchout en Mauritanie, Tripoli en Libye furent contaminées. Le 20/02/1960: Ouargla en Algérie, Dakar au Sénégal furent contaminées. ORTHO 12 13 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Le 21/02/1960: Béchar fut contaminée. Le 24/02/1960: Alger, Oran, Tlemcen en Algérie, Oujda, Fès au Maroc, Alicante en Espagne furent contaminées. Le 25/02/1960: Rabat, Tétouane au Maroc, Sétif, Constantine, Annaba en Algérie, Bedja, Tunis en Tunisie, le sud de la Sicile, le sud de la Corse et le sud de l'Espagne furent contaminées. Au soir du 25/02/1960: Toute l'étendue de l'Algérie fut, totalement, contaminée. Quelles sont les conséquences, à long terme, de cette contamination? Les conséquences des irradiations sont désastreuses pour la faune, la flore, l'homme et l'environnement. Faut-il le rappeler, la demi-vie de l'uranium 235 est de 24 000 ans! D'ailleurs, sur le terrain, la radiation est toujours aussi forte, plusieurs dizaines de fois plus forte que la radioactivité naturelle. Différentes pathologies dont les cancers (cancer de la thyroïde, cancer du poumon, cancer du sein, leucémie) et certaines anomalies congénitales, etc. peuvent avoir été induites par l'irradiation ainsi subie. Des poussières radioactives, répandues dans les eaux souterraines et la flore, représentent un danger pour la santé humaine et animale. Existe-t-il d'autres formes de contaminations, néfastes pour la santé? Les radiations provoquées par les examens radiologiques peuvent être source de rayonnements: Radiographie d'un membre, l'équivalent d'un jour et demi. Panoramique dentaire,l'équivalent de 4 jours. Radiographie pulmonaire, l'équiva lent de 7 jours. Mammographie, l'équivalent de 20 jours. Scanner du crâne et radiographie abdominale, l'équivalent de 300 jours. Scanner du thorax, l'équivalent de 900 jours. Scanner abdomino-pelvien, l'équivalent de 1500 jours. Pour ceci, il est nécessaire d'aller vers des supplémentations preventives quotidiennes, pour assurer une médecine préventive à chaque citoyen, dans un esprit serein et pour assurer une réduction des pathologies chro niques dégénératives, dues aux radiations nucléaires et aux radia tions radiologiques d'origine iatro gène; sans oublier les effets de la pollution atmosphérique, due au monoxydes de carbone et de la pollution électro magnétique, due aux différents réémetteurs de telecom munications, qui nous permettent, par contre, de vous communiqué ces recommanda tions: Prendre soin de soi-même est possible, loin d'un esprit de thématique tabou mais dans un esprit de prévention, rigoureux et efficace. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ Y a- t-il des solutions, pour réduire leur impact sur la santé? Oui, car la principale source de contamination est tardive, constituant 80% des nuisances radioactives. Il existe un protocole préventif, présenté par la SANMO, combinant le protocole japonais-américain et le protocole autrichien, adopté en Chine, pour améliorer les moyens de prévention, vis à vis des radiations nucléaires, par une supplémentation efficace. Il reste entendu que votre Société savante, la SANMO, a reçu des sommités en la matière, tels que les Professeurs Thomas Levy, des Etats Unis, Atsuo Yanagisawa, du Japon, George Birkmayer, de l'Autriche, Gilbert Crussol, de l'Espagne. Quelles sont les solutions, qu'ils ont proposées, pour prévenir les effets néfastes des irradiations ? Le protocole, présenté par Pr George Birkmayer se base sur une dose, quotidienne, de 80 mg de NADH. Le protocole, présenté par le Pr Atsuo Yanagisawa se base sur une dose quotidienne de: Vitamine C: de 3 à 12 grammes, selon les zones et 25 grammes, pour les zones hautement contaminés. Vitamine E: 200 à 400 mg Sélénium: 100 à 400 ug "microgrammes" Acide lipoïque: 200 à 600 mg 13 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Avez-vous proposé ces solutions, à la tutelle ? Oui, au ministère de la Santé et à la Direction Centrale de la Santé militaire. Avez-vous des cas concrets à nous citer? Il suffit de voir l'étendue de l'épidémie des maladies chroniques dégénératives, en Algérie, à type de sclérose en plaque, maladie d'Alzheimer et cancer ! Dans la pratique préventive, l'expérience réalisée à Fukushima, au Japon, suite à l'accident nucléaire de mars 2011, est significatif: Fukushima, au Japon, suite à l'accident nucléaire du 13/03/2011, suite au séisme et tsunami du 11/03/2011, où la vitamine C, à 25 grammes, par voie intraveineuse, a été administré à 16 employés, qui ont eu, grâce à cette méthode et celles classiques, une préservation des facteurs cancérigènes, par rapport au restes des employés, qui n'ont eu recours qu'aux méthodes classiques: tenue spéciale, douche et nettoyage. Suite à ceci la JCIT (collège japonais de thérapie intraveineuse), présidé par le Pr Atsuo Yanagisawa et co-signé par le Pr. Burton Burkson; Thomas Edward Levy; Ronald Hunnighake; Bradford Weeks; Steven Hickey et Masachi Uwabu, le 29/03/2011, émit les 14 recommandations suivantes, pour la prévention, vis à vis des radiations nucléaires: Vitamine C: 1 à 3 grammes 3 à 4 fois par jour, ou Vitamine C liposphérique: 1 à 2 grammes, deux fois par jour. Acide alpha-lipoïque: 100 à 300 mg, deux fois par jour. Sélénium: 50 ug à 200 ug, deux fois par jour. Vitamine E: 100 à 200 mg, deux fois par jour. Pour ceux qui travaillent au niveau des zones contaminées, en plus de ces recommandations, une perfusion de vitamine C, de 25 grammes, par voie intraveineuse. Ce protocole a été approuvé par la SANMO, suite aux deux présentations du Pr Atsuo Yanagisawa, Président de la JCIT et de l'ISOM (Société internationale de médecine orthomoléculaire), dont la SANMO est membre depuis février 2011, lors des séminaires organisés à Alger, le 24 janvier 2013 et le 25 janvier 2014, en présence des membres de la SANMO et des médecins de la Direction Centrale de la Santé Militaire ! A ce protocole, 80 mg de NADH, ou co-Enzyme1, élaborée grâce aux travaux du Pr George Birkmayer, en Autriche, est, également, préconisée; vu les etudes ayant prouvé l'effet potentiel du NADH sur la vitamine ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ C et vice-versa, effectuées au niveau du laboratoire de biologie de l'université de Tlemcen, dirigé par le Pr Hafida Merzouk et vu les etudes effectués en Chine, qui ont prouvé l'efficacité du NADH, dans la protection vis à vis des radiations nucléaires. La SANMO préconise de combiner ces deux méthodes, pour optimiser la prévention ! Existe-il une supplémentation nutritive efficace de la vitamine C? Parmi la prévention alimentaire, les aliments riches en vitamine C restent insuffisants. Pour assurer une protection optimum: 170 mg de vitamine C, par 100 grammes de persil. 100 mg de vitamine C, par 100 grammes de kiwi. 55 mg de vitamine C, par 100 grammes de fraise. 55 mg de vitamine C, par 100 grammes d'orange. Mais, il n'est pas évident d'atteindre la dose de 3 grammes, minimum, par une simple alimentation, car les besoins sont élevé; mais, ceci, néanmoins, permet de réduire le déficit ! La prévention et la prise de conscience est la voie nécessaire, pour un lendemain meilleur, pour la santé du citoyen ! Dr Ilyes BAGHLI. Président de la Société Algérienne de Nutrition et de Médecine Orthomoléculaire. ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 15 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 16 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ًالجوعٍة الجزائزٌة للتغذي والطت الجزٌئ ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE SOCIETE ALGERIENNE DE NUTRITION ET DE MEDECINE ORTHOMOLECULAIRE PROGRAMME SANMO C3S1 Séminaire 1 Cycle III 28-29 Mars 2014 ALGER Vendredi 28 Mars 2014 10h.30 1. NADH et ses applications thérapeutiques Vendredi 28 Mars 2014 8h.30 LES PATHOLOGIES DENTAIRES: PEUT-ON CONTROLER LES FACTEURS DE Pr George BIRKMAYER MD Phd Doctorat en Biochimie Université de VIENNE AUTRICHE Samedi 29 Mars 2014 14h.00 NADH EST UNE THÉRAPIE EFFICACE CONTRE LE CANCER. 2 RISQUE ? Pr Chafika MEHDID : Spécialiste en Odontologie Conservatrice Odontologie CHU Béni MessousMaitre de Conférence A en Odontologie – Conservatrice Endodontie INESSM Alger Samedi 23 Mars 2014 08h.30 Introduction à la nutrition et à la médecine ortho moléculaire Chaque CYCLE de formation se déroulera sous forme de séminaires repartis sur 06 modules et totalisant un volume horaire de 96 heures Objectif de la formation Il s‟agit d‟initier en priorité les praticiens à la compréhension des grands mécanismes physiologiques et biochimiques qui gèrent le fonctionnement de l‟organisme. Le but de cette formation en médecine orthomoléculaire est d‟arriver à comprendre le rôle des micronutriments et d‟identifier les anomalies biochimiques liées à leur carence ou leur excès. Avec ces bases, le praticien sera capable de comprendre la relation existante entre une alimentation inadéquate et le développement de nombreuses pathologies telles que la dépression, les maladies cardio-vasculaires, les maladies dégénératives, les maladies auto-immunes ou les cancers. Au bout de cette formation, il saura ainsi faire un bilan de terrain et pourra reconnaître cliniquement les désordres liés aux manques et conseiller, à titre curatif ou préventif, une administration appropriée en vitamines, en minéraux et oligo-éléments, en acides gras essentiels et en acides aminés. CONDITIONS D'INSCRIPTION POUR UNE FORMATION ET PERFECTIONNEMENT SANMO EN NUTRITION ET EN MEDECINE ORTHOMOLECULAIRE ETRE MEDECIN / BIOLOGISTE / PHARMACIEN / AGRONOME / BIOCHIMIST / CHIMISTE /DENTISTE / DIETETICIEN DOSSIER D'INSCRIPTION: - COPIE DU DIPLOME -COPIE DřUNE PIECE D'IDENTITE -PHOTO Pr. Hafida MERZOUK Directrice du Laboratoire PHYSIO, PHYSIO PATHOLOGIE ET BIOCHIMIE DE LA NUTRITION - TLEMCEN – Vendredi 28 Mars 2014 14h.00 IN TROD UC TION À L' IMMUNO LOG IE I M M UN OL O G I E I N N ÉE ET I M M UN OL O G I E A C QU I S E Pr. Mustapha OUMOUNA M.Sc. Phd. Immunologie Ŕ Microbiologie Responsable Section Biologie Faculté Sciences et Technologie Université Yahia Fares Médéa A ADRESSER PAR MAIL [email protected] ou utiliser notre contact www.orthomoleculaire.org ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ CYCLE III C3S1 28-29 Mars 2014 - La médecine orthomoléculaire ou médecine des micro nutriments.- Diététique - Alimentation Compléments alimentaires.- Les Vitamines: * La vitamine A. * La vitamine E. * La vitamine D. * La vitamine K.- * La vitamine C. * La vitamine B12.Coenzyme Q10. –Radicaux libres, stress oxydatif et antioxydants. C3S2 30-31 Mai 2014 - Les vitamines hydrosolubles : - Vitamines du groupe B : * B1 thiamine * B2 riboflavine * B3 Niacine * B5 acide pantothénique * B6 pyridoxine * B9 acide folique- Acide alphalipoïque. - Trace éléments : sélénium, le fer, le zinc. - Cryptopyrrolurie- Nutriments accessoires : biotines, d‟inositol, acide para-amino-benzoïque. C3S3 29-30 Aout 2014 - Les acides gras insaturés.- Maladie cardiovasculaire. - L‟homocystéine.- Le diagnostic en micronutriments : * Analyse des oligoéléments : * Les minéraux et vitamines :- Trace éléments : chrome, le manganèse, le cuivre, le molybdène :- Les possibilités orthomoléculaires en dermatologie. C3S4 10-11 Oct. 2014 Le milieu interieur.- L'équilibre acido-basique. - Le glutathion.- Les acides aminés.- Le magnésium et le calcium.- Le système cytochrome P450 .- Les métaux lourds et le mécanisme de détoxification.- Les interactions dans la micronutrition. C3S5 28-29 Nov. 2014 - Les possibilités orthomoléculaires dans : * Le diabète sucré. * Le syndrome métabolique. * L‟ostéoporose. * L‟arthrite rhumatoide. * Les infections récurrentes. * La dégénérescence maculaire * Les autres maladies des yeux. * Le syndrome du Burn-out.- La sérotonine et la mélatonine. C3S6 23-24 Janv. 2015 - Potentiel dans le traitement du cancer. - Micro-nutriments dans l'hormonothérapie. - Enzymes. - Médecine dentaire et oligo-éléments. - Intra-veinotherapie. 17 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE PARTICIPANTS Au Séminaire 1 du Cycle III C3S1 ALGER 28-29 Mars 2014 LISTE DES MEMBRES SANMO EN FORMATION: Abdelhamid AIT-SAADI Akila LAIB Amel BOUREZAK Amel KORRICHI Amina-Chahinez BENDJELIDA Amina KHECHNA Anissa TABBI Bahia-Abir GHLAIMI Baya EL-ORABI Baya KEBIR Djamila ISSAD El-Batoul CHERIF Fadela CHAOUCHE Faiza ZOBIRI Farida DJAALAB Fatema-Zohra AMIA Fetta TERBOUCHE Fouzia KOLEI Hadia MANTIZI Hakima AIT-HAMMI Hamza-Amanoullah MEKRI Hanane ABDERRAHIM Hanifa BRAHIMI Houria SEGHIR Houria TAMELIKECHT-ABBAD Kebel HADDAD Khira ATBI Khoudja HAMDACHE Lamia MAHIDDINE Leila MOUZALI Lotfi BENMANSOUR Mohamed MAROUF-ARIBI Mohamed-Rachad BOUMOKOHLA Mohamed TAYEB Mouna TALEB Mounira BOUAIFIA Mounira LATRECHE-DOUAIFIA Nabila LADDI Nabila OUMEDJKANE Nadia BELAID Nassera-Farida BELGOMRI-HALLOUCHE Nassima HASDANE Nesrine DOUFFI Samira BOUSSAID Souad MEDJDOUB Souraya GHARSEDDINE 18 Yasmina DJERBAL Zohra AIT-MAHIEDDINE Zohra SIDENNAS MEMBRES DE LA SANMO EN PERFECTIONNEMENT C3S1 Abdellah DIB Abdelkrim DJERRAD Assia GHEMATI Dahbia SOUCI-MAHIEDDINE Djamila-Leila BENAZZA Hayet-Nadia ZITOUN Khadidja IOUALEN-AISSANI Missoum FERHAT Samira OUMEDJKANE Souad HAMADI MEMBRES DU BUREAU DE LA SANMO: Ilyes BAGHLI Tahar NAILI Ali ASBAI Larbi DJAKRIR Toufik SAADOUN INVITES DřHONNEUR -Son Excellence Aloisa WORGETER, Ambassadeur dřAutriche à Alger -Isabel WEICKEN, Epouse du Pr. George BIRKMAYER -Mr. Seini YAYE de Niamey ŔNIGER- Zakia BOUHADJA épouse d'un patient atteint de sclérose en plaque actuellement sous traitement - Abdelhaifd SEMSAR, patient ayant bénéficié du traitement orthomoléculaire avec succès - Nora MOHAMMEDI, soeur d'un patient, elle est venue spécialement de France, uniquement pour le séminaire , pour s'enquérir des nouveautés scientifiques. MEDIATISATION: Ourida Ait-Ali de Santé-Mag et du Midi-libre. Nor El Houda BOUZEGAOU de Canal Algérie avec toute l'équipe technique sous la direction de Mr Yazid AITMAHIDDINE. La SANMO a honnoré Nor El Houda BOUZEGAOU journaliste à Canal Algérie TV d'un tableau d'honneur SANMO-ISOM remis par le Pr George BIRKMAYER pour tous les efforts consentis par cette journaliste et par Canal Algérie pour promouvoir la vulgarisation de la nutrition et la médecine orthomoléculaire en Algérie et à travers la télévision à travers le monde. ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO-GUEST COURSE Lecture 1 - Part 2 1.NADH et ses applications thérapeutiques NADH and Chronic Fatigue Syndrome Study at Georgetown University Washington • 72% of the patients showed improvement of their symptoms and their general energy level after 6 months (10 mg NADH/daily) • 72% des patients ont montré une amélioration de leurs symptômes et de leur niveau d'énergie générale après 6 mois (10 mg de NADH / jour) • Therapeutic effects of oral NADH • on the symptoms of patients with • chronic fatigue syndrome • LM.Forsyth, HG.Preuss, AL.McDowell • L.Chiazze, GD.Birkmayer and J.Bellanti • ANNALS OF ALLERGY,ASTHMA AND IMMUNOLOGY, 82: 185-191 (1999) NADH and Sleep Deprivation Prof. Dr. Dr. George BIRKMAYER, MD. PhD. Vienna, Austria [email protected] www.birkmayer-nadh.com - Subjects of the NADH group received a single dose of 20 mg NADH – Control group received Placebo tablets – In the morning of the 1st day after a full night sleep (base line test) – and on the 2nd day after 24 h sleep deprivation Tests for cognitive performance, visual perception, mathematical problem solving skills and reaction time were performed. - Sujets du groupe NADH ont reçu une dose unique de 20 mg de NADH - Le groupe témoin a reçu des comprimés de placebo - Dans la matinée du 1er jour, après une nuit de sommeil complète (test de ligne de base) - et le 2ème jour après 24 h de privation de sommeil - Les tests de performance cognitive, la perception visuelle, résolution de problèmes mathématiques les compétences et le temps de réaction ont été effectuées. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 19 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Effect of NADH on cognitive performance after sleep deprivation (24 h without sleep) Can we measure tiredness objectively? Peut-on mesurer objectivement la fatigue? Yes by using the Pupillograph Oui à l'aide du pupillographe Pupillographe Objective measurement of tiredness by the pupillograph in the Prof.Birkmayer Laboratories, Vienna, Austria Reaction time of the pupil before NADH and 1 h after NADH 20 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE NADH and Depression •205 patients with depression were treated either with oral NADH (10 mg per day) or by intramuscular or intravenous injections of 10 mg NADH per day •The duration of therapy ranged from 5 to 310 days •93 % of the patients exhibited a beneficial clinical effect. An improvement up to 44 % with a mean value of 11.5 % was observed. • 205 patients souffrant de dépression ont été traités soit par voie orale NADH (10 mg par jour) ou par injection intramusculaire ou intraveineuse de 10 mg par jour NADH • La durée du traitement variait de 5 à 310 jours • 93% des patients ont présenté un effet clinique bénéfique. Une amélioration de 44% avec une valeur moyenne de 11,5% a été observée. N A D H - The biological antidepressive substance Experience with 205 patients G.D.Birkmayer and W. Birkmayer New Trends in Clinical Neuropharmacology, 5: 7-86 (1991) Weight loss in pounds (lb) after 4 weeks of NADH Total change in weight Visit 4-1 Visit 4 -3 MW - 3.65 5.71 SW 6,89 7,14 SE 1,44 1,56 n 23,00 21,00 p (t-test) 2,54 -3,67 0,0190 0,0015 P significant significant NADH N.A.D.H. and Obesity Effect of NADH on Obesity Patient: WL, 56J. 1,86 m BMI Weight in Kg Change in Kg 17.06.08 35.8 123,7 0.0 15.07.08 35.3 122.0 -1.7 12.08.08 34,5 119,5 -4.2 34,2 118,2 -5,5 18.09.08 Effect of NADH on Obesity BMI Change in Kg Patient: WL, m 56 J, 1,86 m 35.8 - 5,5 Patient: SP, w 59 J, 1,68 m 32,0 - 3.9 Patient: BS, w 58 J, 1,74 m 29,6 - 3.7 Patient: MR, w 45 J, 1,60 m 31,9 - 3.2 ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 21 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE N.A.D.H. and Diabetes Patient: AD, male, born. 18.05.1959 • Weight: 120 kg • Size: 180 cm • Diabetes Typ II • Diagnosed on Nov. 6th, 2009 • Blood sugar 360 , HbA1c 15,3, • (Blood sugar on 15.06. 2007: 100) • (Blood sugar on 05.10.2008: 170) Patient: AD, m, born 18.05.1959 • Therapic protocol of Prof. Birkmayer: Nov. 9th 2009 • NADH RAPID ENERGY 4 Tabs./day • L-Arginin: 3600 mg / day • Chrom: 400 mcg / day • Zink: 40 mg / day • Selen: 200 mcg / day • 1 -2 h physical excercise/day Patient: AD, m, 18.05.1959 Patient: AD, m, 18.05.1959 Patient: MB, male, born. 20.10.1943 • • • • • • • • Weight: 85 kg Size: 185 cm Diabetes Typ II Diagnosed on March. 3rd, 2010 Blood sugar: 724 (!) , HbA1c: 11,5 Therapy: NADH RAPID ENERGY Tabs./ day May 25th, 2010: Blood sugar: 77 HbA1c: 6.4 4 NADH and Diabetes Type-2 • • • • • • 21 patients treated (May 2009 Ŕ June 2013) Treatment: 80 mg NADH (sublingual) / day Results after 3 months of NADH treatment: Blood sugar: 130 Ŕ 150 mg /100 ml HbA1c: 6.4 Ŕ 8.2 All patients could skipped their antidiabetic medication The NADH product used for the studies 22 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE NADH and Menopause NADH improves symptoms of climacteric syndrome Results: • 49 Women (14 from CH, 35 from A) • The following symptoms • improved significanty: • Hot flashes • Depressive Mood • Fatigue • Sleeping distrubances • Drive • Nervosness The 2 most frequently asked questions about NADH: (1) How safe is NADH ? (2) Are there any side-effects? NADH is one of the safest dietary supplement • Longterm-safety tests over 6 months showed that 15 mg NADH per day per kg body weight are tolerated without side effects. • 15 mg NADH per kg body weight corresponds to 1050 mg per day for a 70 kg heavy subject. • 1050 mg NADH corresponds to 105 tablets of 10 mg NADH NADH shows no side effects During the numerous FDA approved clinical studies the potential side effects had to be documented. No side effects have been observed. More than a 50.000 consumers in the USA which have been taking the nutritional supplement NADH since 1996 and have not reported any side effects NADH shows no interactions with the most frequently used drugs • A number of patients , participating in NADH studies had to take the following medications: Blood pressure medications, Antihistaminics and / or Antidepressants • No interactions between these drugs and NADH have been observed. Recommended daily dose of NADH 1. Healthy people: 1-2 tablets per day 2. Subjects low in energy: 2-3 tabs / day 3. Chronic Fatigue: 3-6 tabs.per day NADH and Ophtalmological Applications NADH improves Glaucoma (high intraocular pressure) Intraocular pressure before and after NADH NADH and Macula Degeneration NADH VISION leads to revascularization of macula blood vessel Eye fundus before treatment with Cellergie NADH ASTARTE ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 23 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE NADH and Dermatological Applications The anti-wrinkle effect of NADH SKIN SERUM was tested at the University of Freiburg, Germany The Anti-Wrinkle Effect of NADH SKIN SERUM Eye fundus 6 weeks after treatment with Cellergie NADH ASTARTE NADH and Arthritis NADH ARTHROS has shown 3 major beneficial effects: 1. Relieve of joint pain 2. Improved mobility of the joint 3. More enenergy for physical exercise Case Report 1: Male patient, 75 y, since 2007 extensive joint pain in both knees and both hips. Constant intake of pain killers CT 2010 shows almost no cartiladge in the knees and the hips Mai 2011 start with NADH ARTHROS End of June 2011 (after 8 weeks) pain free and much better mobility Case Report 2: Female, 45 y, M.D. (Internal Medicine) marathon runner April 2011: Pain in both knees, impossible to walk without pain . 8 weeks after NADH ARTHROS she runs marathon again Case Report 3: Female Patient: 76 years, Artrhoses in both hipps and knees Extreme pain and immobility 4 weeks after 3 capsules NADH ARTHROS pain disappeared and Mobility almost back to normal. Patient is feeling a new quality of life . 24 (1) before NADH SKIN SERUM (2) 2 weeks after NADH SKIN SERUM Advantages of NADH SKIN SERUM only one ingredient (NADH) only one Carrier (pure Lecitihin Liposomes) NADH is transported through the skin NADH gets into the cells NADH produces energy and water in the cells NADH repairs damaged cells of the skin after application of NADH SKIN SERUM any other cosmetic product can be used ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ NADH SKIN SERUM has lead to significant improvements in: Teleangiectases, Varicosis Aging Spots Wrinkles Smoothing the skin Skin Aging Energizing the skin Impure Skin Vitiligo Rosacea Akne Vulgaris ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE NADH Skin Serum is Healthy Beauty 1. Transdermal 2. Energizing 3. Regenerative Rosacea (Acne) before and 2 weeks after NADH treatment NADH and Dental Applications NADH DENTAL GEL • Restores health gum • Stops gum bleeding • Regenerates damaged gum • Reduces deepth of gum pockets • Tightens wobbling teeth • High safety profile • After Insertion of implants • After tooth extraction • Decubitus • Parodontitis marginalis • Gingiva injuries • Gingivaplastics Reports about NADH effects by doctors and consumers • Happy with results. • Feel more alive and energetic. Toxic Contact dermatitis before and 2 weeks after NADH treatment • • • • • • • • • • • • • Sleep actually much better! This product is a miracle! Have more energy. Do not fatigue as easily. I am impressed so far with the product. I am taking it for Parkinsonřs and depression. I really feel much better. I have much more energy and donřt need naps during the day. Great product!! Huge potential!! Great supplement! Feel so much better. Improves my depression. It greatly helped memory and depression. Wonderful. Only thing that works. My husband is 75 and I am 66. We almost feel like teenagers • It has increased my quality of life. I cannot live without it! • I love this supplement. It has really helped. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 25 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Amazing results. Great product. Wonderful product! Also helps my son with his ADHD. Highly recommended. Gave me a great deal of energy. It is helpful. Results better than expected. I feel like walking in the evenings. Iřve more energy! • Very satisfied with this product. • This is the biggest improvement I have had since I got EBV. • I also can concentrate better as my mind does not wander. • Every benefit mentioned in Atkinřs book has been realized. • I have had CFS for years and this is the only help I found. • Noticeable stamina. • I also hope to loose weight with it. • It is terrific. Report about the effectivness of NADH products from Dr. Olga REBROVA, St.Petersburg, Russia • • • • • • • • Conference-1 CIII Leture 2 2.COENZYME 1 NADH est une thérapie efficace contre le cancer Professor Dr. Dr. George Birkmayer, Medical University of Graz, Austria Prof. George Birkmayer NADH RAPID ENERGY is good for people who work a lot and must do a lot of different things in one moment, who go to bed late at night and must be in a good form in the morning. It seemed to my patients and me that NADH RAPID ENERGY and NADH VISION help to keep weight ( I mean to keep at low level) and good for physical form also. NADH SKIN SERUM is good for face skin. In summer when it is too hot I use it even without cream later. I have good experience of using serum on wounded surfaces, after surgery, on pus wounds. Prof. Birkmayer © 14 NADH (1) Biological Functions (2) Therapeutic Effects (1) Fonctions biologiques (2) Effets thérapeutiques Prof. Birkmayer © 14 Biological Functions of NADH Les Fonctions biologiques du NADH 26 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Prof. Birkmayer © 14 Prof. Birkmayer © 14 The 6 most important biological functions of NADH (1) (2) (3) (4) (5) (6) Fuel for cellular energy production Cell - and DNA Repair Highly potent Anti-oxidant Stimulates Adrenaline und Dopamine Enhances the Immune System Stimulates N-O Production (2) NADH essential for cell and DNA repair (2) NADH et réparation de l'ADN cellulaire DNA repair enzymes need NADH as a Co-factor. Hence: The more NADH a cell has available, the better the DNA- repair system works. Les 6 plus importantes fonctiones biologiques de NADH (1) (2) (3) (4) (5) (6) Le combustible pour la production d'énergie cellulaire et réparation de l'ADN et les lésions cellulaires Elle est antioxydant le plus puissant stimule l'adrénaline et la dopamine renforce le système immunitaire stimule l'oxyde nitrique (NO) Enzymes de réparation de l'ADN besoin de NADH comme co-facteur. Par conséquent: Le plus NADH une cellule dispose, plus le système fonctionne réparation de l'ADN. Prof. Birkmayer © 12 (1) NADH Prof. Birkmayer © 14 the fuel for cellular energy production The Reduced Coenzyme Nicotinamide Adenine Dinucleotide (NADH) repairs DNA damage of PC12 cells induced by doxorubicin (1) NADH le combustible pour la production d'énergie cellulaire JR Zhang, K.Vreko, K.Nadlinger, D.Storga, GD.Birkmayer and G.Reibnegger J.Tumor Marker Onco.13, 5-17 (1998) Prof. Birkmayer © 14 NADH - supplementation decreases pinacidil-primed I K(ATP) in ventricular cardiomyocytes by increasing intracellular ATP Prof. Birkmayer © 14 Pelzmann B, Hallström S, Schaffer P, Lang P,Nadlinger K, Birkmayer GD, Vrecko C, Reibnegger G and Koidl B. Brit. J. Pharm. 2003 139, 749-754 ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 27 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Prof. Birkmayer © 14 Prof. Birkmayer © 14 (3) NADH a highly potent antioxidant NADH très puissant antioxydant • NADH reduces lipid peroxidation • NADH normalizes Cholesterol • NADH lowers blood pressure Oral NADH effects blood pressure, lipid peroxidation and lipid profile in spontaneously hypertensive rats Busheri N,Taylor J,Lieberman S,Mirdamadi-Zonosi N, Birkmayer G, Preuss HG. Geriat.Nephrol.Urol. 18(2) 95-100 (1998) • NADH réduit la peroxydation lipidique • NADH normalise le cholestérol • NADH réduit la pression artérielle Prof. Birkmayer © 14 Prof. Birkmayer © 14 Oral NADH effects blood pressure, lipid peroxidation and lipid profile in spontaneously hypertensive rats The antioxidative capacity of NADH in humans Busheri N,Taylor J,Lieberman S,Mirdamadi-Zonosi N, Birkmayer G, Preuss HG. Reibnegger G, Greilberger J, Juergens G. and Oettl K. J.Tumor Marker Oncol. 18, 37-41 (2003) Geriat.Nephrol.Urol. 18(2) 95-100 (1998) Prof. Birkmayer © 14 Prof. Birkmayer © 14 (3) NADH a highly potent antioxidant NADH très puissant antioxydant (4) NADH stimulates Adrenaline and Dopamine production • NADH reduces lipid peroxidation • NADH normalizes Cholesterol • NADH lowers blood pressure • NADH réduit la peroxydation lipidique • NADH normalise le cholestérol • NADH réduit la pression artérielle 28 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ (4) NADH stimule la production d'adrénaline et de dopamine ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Prof. Birkmayer © 14 NADH enhances activity of macrophages • Macrophages are responsible for the elimination of bacteria, viruses and altered tissue including cancer. • They absorb and degrade them. (6) NADH stimulates N-O production (6) NADH stimule l'oxyde nitrique (NO) Prof. Birkmayer © 14 NADH enhances activity of macrophages • The first step in the elimination of cancer tissue is the perturbation of the plasma membrane of the phagocytes. • As a consequence, the metabolic activity is markedly increased, including the oxygen consumption within the cells. • Most of the oxygen is converted to superoxide and hydrogen peroxide. • This phenomenon is known as the “metabolic burst”, Biological functions of N-O N-O is a neurotransmitter N-O relaxes blood vessels N-O brings more blood into organs Fonctions biologiques de N-O N-O est un neurotransmetteur N-O détend les vaisseaux sanguins N-O apporte plus de sang dans les organes Prof. Birkmayer © 14 NADH enhances activity of macrophages • During this “metabolic burst” and the cytotoxic activity of the macrophages, high amounts of NADH are consumed by the macrophages. • The logical conclusion is: The more NADH the organism has available, the better the cellular immune system works. NADH stimulates N-O production N-O relaxes blood vessels Hence: NADH helps with: Angina pectoris, Asthma, Migraine and also the genital organs get more blood. NADH stimule l'oxyde nitrique (NO) N-O détend les vaisseaux sanguins Par conséquent: NADH aide à: Angine de poitrine, l'asthme, la migraine et également les organes génitaux obtenir plus de sang. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 29 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE NADH en tant que traitement pour le cancer Prof. Birkmayer © 14 Genetic theory of Oncogenesis Pro-Carcinogen NADH Carcinogen Normal DNA Binding to DNA DNA -Repair No Repair NO Cancer Development Mutated repressed DNA Promotors Anti-Promotors Altered mutated Cell Increase of cell energy Cancer Development Prof. Birkmayer © 14 Prof. Birkmayer © 14 Epigenetic theory of Oncogenesis Biological functions of N-O Pro-Carcinogen N-O is a neurotransmitter N-O relaxes blood vessels N-O brings more blood into organs NADH Carcinogen Damage of the Mitochondria Fonctions biologiques de N-O Normal ATP Production Repair of the Mitochondria normal Cell regulation NO ATP Production N-O est un neurotransmetteur N-O détend les vaisseaux sanguins N-O apporte plus de sang dans les organes Stimulation of ATP Production Energy deficient Cell Increase of cell energy Cancer Development Prof. Birkmayer © 14 CARCINOGENESIS DRIVERS OF MITOCHONDRIAL MALIGNANCY Ionizing rays & Carcinogens L. Galuzzi et al, 2010 NADH stimulates N-O production N-O relaxes blood vessels O.Warburg,1956 Hence: NADH helps with: Angina pectoris, Asthma, Migraine and also the genital organs get more blood. P.Seeger,1958 NADH stimule l'oxyde nitrique (NO) N-O détend les vaisseaux sanguins Par conséquent: NADH aide à: Angine de poitrine, l'asthme, la migraine et également les organes génitaux obtenir plus de sang. 30 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Prof. Birkmayer © 14 Prof. Birkmayer © 14 Normal Egg Cell Removal of the Cell Nucleus Cytoplasm Nucleus ATP NADH Injektion of the Nucleus of the Cancer Cell into the normal Nucleus free Egg cell ATP Nucleus ATP ATP Nucleus Nucleus Nucleus of the Cancer Cell Prof. Birkmayer © 14 Normal Egg Cell Cytoplasm Nucleus Normal Cell Injection of the Nucleus of the Cancer Cell into the normal Nucleus free Egg cell Nucleus Cancer cells Nucleus of the Cancer cell Prof. Birkmayer © 14 Normal Cell Cytoplasma Nucleus of the Cancer Cell ATP ATP Nucleus of the Cancer Cell ATP more ATP – energy a cell has available the more components essential for regulation of cell divivison it can produce. .The Extraction of the Nucleus of the Cancer cell Cancer Cell LUNG CANCER • Patient: male 48 Y, small cell BronchusCancer • Diagnosed by MRT • verified by biopsy January 2001 • Tumorsize: 6 x 8 cm • Radiation - and Chemotherapy for 5 months • NO Reduction of Tumor mass • Visit in Vienna in my office in Sept 2001 • Therapy regimen: NADH 5mg 4 Tabl / day • In addition: Selenium (200 μg) und Vitamin C (oral) • Jan. 2002: Tumorsize: 1,5 to 2 cm • July 2002 : MRT negativ, • No Tumor detectable !! • Dec. 2010: „Merry Christmas, I am healthy • March 2013: „I am sorry I can not come to Vienna as testimonial for your Schwarzenberg Lecture • I am healthy and the manager of 5 shops in AmsterdamŖ. • Patient: female 64 Y, • Non small cell Bronchial-Ca • Diagnosed by CT : 3.Nov.2012 • Therapy as of 3.Nov. 2012 • 160 mg NADH / Tag (8 Tablets á 20 mg NADH) ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 31 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE NADH RAPID ENERGY • Patient: female 64 Y, • Non small cell Bronchial-Ca • Diagnosed by CT : 3.Nov.2012 • Control by CT : 28.Nov.2012 • Results: 1.Only minimal increase, if at all, of the 5 cm tumor 2.The tumor is centrally necrotic 3.The smalller tumor of 2 cm is not detectable anymore CANCERS, WHICH HAVE BEEN SUCCESSFULLY TREATED WITH NADH • Prostate Cancer: 21 Patients; 9 TR ; 12TF • Mamma Carcinoma: 5 Patients; 3 TR ; 2TF • Lung Carcinoma: 4 Patients; 1 TR ; 3TF • Colon Carcinoma: 4 Patients; 1 TR ; 3TF • Ovarian Carzinoma: 3 Patients; 3 TF • Bladder Carcinoma: 4 Patients; 4 TF • Non-Hodgkin Lymphoma 4 Patients;2TR 2TF • Glioblastoma: Patients; 1 TR ; 1TF • Gastric Carzinoma: 1 Patient; 1 TR • Pankreas Carzinoma: Patients; 1 TR; 2 TF • Patient: female 64 Y, • Non small cell Bronchial-Ca • Control by CT : 11. March 2014 • Results: • No evidence of recurrence 1. NO tumor detectable 2. NO enlarged lymph nodes detectable. • TR = Tumor Remission TF = Tumor Free NON ŔHODGKIN LYMPHOM • Patient, male, 56 Y, IS PREVENTIVE CHEMOTHERAPY MEANINGFUL ? • On June 17th 2008 a diffuse large cell • Chemotherapy destroys rapid growing anablastic B-Zell-Non-Hodgkin-Lymphom cells such as cancer cells Stage II B was diagnosed. but also mucosa, blood and hair cells. • Chemotherapy: COMP 8 cyclel • After termination of chemotherapy • Lymph Nodes size reduced from 8 cm to 5cm the mucosa, the blood and hair cells • 12 cycles of Radiotherapy until 05.01.2009 regenerate. • 17.05.2011 new lymph node detected Cancer cells also regenerate • Size 1.8 cm • If cancer cells regenerate after • Lymph node partially resected chemotherapy is chemotherapy then • Patient was advised by his clinic to take further meaningful ? cycles of chemotherapy • If after chemotherapy no cancer cells • Patient refused further chemotherapy occur again then no cancer cells were • Patient takes NADH (80 mg pro Tag) present before chemotherapy. • 22. March 2014 NO RECURRENCE • If no cancer cells were present before • chemotherapy, why then use preventive chemotherapy? 32 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO-DZ COURSE MÉDECINE ORTHO-MOLÉCULAIRE POUR UN ÉQUILIBRE ALIMENTAIRE Professeur MERZOUK Hafida Directrice du laboratoire PPABIONUTPhysiologie, Physiopathologie et Biochimie de la Nutrition Faculté SNVTU, Université Abou Bekr Belkaid Tlemcen, Algérie Article publié dans VIE SCIENTIFIQUE le 21/11/2011 Le régime alimentaire est désormais une des priorités des praticiens de la santé. Bien manger est essentiel pour garder la forme et la santé, mais les excès sont aussi néfastes que les privations, et la quantité doit sřallier à la qualité. Lřintroduction de la médecine orthomoléculaire est lřune des solutions que propose la Société Algérienne de Nutrition et de Médecine Orthomoléculaire, créée en janvier 2011, à lřinitiative du défunt Dr Baba, mésothérapeute. L'approche orthomoléculaire, véritable médecine, utilise des molécules naturelles et biologiques comme outil thérapeutique. Les objectifs: -Connaître les acides aminés, les acides gras, les antioxydants, les bio flavonoïdes et les enzymes, leurs rôles biochimiques, posologie, contreindications, interactions et sources alimentaires. - Application dans les cas de pathologies, et dans le cadre d'une approche globale nutritionnelle, c'est-àdire alimentaire et complémentaire. Il existe de nombreux noms pour définir cette manière de préserver la santé: Nutrithérapie, Nutrition ou Médecine Ortho moléculaire, Médecine Nutritionnelle. Quelque soit son nom, le principe est tout simple: Il consiste à donner au corps tous les éléments qu'il a besoin dans des quantités optimales pour permettre non seulement une meilleure santé à court terme, mais aussi pour réduire les risques de cancer, de maladies cardiovasculaires et d'autres maladies dégénératives. Ces éléments sont essentiellement les vitamines et les minéraux. On compte 13 vitamines essentielles: vitamines hydrosolubles et liposolubles . Les minéraux sont des substances inorganiques qui contribuent au métabolisme des lipides, des glucides et des protéines, à la formation du squelette et au bon fonctionnement du système nerveux et des muscles. On trouve 22 minéraux essentiels qui se regroupent en macro minéraux et micro minéraux ou oligo-éléments. La médecine orthomoléculaire se propose de soigner par l'apport optimal de substances naturellement connues de l'organisme, par opposition à l'approche dite allopathique qui s'oriente plutôt vers les effets thérapeutiques de molécules créées par l'homme. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 33 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Le terme « ortho moléculaire », créé en 1968 par le professeur Linus Pauling signifie «molécule correcte» au sens «qui n'est pas étrangère au corps humain, qui est biologiquement correcte ». Les autres molécules (principes actifs des médicaments) étant vues comme biologiquement incorrectes provoquant des dysfonctionnements (les effets secondaires). La "Médecine ortho moléculaire" repose sur lřutilisation thérapeutique des nutriments: acides aminés, acides gras, oses, vitamines, minéraux. Partant du postulat qu'être et rester en bonne santé dépend de la qualité de notre alimentation, la nutrithérapie ortho- moléculaire va au delà de la simple considération de la variété des apports et de l'équilibre entre macro et micro nutriments dans la nutrition cellulaire... Pourquoi???? Carences en micronutriments dues: Dégradations et pollution chimique sols, eau, air. Modes de culture, conservation et cuisson des aliments : alimentation insuffisante en éléments vitaux Déficits conduisent à une baisse de forme, fatigue, stress, diminution des facultés intellectuelles, altération de peau, muqueuses et phanères, augmentation de pathologies dégénératives : cardiovasculaire, 34 cancers, baisse des défenses immunitaires, maladies auto-immunes, ostéoporose, cataracte... PREVENTION PAR LA NUTRITHERAPIE Elle est fondée sur : La compréhension des mécanismes biochimiques de l'organisme, le métabolisme cellulaire et le métabolisme des micronutriments et comment leur carence provoque des désordres physio-psychologiques. L'utilisation de substances présentes dans l'organisme à des fins préventives. Elle vise à optimiser la santé, les performances physiques et intellectuelles, à retarder les effets du vieillissement, à prévenir les risques de maladie. Chacune de nos cellules a besoin en permanence d'un apport de matériaux et d'énergie afin d'assurer son fonctionnement. Cet apport est assuré par les nutriments cellulaires, à partir de l'alimentation. Lorsque l'un fait défaut ou n'est pas présent en quantité suffisante, l'organisme puise dans ses réserves. Certaines fonctions cellulaires sont donc forcées de tourner au ralenti et certaines structures sont mal réparées. Si la situation se prolonge et que ces ralentissements touchent de nombreuses cellules, les pathologies apparaissent. ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE LES PRINCIPES DE LA MÉDECINE CELLULAIRE ET COMPLÉMENTS ALIMENTAIRES Que ton aliment soit ton médicamentŗ Hippocrate Lřalimentation est nécessaire à la vie mais entre anorexie, jeûne, sous alimentation et suralimentation où se situe lřalimentation adéquate? Passage d řune alimentation traditionnelle à une alimentation très riche en produits transformés ou purifiés Production alimentaire industrielle fractionnement des aliments environnement calorique artificiel manipulation du goût marketing alimentaire agressif augmentation des troubles du comportement alimentaire Offre alimentaire peu adaptée aux besoins de l řhomme Abondance des sucres, des graisses et des protéines animales Très forte utilisation dřingrédients raffinés Insuffisance dřapports en produits végétaux Mauvaise couverture des apports nutritionnels conseillés (ANC) déséquilibre en acides gras, manque de fibres alimentaires, ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 35 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE apports insuffisants en micronutriments (vitamines, minéraux Recherche de compléments nutritionnels 36 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Mode de vie actuel Déséquilibre des deux fractions Nécessité des compléments alimentaires Considérés comme denrées alimentaires Complément alimentaire Source concentrée de nutriments (vitamines, minéraux, acides gras ou acides aminés) manquants ou en quantité insuffisante dans le régime alimentaire normal d'un individu Effet nutritionnel Effet préventif Effet thérapeutique Mais?? les compléments alimentaires ne sont pas des médicaments. Les compléments alimentaires ont, du fait de leur composition et dosage, une action physiologique et n'ont pas, à la différence du médicament, une action pharmacologique. Mais, attention au surdosage Prudence: respecter les AJR Compléments nutritionnels peuvent provenir: Dřun aliment classique : un extrait de fruit, des huiles…. De nutriments, comme les vitamines, les minéraux comme le calcium. De produits à but nutritionnel, comme les protéines, les acides gras, les antioxydants, les fibres, ou des oligo-éléments……. Compléments nutritionnels ces compléments alimentaires servent à combler dřéventuelles carences ne jamais dépasser les apports journaliers recommandés sur les étiquettes des produits. Les vitamines comme compléments Le besoin en vitamines dépend : - de l'état de santé de l'individu ; de la ration alimentaire - de l'activité, du mode de vie (si fumeur, besoin en vitamine C augmenté) Les 13 vitamines sont classées en deux groupes : - les vitamines liposolubles : A, D, E, K - les vitamines hydrosolubles : C, groupe B (B1 ou thiamine, B2 ou riboflavine, B3 ou PP ou niacine, B6 ou pyridoxine, B5 ou A pentothénique, B9 ou acide folique ou folate, B12 ou cyanocobalamine). Les minéraux comme compléments Les minéraux sont classés en 2 catégories : les minéraux majeurs ou macroéléments (apports quotidiens de lřordre du gramme) et les oligo-éléments ou éléments trace (apports inférieurs à une centaine de microgrammes). Les macroéléments sont le sodium, le potassium, le chlore, le calcium, le phosphore et le magnésium. Les oligo-éléments sont beaucoup plus nombreux. Ce sont par exemple le fer, le zinc le cuivre le manganèse, lřiode, le sélénium ... ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 37 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE MINERAUX NOM DE LřÉLÉMENT Calcium (Ca) Chrome (Cr) Iode (I) Fer (Fe) Magnésium (Mg) Manganèse (Mn) Potassium (K) Sélénium (Se) Zinc (Zn) RÔLE Composant des os et des dents, participle à la synthèse et à la liberation des neurotransmetteurs Intervient dans le metabolism et dans la production dřénergie Régulateur du fonctionnement thyroïdien. QUANTITÉ QUOTIDIENNE 1100mg Laitages, amandes, noix, noisettes, fruits secs(figues, dates), pissenlit, crustacés, cresson, soja en grains. < 0,005𝒎𝒈 Levure de bière, huiles végétales, cereals, céréales complètes. 0,1 Ŕ 0,2 mg Essentiel à notre vie, il est à la base de lřhémoglobine, véhicule lřoxygène de nos cellules. Constituant des os, mais son action est plus cellulaire, il intervient dans les reactions énergétiques 0,5 Ŕ 5 mg 250 mg Intervient dans la croissance osseuse, la lubrification et souplesse des cartilages. Antiallergiques universel. Intervient dans lřéquilibre acido-basique, il régule la teneur cellulaire en eau, transmit lřinflux nerveux aux muscles. Anti oxydant puissant surtout en synergie avec Vit C, E et A. Entre dans plus de 100 fonctions enzymatiques. Indispensable. ALIMENTS RICHES 2 à 5 mg 3,5 à 4 g Algues, morue fraîche, moules, huitres, ananas, crustacés, légumes verts. Persil, ortie, foie, cacao, jaune dřoeuf, lentilles, amandes, abricots, cresson, noisettes, huitres, céréales complètes. Cacao, bigorneaux ou escargots de mer, flacons dřavoine, legumes verts, fruits secs (noix, noisettes; cacahuètes), pain complet. Gingembre, céréales complètes, soja, ananas, thé, légumineuses, amandes, bananes, crustacés. Bananes, légumes frais et secs, artichaut, avocet, chocolat, fruits frais, bière; champignons, persil. 0,05 mg Levure de bière, ail, oignons, poisons de mer, foie, choux, céréales, ananas. 0,4 à 16 mg Huitres, cresson, céréales complètes, champignons, oignons, jaune dřoeuf, noix, broccolis, hareng. Il est donc très important, en cas de supplémentation, de consommer un produit complet, contenant plusieurs vitamines et minéraux : un multi-vitamine Les vitamines et les minéraux travaillent en synergie 38 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE UTILISATION DES COMPLEMENTS NUTRITIONNELS TRES VARIEE Diabète et compléments alimentaires Diabète sucré Perturbations métaboliques Stress oxydatif Correction par les compléments nutritionnels Les vitamines du groupe B, C et minéraux La prise dřune combinaison de vitamines B6, B9 et B12: -réduit l'incidence des accidents cardiaques chez les diabétiques -Réduit le taux d'homocystéine -Améliore le métabolisme des glucides - La thiamine ou vitamine B1, peut inverser le stade précoce de maladie rénale chez les personnes atteintes de diabète de type 2 - Vitamine B5:Réduction des taux de lipides sanguins (taux de cholestérol et de triglycérides). - Vitamine B6: Elle sřoppose à la glycation au cours du diabète - Vitamine C: lutte contre les diverses complications du diabète Le magnésium contribue aussi à la prévention de lřathérosclérose Supplémentation en chrome: effet bénéfique sur la glycémie et sur le taux dřhémoglobine glycosylée chez les personnes atteintes de diabète de type 2. augmenter la sensibilité à lřinsuline de personnes diabétiques Sélénium: Réduit le risque de dysglycémie Régulation métabolique Un apport régulier en zinc durant plusieurs semaines permet de réactiver chez les diabétiques la formation dřinsuline, et stabilise le taux de glycémie dans le sang. MENOPAUSE ET COMPLEMENTS NUTRITIONNELS Le calcium et le phosphore Le calcium et le phosphore sont indispensables au système osseux. En effet, ils représentent les constituants majeurs des os et des cartilages. Ils permettent donc de lutter contre lřostéoporose. Lřassociation des deux est fortement conseillée car le calcium est mieux absorbé en présence de phosphore Ou Calcium et vitamine D. La vitamine D: Elle permet de faciliter lřabsorption du calcium sur le squelette. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 39 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE CALCIUM : DES COMPLEMENTS ALIMENTAIRES DANGEREUX POUR LE CŒUR DES FEMMES ? Une étude met en cause les compléments alimentaires à base de calcium dans la survenance de crises cardiaques chez les femmes. 1. Is calcium supplementation a risk factor for cardiovascular diseases in older women? Sabbagh Z, Vatanparast H. Nutr Rev. 2009 Feb;67(2):105-8. 2. Vascular events in healthy older women receiving calcium supplementation: randomised controlled trial. Bolland MJ, Barber PA, et al. BMJ. 2008;336(7638):262-6 MEMOIRE ET COMPLEMENTS ALIMENTAIRES Vitamine E antioxydante Vitamines B La vitamine B6 est un facteur important de la synthèse des neuromédiateurs La vitamine B1 est nécessaire à l'utilisation du glucose par la cellule cérébrale. Les vitamines B9 (folates) et B12 participent à la fabrication des globules rouges. Leur carence est à l'origine de troubles de mémoire ZINC: une carence en zinc peut être à l'origine de troubles de l'apprentissage, de la pensée, de la mémoire et de l'attention. GROSSESSE, ALLAITEMENT ET COMPLEMENTS ALIMENTAIRES Besoins en micronutriments élevés Les vitamines, les minéraux, les oligo-elements ainsi que les acides gras et les acides amines sont utilises pour couvrir essentiellement les besoins accrus chez la mère. Un approvisionnement suffisant avec les micronutriments dřimportance vitale sert en plus à assurer un développement optimal de lřenfant et favorise un déroulement positif de la grossesse. VISION ET COMPLEMENTS ALIMENTAIRES La supplémentation en lutéine et zéaxanthine (caroténoïdes) Améliore la densité du pigment maculaire Améliore la vision Supplémentation en vitamines A, C et E Antioxydantes, travaillent en synergie Supplémentation en zinc Antioxydant, cicatrisant, action métabolique Stimule lřimmunité au niveau de lřoeil CHUTE DE CHEVEUX ET COMPLEMENTS ALIMENTAIRES Le poil se compose d'une racine et d'une tige. Seule la racine, avec son extrémité inférieure en forme de bulbe représente la partie vivante qui assure la croissance du cheveu. La tige formée uniquement de kératine (principalement composée de protéines avec méthionine et cystéine), n'est qu'une partie morte. 40 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE LE ZINC : rôle fondamental dans la croissance des cheveux. C'est un anti-oxydant efficace pour pénétrer dans les micro-vaisseaux sanguins du follicule et réduire les radicaux libres, il est indispensable à la synthèse de la kératine, en liant les terminaisons soufrées les unes aux autres. Il intervient aussi dans la synthèse des acides gras essentiels, lesquels nourrissent et préviennent le dessèchement des tissus du follicule pileux. il aide à inhiber la 5-alpha-réductase, enzyme située au niveau du cuir chevelu et provoquant un excès de sébum et la chute des cheveux. VITAMINE B6 PYRIDOXINE participe au métabolisme des protéines soufrées de la kératine. À partir de la méthionine, elle synthétise la cystéine Elle potentialise le zinc dans son action inhibitrice de lřenzyme (5-alpha-réductase) Anti-stress : elle est nécessaire à la synthèse de la taurine (autre acide aminé soufré, dérivé de la méthionine et de la cystéine) qui calme les tensions nerveuses. Elle aide également à fixer le magnésium, lequel est anti-radicalaire et contribue d'autre part à lřéquilibre des neurotransmetteurs, en contrôlant les états anxieux. Propriétés importantes lorsque lřon connaît lřinfluence du stress sur la chute des cheveux. VITAMINE B8 (BIOTINE) Elle participe à la production d'énergie nécessaire au renouvellement des cellules du follicule pileux et à la construction protidique de la kératine stimule le cuir chevelu et est antiséborrhéique ACIDE PANTOTHENIQUE (VITAMINE B5) Synthèse des acides gras : le CoA et plus particulièrement lřacétyl-CoA, sont des éléments essentiels dans la fabrication des acides gras, nécessaires pour la synthèse des membranes des des cellules du follicule Donc améliore la structure et lřéclat des cheveux . VITAMINE E est un puissant anti-oxydant. Elle stimule lřoxygénation et la circulation du sang au niveau du follicule pileux, elle protège la peau et le cuir chevelu du dessèchement, en rendant positive lřaction des acides gras essentiels. VITAMINE A La vitamine A est un agent protecteur de lřépiderme sur lequel elle exerce une action hydratante et anti-infectieuse. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 41 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE NUTRITHERAPIE PRO-ÂGE Suppléments nutritionnels « Stratégie Longue Vie » INFLAMMATION Oxydation et stress oxydatif Troubles du métabolisme Conséquences directes Douleurs Déformations Conséquences indirectes Cardiovasculaires Surpoids Cancers Troubles neuropsychiques PATHOLOGIES ASSOCIÉES AUX VIEILLISSEMENT Maladies cardio-vasculaires et leurs co-facteurs: obésité, syndrome métabolique, diabète… Maladies infectieuses Cancers Dégénérescences cérébrales SUPPLÉMENTS NUTRITIONNELS EFFICACES Parmi ceux-ci: Acide lipoïque (abats, légumes verts, levure) Zinc (viande, œufs, fromage) Vitamine D ( poissons, les huiles et le beurre) Coenzyme Q10(poisson, viande, œufs, noix, légumes verts) Acides gras Omega 3 L-glutamine (lactosérum) Polyphénols LARGE UTILISATION DES COMPLEMENTS NUTRITIONNELS Cellule saine, suffisamment alimentée en micronutriments Dr. Matthias Rath 42 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Principes de la médecine cellulaire ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 43 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 44 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Carences en micronutriments Mauvais fonctionnement des cellues ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 45 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Apparition de maladies Traitement= apport optimal en vitamines et minéraux (ou association des deux) Exemples concrets La Médecine Cellulaire est la base scientifique pour éradiquer les maladies cardio-vasculaires. Le coeur et le système vasculaire représentent l´organe le plus actif de notre organisme et consomme le plus de nutriments essentiels Les cellules les plus importantes sont: Les cellules des parois vasculaires : les cellules endothéliales Les cellules du myocarde La Médecine Cellulaire permet une nouvelle approche des causes de l´infarctus, de l´attaque cérébrale et de l´hypertension. Une carence en vitamines et nutriments essentiels, à long terme, altère les fonctions des parois vasculaires. Les conséquences sont l'hypertension et les dépôts d'athérome. Une carence chronique en vitamines et autres nutriments essentiels dans les cellules du myocarde peut affaiblir les fonctions cardiaques. Les conséquences: battements de coeur irréguliers (arythmie) et insuffisances cardiaques (essoufflement, 46 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 47 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 48 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE LE ROLE PREPONDERANT DE LA VITAMINE C ! Les animaux ne sont pas atteints de scorbut Les animaux n'ont pas d'infarctus parce qu'ils fabriquent de la vitamine C qui protège leurs parois vasculaires. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 49 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Clichés des artères coronaires Avant: dépôt dřathérome Après supplémentation: disparition des dépôts 50 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 51 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 52 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 53 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 54 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Les nutriments cellulaires essentiels spécifiques en cas d'insuffisance cardiaque Vitamine C : transporteur d'énergie pour le métabolisme de chaque cellule. • Vitamine E : protection antioxydante et protection des membranes cellulaires. • Vitamine B1, B2, B3, B5, B6, B12 et biotine : transporteurs de bioénergie du métabolisme cellulaire, surtout dans les cellules du myocarde; elles assurent un meilleur fonctionnement et une meilleure fonction de pompage du coeur. • Coenzyme Q10 : élément le plus important de la " chaîne de respiration " de chaque cellule ; amélioration de la fonction du myocarde. • Carnitine : augmente l'apport en bioénergie pour les mitochondries. • Taurine : une carence de cet acide aminé dans les cellules du myocarde est une cause fréquente d'insuffisance cardiaque. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 55 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 56 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Dr RATH ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 57 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 58 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 59 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 60 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 61 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 62 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Davantage de vitamine C et moins dřinsuline ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 63 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 64 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 65 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 66 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 67 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE • La vitamine C: renforce les défenses immunitaires et contribue à l'élimination des cellules cancéreuses. 68 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE • L'EGCG (gallate d'épigallocatéchine ; polyphénol de thé vert): inhibe la formation et la propagation de cellules cancéreuses. • Substances végétales biologiquement actives, telles que le resvératrol (raisin), la quercétine (oignon), les glucosinolates (chou) et la curcumine, qui, en même temps que lřEGCG, empêchent aussi la formation et la propagation de cellules cancéreuses. • La lysine: élément majeur dans la neutralisation des enzymes lysant le collagène. En outre, cet acide aminé est un élément constitutif important pour la formation de tissu conjonctif stable. • La proline, qui est un élément constitutif nécessaire à la formation de tissu conjonctif stable. • La N-acétyl-cystéine: puissant antioxydant et qui protège le tissu conjonctif dřune dégradation incontrôlée. En outre, d'autres "substances ciment" (sulfate de chondroïtine et glucosamine) contribuent à la stabilité de celui-ci. • l'arginine: renforce le système immunitaire et inhibe la division des cellules cancéreuses. Lřarginine est un précurseur de l'oxyde nitrique (NO), qui agit principalement comme un inducteur d'apoptose dans les cellules cancéreuses. • Le sélénium, qui est un élément important antioxydant du système de défense. Il est en mesure dřempêcher la croissance de la tumeur et le développement des premières étapes de sa propagation. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 69 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 70 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 71 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 72 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE La médecine cellulaire nřest pas encore très bien connue ? Le commerce de lřindustrie pharmaceutique avec la maladie Dřaprès le Docteur RATH Au niveau mondial,les gains de lřindustrie pharmaceutique sřélèvent, chaque année, à plus de 500 milliards La médecine cellulaire permet dřéradiquer la plupart des maladies de civilisation Grâce à des traitements naturels et abordables Les activités dřinvestissement de lřindustrie pharmaceutique sont menacées dřune fin proche Peut-on prendre des synergies de substances cellulaires essentielles à titre préventif ? Oui. Des travaux scientifiques et des études cliniques ont démontré que de nombreux problèmes de santé sont dus à une carence prolongée en micronutriments essentiels ou à un déséquilibre en certaines substances nutritives. Une alimentation saine, une bonne hygiène de vie et un apport optimal en micronutriments essentiels pour couvrir les besoins, sont des éléments fondamentaux pour votre santé et votre bien-être. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 73 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 74 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 75 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO DZ COURSE LES PATHOLOGIES DENTAIRES : PEUT ON CONTRÔLER LES FACTEURS DE RISQUE ? INTRODUCTION Pr Chafika MEHDID 76 Malheureusement les pathologies dentaires sont nombreuses et assez fréquentes Quřelles soient, génétiques ou acquises avant, ou après lřéruption des dents, elles peuvent avoir des conséquences néfastes tant sur le plan esthétique que fonctionnel: La santé dentaire fait partie intégrale de la santé générale. Elle favorise par ailleurs, le développement et lřinsertion psychosociale de lřindividu au-delà des dimensions fonctionnelle, esthétique et de bonne santé. Les interactions entre les dents et lřensemble du corps humain sřeffectuent via le système sanguin ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE La cavité buccale est le reflet de lřétat de santé de lřindividu. Il est très important dřy veiller dés le jeune âge et même avant la naissance Le développement de la dentition temporaire débute morphologiquement vers la 6ème -7ème semaine de la gestation . Puis, rapidement on retrouve la coexistence dřébauches dentaires temporaires et définitives. Lřune temporaire (6mois/6ans) Deux dentures denture mixte Lřautre permanente (à partir de 6ans) A la naissance Les germes dentaires sont en intra maxillaire - Les couronnes des dents T sont entièrement édifiées, - la minéralisation a débuté vers 3-6mois in utéro = peu affectée par les atteintes structurelles - Vers 6mois = Eruption de la première dent T - 2ans ½ = Eruption dernière dent T 2ans ½ → 5/6ans Vers 5ans = - Dents temporaires en cours de rhizalyse - IC sup et inf au cours dřédification rad Vers 6ans -Eruption de la première dent permanente + IC et IL inf ICsup FORMATION ŔMINÉRALISATION-ERUPTION DES 2MP, Puis , 6ans OU plus , plus tard= 3MP 20 dents temporaires fonctionnelles L'odontogenèse s'achève vers 18-25 ans par la rhizagenèse et lŘéruption des 3ème MP . ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 77 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE LES PATHOLOGIES CONGENITALES Quelles sont les pathologies que lřon peut rencontrer au niveau dentaire LES PATHOLOGIES GENETIQUES LES GENES DENTAIRES Le nombre la structure LES GENES DE SPATIALISATION La Taille La Forme La Position ANODONTIE OLIGODONTIE HYPODONTIE - Les hypoplasies la maladie carieuse - Elles peuvent - être isolées - coexister élément dřun syndrome Oligodontie = absence dřun grand nombre de dents (+ de 6 dents ) + dřautres malformations d řorganes / élément dřun syndrome etc .. . Dento-Oncho-Digito-Tricho-génito-cardio LADD=syndrome Lacrymo-auriculo-dento-digital DODD=dysplasie- oculo- dento-digitale PATHOLOGIES DENTAIRES PATHOLOGIE GENETIQUES AVANT LA NAISSANCE APRES LA NAISSANCE CONGENITALES 78 ACQUISES Dysostose cleidocranienne (mode autosomique dominant) -hyperlaxité de lřépaule - Hypoplasie uni ou bilatérale ou absence de clavicule -Anomalie cranienne ,exophtalmie ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE MANIFESTATIONS BUCCALES: -palais ogival, étroit -Retard ,absence dřéruption des dents temporaires et P -Dents surnuméraires incluses -Les dents peuvent être malformées -Présence de lésions parodontales Dysplasie éctodermique hypohydrotique Anhydrotique (forme sévère ) SIGNES CARACTÉRISTIQUES faciès caractéristique BESMALA = seule atteinte dřune fratrie de trois Sans lien de parenté connu entre ses parents Prise en charge au service de chirurgie infantile du CHU Béni Messous (Fente labio-palatine bilatérale) La patiente est très éveillée ,autonome et bonne élève à lřécole Naissance =2006 Mars 2014 SYNDROME OCULO-DENTO-DIGITO-TRICHO JEUNE FILLE âgée de 20ans, 5ème dřune fratrie de 8 - Motif de la consultation = traitement dřune molaire sup nécrosée Examen clinique = dent temporaire -persistance dřautres dents temporaires 31-41 -lřabsence de nombreuses dents permanentes -un frein labial bas inséré -diastème important entre 11-21 -Hypo ou anodontie - Dents conoides hypohydrose OU Anhydrose - Hypotrichose - Agénésie des dents permanentes + persistance de dents temporaires 31-41-13-23 Dystopies Transpositions 34,44 à la place des 14,24 Parodonte semble normal ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 79 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE -Taurodontisme -Absence de dents de remplacement Dysplasie ectodermique hypohydrotique? Au niveau du maxillaire inférieur - Necéssité de maintien de l‟os alvéolaire -Conservation des racines = Tts endodontiques conservation de l‟os alvéolaire Plan de surélévation au niveau molaire (ODF) Restaurations ésthètiques au niveau des incisives mandibulaires Agénésie 12,22,13,23, des quatre 2 PM , 31,41,32,42, Des quatre 2M ,3M Persistance 71,81,53,63,55 Dystopie 44,34 ; présence des 33-43;16-26;36-46 inclusion dřune dent présentant lřaspect dřune PM inf Houda âgée de 8ans(2012- 2013 ) Lřainée dřune fratrie de deux (caractère génétique ) (les parents sont cousins ) Examen clinique = dents conoïdes, peau sèche ,cheveux épars Cas complexe Prise en charge pluridisciplinaire - OC, orthodontie (verin ), prothèse La patiente a été hospitalisée pour la première fois au CHU Bab El Oued pour exploration en 2011 à lřâge de 07 ans - Le diagnostic précoce - Le diagnostic anténatal -Hypo ou anodontie ,Dents conoides - Hypohydrose - Hypotrichose La plus jeune âgée de 5ans présente toutes ces dents T 80 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE OBJECTIFS - La cavité buccale peut nous orienter à rechercher dřautres pathologies particulièrement lorsque les atteintes ne sont pas flagrantes /des deux sœurs dont la pathologie nřa été suspectée chez lřainée quřà lřâge de 7ans alors que lřéruption de la première dent a lieu à lřâge de six mois - -reconnaitre les dysmorphies , pour orienter chez les confrères de la spécialité (éviter un diagnostic tardif ) - -soulager le patient, lui faciliter le quotidien par la prise en charge précoce, la réalisation de prothèses , la prescription de moyens de facilitation du quotidien.. . PEUT ON CONTROLLER LES FACTEURS DE RISQUE ? Les anomalies génétiques peuvent être à transmission - Autosomique dominante (un individu atteint a forcément un parent atteint, indépendemment du sexe ) ou - Autosomique recessive (les parents hétérozygotes non malades, indépendemment du sexe: attention à la consanguinité, ou - Récessive liées à lřX (les filles sont conductrices, jamais atteintes, les garçons peuvent être atteints, jamais de transmission père fils) LES PATHOLOGIES GENETIQUES LES GENES DENTAIRES Le nombre la structure LES GENES DE SPATIALISATION Email Dentine La Taille La Forme La Position PATHOLOGIE DE LřEMAIL= Amélogenèse imparfaite GENETIQUES ACQUISES Atteinte de Avant Après Toutes les la naissance Dents Episode de Malnutrition Ou de maladie (maman) locale Générale (maladie de Traumatisme Enfant) DEBUT DE MINERALISATION DES DENTS PERMANENTES (dřaprès Chikani P,Mugnier A ) - VERS 1/2ans Début de minéralisation des couronnes des INCISIVES +1MP, suivi des CANINES - VERS 3/4ans Début de minéralisation des couronnes des 1PM inf - VERS 4/5ans Début de minéralisation des couronnes des 1PM sup Début de minéralisation des couronnes des 2PM inf - VERS 5/6ans Début de minéralisation des couronnes des 2PMsup+ des couronnes des 2MP Vers 10/12 ans (3MP) LA SEVERITE DE LřATTEINTE DE LřEMAIL ATTEINTE PRIMAIRE ATTEINTE SECONDAIRE PRECOCE QUANTITATIVE QUALITATIVE PLUS SEVERE (la matrice est déjà = formée ) HYPOPLASIE ANODONTIE OLIGODONTIE HYPODONTIE ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ Hypo minéralisation Minéralisation initiale Hypomaturation Maturation consécutive 81 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE LřHYPOPLASIE= serait due à une défectuosité primaire de lřaméloblaste =trouble cellulaire, il secréterait une substance inapte à la minéralisation normale Il pourrait ensuite reprendre sa fonction normale Puits Hypoplasie incisive = -dépressions horizontales, linéaires, toujours foncées ± larges (selon la durée de lřatteinte) Au niveau des dents cuspidées = -cuspides déformées en pointe en gradins ou en gâteau de miel (zones en cours de minéralisation au cours de lřatteinte ) -Amélogenèse imparfaite , -enfant de 12ans -atteinte des deux dentures fillette âgée de 9ans Motif de la consultation esthétique 2ème atteinte dřune fratrie de trois = caractère génétique Examen clinique = Hypoplasie des 2 dentures +Absence dřhygiène Après polissage =nombreuses zones dřexpositions dentinaires → sensibilités 82 LES HYPOPLASIES ACQUISES PRÉNATALES Les déficits nutritionnels - une hypo ou avitaminose A mais surtout C = MÉTAPLASIE SÉVÈRE DE L'ÉMAIL disposition spiralée des prismes. LA DENTINE EST DÉFICIENTE • quantitativement et qualitativement (les tubuli dentinaires sont irréguliers, diminution de la taille des odontoblastes, inclusions cellulaires dans la dentine). les maladies prénatales lřérythroblastose fœtale, - les affections fébriles des derniers mois de la grossesse / la rubéole, toxoplasmose.. . sřaccompagnent dřune HYPOPLASIE des dents en cours de minéralisation lors de cette période les molaires et les canines temporaires (rarement les incisives ) La dent dřHuchinson( 1958)= Syphilis congénitale= Lřhypoplasie atteint les incisives et les 1MP des deux maxillaires = contamination trans placentaire entre 16-20ème semaine de la VIU: les spirochètes sont identifiés entre les améloblastes grâce aux colorants dřargent ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Une maladie de la femme enceinte ou du jeune enfant = SIGNATURE Au niveau de lřémail proportionnelle à sa durée plutôt quřà son intensité Un épisode fébrile systémique ←→ Défaut de vascularisation de lřorgane dentaire = puits hypoplasiques Mort de quelques prismes dřémail Un puits = dégénérescence de 20 à 30 prismes dřémail LES PATHOLOGIES DENTAIRES ACQUISES AVANT APRES LA NAISSANCE AVANT APRES LřERUPTION DES DENTS - Maladie de lřenfant - Déficit nutritionnel, intoxication Conséquence de Traumatismes ou dřinfection de la dent T -maladie carieuse -Les érosions, -les colorations .. . LES MALADIES DřORGANES OU SYSTEMIQUES DE LřENFANT/ - Les cardiopathies congénitales avec cyanose - La maladie caeliaque - Les nephropathies - Lřatteinte cérébrale - Les endocrinopathies: hypothyroidie, hypoparathyroidie Sřaccompagnent HYPOPLASIES DE LřEMAIL Enfant de 14ans Hypoplasie acquise des 1MP et incisive supérieures (probablement en rapport avec un trouble survenu lors de la minéralisation de ces dernières : première année de la vie ) LES HYPOPLASIES DES TROUBLES NUTRITIONNELS LES HYPOPLASIES ACQUISES NÉONATALES La ligne néonatale (émail, dentine des dents T +1MP), décrite en 1936 par Schour = HYPOPLASIE due à un changement brutal dřenvironnement (NAISSANCE ). ces hypoplasies sont nettement plus fréquentes - chez les prématurés /enfants nés à terme - Les enfants nés avec paralysie cérébrale, - En cas dřallergie congénitale - dřune erythroblastose fœtale , -Nécessité de Tts intensifs à la naissance / cas dřaccouchements prématurés, hyper bilirubinémie, désordres métaboliques du calcium, les infections virales, rougeole, scarlatine .. . Lřhypovitaminose A, -lřhypovitaminose D, -lřhypovitaminose C De même que le rachitisme vitamine D résistant (hypo phosphatémique ) -lřhypocalcémie -la carence en tryptophane hypoplasie Le déficit en vit du groupe A, B et C = Jeune fille 18ans ( perdue de vue: examen du Bac en 2011/2012) - Sécheresse des téguments: lèvres et peau - puits hypoplasiques Aphtes, gingivites, défaut de structure amélaire et dentinaire ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 83 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE HYPOPLASIE DES INTOXICATIONS Il ya une prise de conscience chez les jeunes ces dernières années La Fluorose dentaire - Etudiante 5ème année en 2009 née grandi dans la région de Ghardaia (Metlili) - CAO=2 4 MARS 2009 ELOUED Enfant âgés dřenviron 10-12ans Hypoplasie en bande légère La présence de fluor en quantité physiologique au cours de la formation de I 'émail peut donc aider à améliorer la résistance de la couche externe de I 'émail . Cependant, des doses trop élevées peuvent être toxiques pour les améloblastes et provoquer une fluorose caractérisée par un émail: HYPO MINÉRALISÉ Enfants du SOUF 4 Mars 2009 84 4 MARS 2009 ELOUED INDIVIDUS ÄGES Dř ENVIRON 40 Puisque IŘ émail est une membrane semiperméable, lřapplication topique du fluor n'affecte que les cristaux en surface . Compte tenu que la carie initie son attaque à la surface de la dent, une teneur adéquate de fluor dans la couche superficielle de I 'émail pourrait exercer une protection sans les risques associés aux excès systémiques. ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE HYPOPLASIE TRAUMATIQUE ACQUISE DE CAUSE LOCALE Conséquence de la pathologie de la dent temporaire sur le germe de remplacement La dent de Turner(dent P) = - La carie dentaire devant être imputée à la production dř ACIDE, - la cariogenicité dřun produit peut être évaluée à partir de la mesure du pH de la plaque dentaire, conséquence de lřinfection ou dřun traumatisme de la dent T plaque bacterienne au niveau du collet des dents (PM surtout inférieure) Atteintes dentinaires = Dentinogenèse imparfaite exclusivement génétique (formation + précoce) Les dents présentent une teinte bleu gris à brun ambré opalescent Toujours recherchez une fragilité osseuse dans ce cas Ostéogenèse imparfaite = maladie des os de verre PATHOLOGIES ACQUISES APRES LřERUPTION DENTAIRE Il sřagit essentiellement de - la maladie carieuse, - Des érosions du bruxisme - Colorations post traumatiques - Coloration acquises ( bactéries, antiseptiques, supplémentation ferrique, tabac, thé, café .. .) LA MALADIE CARIEUSE: ETIOLOGIE - En lřespace de quelque minutes après lřexposition dřune plaque bactérienne aux sucres fermentescibles les bactéries cariogènes font baisser le pH à lřinterface plaque Ŕ émail PATHOGÉNIE ACTUELLE DE LA LESION CARIEUSE - les baisses répétitives du pH font apparaître des chenaux par dislocation des minéraux sous lřémail de surface. - La lésion devient alors cliniquement décelable et lřémail accuse un déficit minéral de 10% par rapport à un émail sain fréquence dřingestion Intérêt dřun programme de prévention - précoce - concerner tous les facteurs qui concourent ensemble à lřapparition de la carie : - Le Terrain - L‟Hygiène - La Nutrition Diagramme de KEYES 1962 modifié par Kônig 1964 (+ Facteur temps) ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 85 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE LřHYGIENE Dame de 30ans Taches de déminéralisation après retrait de la plaque dentaire Suppression des nutriments Réduction du potentiel bactérien - Hygiène défectueuse - un enfant de 12ans Lésions initiales de déminéralisation de l‟émail: 1/3 cervical I sup Lésions carieuses: I inf Enfant de 13ans Cavités carieuses ayant déjà été obturées à l‟aide de verres ionomères Protocole d‟hygiène recommandé selon le risque carieux -Brossage dentaire régulier avec dentifrice fluoré (1000-1500ppm F, 500 ppm chez lřenfant) - + nettoyage proximal Patient à haut risque Brossage dentaire régulier(électrique) Avec dentifrice fluoré (1000-1500ppmF) +nettoyage proximal +nettoyage dentaire professionnel-2X/mois vérification régulière tous les 12-18 mois Vérification régulière tous les 2 à 4mois Patient à faible risque Attention à la thérapeutique fixée en orthodontie -Lřhygiène doit être renforcée +contrôles réguliers Pour lřinterception Déminéralisations + lésions carieuses après retrait dřappareils orthodontiques Terk B. Motivation à lřhygiène chez les enfants traités en orthodontie. Réalités cliniques vol 4 N°3, sep 1993 :375-385 86 LE TERRAIN LA CONSTITUTION DES DENTS (la nutrition de la femme enceinte du jeune enfant) LA SALIVE(Composition, qualité, retentissement de maladie générale) ... - Avant lřapparition des dents Assurer une denture solide par : lřapport des nutriments nécessaires et indispensables à son développement une alimentation de base équilibrée chez - la femme enceinte - le jeune enfant La croissance du bébé est très rapide au cours de la première année - Son poids triple - Sa taille double - Trois types alimentaires - Alimentation lactée (6 premiers mois ) - Diversification alimentaire douce(alimentation semi liquide), vers la transition 6-20 mois - alimentation solide adulte - Le colostrum = fluide produit par la glande mammaire au cours des premiers jours suivants la naissance, est riche en - protéines, - minéraux, - vitamines, ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE - ATC, - des agents anti infectieux, - des facteurs ATI, - des facteurs de croissance , - des enzymes, - des hormones , Très bénéfique pour la santé du bébé Le lait artificiel (parfaitement adapté aux besoins nutritionnels ) est sensoriellement monotone : texture, arôme , saveur. Le lait maternel est porteur dř - une grande variété dřaromes provenant de lřalimentation maternelle - source de facilité pour la diversification en plus - lřépaisseur du lait augmente au cours dřune tétée [augmentation de la concentration en lipides entre le début et la fin de la tétée ] Tous ces facteurs montrent lřimportance quřil faut accorder très tôt à lřalimentation du bébé : Par ailleurs, les effets dřune malnutrition précoce sur la Santé bucco-dentaire sont prouvés (étude au Pérou :Alvarez J.O 1995) - Retard dřéruption des dents T - Retard dřexfoliation des dents T Aussi, une période de malnutrition légère à modérée entraine un risque carieux élevé sur les dents T et P même des années plus tard. LA SALIVE agira par - sa composition -sa qualité et sa quantité ainsi, LE POUVOIR TAMPON Les concentrations ioniques élevées de calcium, de phosphates inorganiques et de fluor dans la salive et/ou un pH élevé protègent I 'émail de la déminéralisation en stabilisant la phase minérale. LE DEBIT SALIVAIRE semble influencer la concentration initiate des glucides fermentés cibles dans la cavité buccale favorisant leur élimination, ainsi que celle des acides de la plaque. II est bien connu que la xérostomie et les secrétions anormalement réduites de salive augmentent la sensibilité à la carie et sa distribution Réduire la fréquence dřingestion pour laisser le temps à la salive de neutraliser lřacidité buccale= Pouvoir Tampon Si les ingestions sont trop fréquentes le pouvoir tampon de la salive est débordé (Larmas 1985) LA NUTRITION Les facteurs alimentaires qui jouent dans lřincidence de la carie sont les suivants : -La présence dans la nourriture dřune quantité élevée dřhydrates de carbone pouvant être fermentés rapidement ; - Lřinsuffisance, dans la nourriture moderne, dřaliments favorisant une salivation abondante et une mastication vigoureuse, capables dřassurer un nettoyage naturel de la cavité buccale ; -La diminution des constituants susceptibles de réduire la carie dans la nourriture raffinée. - Lřaugmentation du nombre de repas ; jusqu'au XV siècle, les sucres étaient surtout réservés aux classes privilégiées et la consommation moyenne par personne était de I'ordre de 1 kg par an . Actuellement, dans les pays industrialisés, ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 87 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE la consommation moyenne par personne est de l'ordre de 50 kg pour I'Australie et 30 kg pour I'Espagne 40 kg par an Repas réguliers Peu dřabsorption de sucres = Peu de risque de caries Grignotages Absorption répétée de sucre = Grand risque de caries Concernant les maladies génétiques Eviter les mariages consanguins( en présence de pathologie manifeste plus particulièrement ) -Importance du conseil génétique CONCLUSION Alimentation, santé bucco-dentaire et santé générale sont intimement liées. Les médecins dentistes sont en première ligne pour - Le dépistage des signes de malnutrition et même - Des pathologies générales Ainsi, médecins généralistes et médecins dentistes doivent se rappeler qu'ils prennent en charge un patient et non pas juste une pathologie ou une cavité buccale . PEUT ON MAITRISER LES FACTEURS DE RISQUE ? OUI pour les pathologies les plus fréquentes Les facteurs de risque (Varient selon la pathologie) = NOMBREUX - une hygiène défectueuse - Une alimentation déséquilibrée - Absence de consultations régulières et de prise en charge dans un programme de prévention Veiller à une prise en charge correcte de la femme enceinte - Le plan nutritionnel - Veiller à une hygiène de vie et de santé : vérifier la validité des vaccinations Assurer des contrôles réguliers Renforcer lřhygiène BD et les apports nutritionnels Eviter les maladies contagieuses vulgariser les bonnes pratiques chez lřenfant Veiller à une prise en charge précoce chez lřenfant Supprimer la cause =plus de conséquence 88 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO DZ RESEARCH JOURNAL OF VIROLOGY, Feb. 2005, p. 2024–2032 Vol. 79, No. 4 0022-538X/05/$08.00_0 doi:10.1128/JVI.79.4.2024–2032.2005 Copyright © 2005, American Society for Microbiology. All Rights Reserved. Formulation with CpG Oligodeoxynucleotides Prevents Induction of Pulmonary Immunopathology following Priming with Formalin-Inactivated or Commercial Killed Bovine Respiratory Syncytial Virus Vaccine M. Oumouna,† J. W. Mapletoft, B. C. Karvonen, L. A. Babiuk, and S. van Drunen Littel-van den Hurk* Vaccine and Infectious Disease Organization, University of Saskatchewan, Saskatoon, Canada Received 14 June 2004/Accepted 28 September 2004 Commercial killed bovine respiratory syncytial virus (K-BRSV) and formalin-inactivated BRSV (FIBRSV) tend to induce Th2-type immune responses, which may not be protective and may even be detrimental during subsequent exposure to the virus. In this study we assessed the ability of CpG oligodeoxynucleotides (ODNs) to aid in the generation of effective and protective BRSV-specific immune responses. Mice were immunized subcutaneously with FI-BRSV formulated with CpG ODN, Emulsigen (Em), CpG ODN and Em, or non-CpG ODN and Em. Two additional groups were immunized with K-BRSV or K-BRSV and CpG ODN. After two vaccinations, the mice were challenged with BRSV. FI-BRSV induced Th2-biased immune responses characterized by production of serum immunoglobulin G1 (IgG1) and IgE, as well as interleukin-4 (IL-4), by in vitro-restimulated splenocytes. Formulation of FI-BRSV with CpG ODN, but not with non-CpG ODN, enhanced serum IgG2a and IFN-_ production by splenocytes, whereas serum IgE was reduced. Although the immune response induced by K-BRSV was not as strongly Th2 biased, the addition of CpG ODN to this commercial vaccine also resulted in a more Th1-type response. Furthermore, the addition of CpG ODN to the BRSV vaccine formulations resulted in enhanced neutralizing antibody responses. Significant production of IL-5, eotaxin, and eosinophilia was observed in the lungs of FI-BRSV- and K-BRSV-immunized mice. However, IL-5 and eotaxin levels, as well as the number of eosinophils, were decreased in the mice vaccinated with the CpG ODN-formulated vaccines. Finally, when formulated with CpG ODN, both FIBRSV and K-BRSV significantly reduced virus production after challenge with BRSV. Respiratory syncytial virus (RSV) is an important infectious agent and the leading cause of viral lower respiratory tract infection in infants and young children worldwide (4). Clinical manifestations range from asymptomatic infection to bronchopneumonia, bronchiolitis, and pneumonia. RSV infection is also associated with development of asthma later in life (50, 51). Like human RSV (HRSV), bovine RSV (BRSV) is a negative-stranded RNA virus classified in the Pneumovirus genus of the Paramyxoviridae family. It has been recognized as an important pathogen for cattle for 30 years, and it affects primarily young calves (2, 38, 58). Infection is characterized by pyrexia, coughing,trachypnea, and dyspnea (7), pneumonia (56), and sometimes death (57). The pathological lesions caused by HRSV and BRSV are very similar. Both viruses induce lymphocyte bronchitis, bronchiolar epithelial necrosis, bronchiolar occlusion, parenchyma inflammation, and alveolar exudation (53). Despite the importance of HRSV as a respiratory pathogen, there is no safe and effective vaccine available. The first vaccine trial, in the 1960s, in which young ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 89 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE children were given formalin-inactivated HRSV (FIHRSV), had serious consequences upon subsequent natural infection with RSV. The vaccine recipients developed enhanced pulmonary disease leading to hospitalization and even to the deaths of two children (9, 17, 35, 61). It was reported that in mice the failure of the FI-HRSV vaccine was caused by an imbalance in the immune responses to the RSV attachment (G) and fusion (F) proteins, because of poor preservation of the F protein during formalin inactivation (12, 19, 43). Other studies with cotton rats showed an immune response against F after immunization with formalin-inactivated virus (11), although disease complications still occurred. It has now been reasonably well established at least for the mouse model that the immunopathology is caused by polarized type 2 T-helper cell (Th2) responses (13), characterized by high levels of RSV-specific immunoglobulin G1 (IgG1) and IgE, as well as an increase in the amount of Th2 cytokines such as interleukin-4 (IL4) and IL-5, which result in enhanced pulmonary eosinophilia. A similar exacerbation of respiratory disease occurred in calves given a live or FI-inactivated BRSV vaccine (34, 37) and in laboratory animals immunized with recombinant virus vaccine (54). Furthermore, in cattle activation of complement has been observed (36), and in monkeys a deposition of immune complexes has been observed (46). However, there are commercial BRSV vaccines, which have shown limited success in preventing the disease or stopping the virus from spreading between herds. Synthetic oligodeoxynucleotides (ODNs) containing unmethylated CpG dinucleotides flanked by two 5_ purines and two 3_ pyrimidines (CpG motif) have been reported to have immunomodulatory activity (16). These ODNs require chemical modifications such as the replacement of the nonbridging oxygen atom on the phosphate group with a sulfur atom (phosphorothioate modification) (40) to increase resistance to nuclease degradation and thus activity (48). By binding Toll-like receptors, CpG can activate dendritic cells and macrophages to trigger the production of IL-1, IL-6, IL-12, and tumor necrosis factor alpha, as well as natural killer (NK) cells and lymphocytes, to produce gamma interferon (IFN-_), IL-6, IL-10 and immunoglobulin, respectively (3, 26, 27). Overall, CpG DNA stimulates Th1-type responses, characterized by IL12 and IFN-_ secretion with very little secretion of Th2 cytokines and a predominance of IgG2a over IgG1 in the mouse (10, 14, 30,33). ODNs do not bind major histocompatibility complex molecules and are not recognized as antigens by T cells, and therefore CpGbased adjuvants do not trigger severe granulomatous reactions (52) and are not associated with adverse 90 injection site reactions (32). Although for cattle the Th1/Th2 paradigm has not been as firmly established as it has been for mice, we have observed increased IgG2 levels and IFN-_ production in the blood of calves vaccinated with CpG-formulated bovine herpesvirus 1 gD (31). In the present study we evaluated the ability of CpG ODNs to shift the immune response bias induced by vaccination with FI-BRSV or commercial killed BRSV (K-BRSV), as well as to enhance protection after BRSV challenge. We chose to use the BRSV challenge model because commercial vaccines are available for BRSV. This allowed us to not only evaluate an experimental FI-BRSV vaccine but also to assess the potential for improvement of a commercial K-BRSV vaccine. MATERIALS AND METHODS Cells and virus. BRSV strain 375 was propagated in Madin-Darby bovine kidney (MDBK) cells maintained in Dulbecco‟s modified Eagle‟s medium (MEM) (GIBCO-BRL, Grand Island, N.Y.) supplemented with 1% heat-inactivated (56°C) fetal bovine serum (GIBCO-BRL). The virus was propagated until there was a detectable cytopathic effect. Infected cells were collected and frozen at _70°C. The virus titer was determined by plaque assay on MDBK cells. Formalin-inactivated BRSV vaccine was prepared as described previously (35). Briefly, the supernatant from BRSV-infected MDBK cells was centrifuged for 15 min at 1,600 rpm (Legend RT; Sorval) to remove cellular debris. One part of 37% formalin (Sigma, St. Louis, Mo.) was incubated with 4,000 parts of clarified BSRV lysate at 2 _ 106 PFU per ml for 3 days at 37°C and pelleted by ultracentrifugation for 1 h at 17,000 rpm in an SW28 rotor (Optima L-100 XP; Beckman Coulter). The virus pellet was resuspended in 1/25 of the original volume in serum-free MEM (GIBCO-BRL). Vaccination and challenge. Six- to 8-week-old female BALB/c mice were purchased from Charles River (Montreal, Quebec, Canada) and kept in an in-house animal care facility. Nine groups of six mice each were immunized subcutaneously twice with a 3week interval with 100 _l of FI-BRSV or K-BRSV. FI-BRSV strain 375 was formulated with either ODN 1826 (10 _g), Emulsigen (Em) (30%, vol/vol) (MVP Laboratories, Ralston, Nebr.), both ODN 1826 and Em, or ODN 1982 (10 _g) and Em. Emulsigen was ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE chosen because of its efficacy as a coadjuvant with CpG ODNs (30). Because the commercially available killed virus vaccine (Triangle 4; Fort Dodge Laboratories Inc., Fort Dodge, Iowa) already contains an undisclosed adjuvant, it was formulated with ODN 1826 alone (10 _g) (Table 1). Both ODN 1826 (TCCATGACGTTCCTGACGTT) and non-CpG ODN 1982 (TCCAGGACTTCTCTCAGGTT) were phosphorothioate modified and synthesized by Qiagen GmbH (Hilden, Germany). ODNs were diluted in endotoxin-free water (GIBCOBRL). All mice were challenged 3 weeks after the secondary vaccination. Following sedation with ketamine and xylazine (60 mg/kg; Butler Co., Dublin, Ohio), 107 PFU of BRSV strain 375 in a final volume of 50 _l was applied in the nostrils. Four days after challenge, all mice were euthanatized. The experiment was performed twice to validate the results, and results from a representative trial are shown. All procedures involving the animals were performed in accordance with the recommendations of the Canada Council for Animal Care Enzyme-linked immunosorbent assay (ELISA). To determine BRSV-specific IgG titers, 96-well polystyrene Immulon 2 microtiter plates (Dynatech, Gaithersburg, Md.) were coated overnight with BRSV antigen, which was composed of detergent-treated MDBK cells infected with strain 375 of BRSV. Mockinfected MDBK cells were used as the control antigen as previously described (55). Plates were incubated for 2 h at room temperature (RT) with serially diluted mouse sera. Alkaline phosphatase (AP)-conjugated goat anti-mouse IgG (Kirkegaard & Perry Laboratories, Gaithersburg, Md.) at a dilution of 1:5,000 was used to detect bound IgG. The reaction was visualized with p-nitrophenyl phosphate (PNPP) (Sigma Chemical Co., Oakville, Ontario, Canada). To determine BRSV-specific IgG1 and IgG2a titers, 96-well polystyrene microtiter plates were coated overnight with BRSV-infected and mock-infected cell lysates as described above (55). Plates were incubated for 2 h at RT with serially diluted murine sera. Bound antibodies were detected with biotinylated goat anti-murine IgG1 and IgG2a (Caltag Laboratories, San Francisco, Calif.) at 0.05 and 0.5 _g of IgG per ml, respectively, followed by streptavidin-AP (GIBCOBRL) at a dilution of 1:2,000. The reaction was visualized with PNPP (Sigma Chemical Co.). To determine BRSV-specific IgE titers, 96-well polystyrene microtiter plates were coated overnight with BRSV-infected and mock-infected cell lysates as described above (55). Murine sera were serially diluted and incubated overnight at 4°C. Bound antibodies were detected with biotinylated rat antimouse IgE (Serotec, Oxford, United Kingdom) at a 1:5,000 dilution, followed by streptavidinAP (GIBCO-BRL) at a dilution of 1:2,500. The reaction was visualized with PNPP (Sigma Chemical Co.). The titers were determined based on the titer differences between the BRSVinfected and mock-infected cell lysates as previously described (55). Virus neutralization assay. MDBK cells were cultured overnight in 96-well tissue culture plates (Becton Dickinson, Mountain View, Calif.) to obtain a confluent monolayer. Murine sera were pooled for each group and serially diluted twofold, and known BRSV-high-positive, -low-positive, and -negative sera were used as controls. The 375 strain of BRSV was diluted 1:1 with 100 _l of each serum sample and incubated at 37°C for 1 h. The serum-virus mixture was then added to duplicate MDBK cell cultures and incubated for 48 h. The ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 91 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE plates were stained with BRSV-specific goat serum (VMRD, Inc., Pullman, Wash.) and biotinylated goat anti-rabbit serum (Vector Laboratories, Inc., Burlingame, Calif.), followed by detection with the Vectastain ABC horseradish peroxidase kit and diaminobenzidine substrate as recommended by the manufacturer (Vector Laboratories Inc.) to visualize viral plaques before counting. Virus neutralization titers were expressed as the reciprocal of the highest dilution of serum that caused a 100% reduction in plaques relative to the virus control. IFN-_ and IL-4 enzyme-linked immunospot assays. Splenocytes were isolated as described previously (30). Following the removal of excess fat, spleens were cut into pieces and gently pushed through a sterile strainer into a petri dish containing MEM supplemented with 100 U of penicillin and 50 _g of streptomycin (GIBCO-BRL) per ml and 5 mM HEPES (GIBCO-BRL). The strainer was washed, and the splenocytes were transferred into 15-ml tubes. After 5 min on ice, the cells were centrifuged for 10 min at 4°C and resuspended in 1.5 ml of ammonium chloride lysis buffer. One minute later, 10 ml of MEM was added and the cells were centrifuged again. After the cells were counted with an automatic Coulter counter (Z1; Beckman Coulter, Hialeah, Fla.), they were resuspended in Aim-V medium (GIBCOBRL) supplemented with 2 mM glutamine (GIBCO BRL), 100 U of penicillin and 50 _g of streptomycin (GIBCO-BRL) per ml, 5 _10_5 M 2-mercaptoethanol (Sigma Chemical Co.), 10 mM HEPES (GIBCOBRL), and 10% (vol/vol) fetal bovine serum (Sigma Chemical Co.) to 107 cells per ml.Nitrocellulose plates (Whatman, Inc., Clifton, N.J.) were coated overnight at 4°C with mouse IFN-_- and IL-4-specific monoclonal antibodies (PharMingen, San Diego, Calif.) diluted to 2 _g/ml. Unbound antibody was removed by washing with 0.05% (vol/vol) phosphatebuffered saline (PBS)–Tween 20, with a final wash with PBS alone. Wells were blocked with 100 _l of complete AIM V medium for 1 to 2 h at 37°C. Mouse splenocytes were cultured in triplicate wells at 106 cells per well in the presence of BRSV-infected or mock-infected cell lysate. Following 24 h of 92 incubation at 37°C, the plates were washed with doubledistilled water (ddH2O) for 1 min to lyse the cells. Cells were then removed by washing with ddH2O followed by PBS-Tween 20. The plates were subsequently incubated with biotinylated anti-mouse IFN-_ and IL-4 monoclonal antibodies (PharMingen) at 2 _g/ml for 1 h at RT, followed by streptavidin-AP (GIBCOBRL) at a 1:1,000 dilution. Bound IFN-_- and IL-4-specific antibodies were visualized with 5bromo-4-chloro-3-indolylphospohate and nitroblue tetrazolium substrate tablets (Sigma Chemical Co.). Plates were washed in ddH2O and air dried. Spots were counted with the aid of an inverted microscope. The numbers of BRSV-specific IFN-_- and IL-4secreting cells are expressed as the difference between the number of spots per 106 cells in BRSVstimulated cultures and the number of spots per 106 cells in control cultures. IL-5 and eotaxin ELISA. IL-5 secretion into the lungs was evaluated by ELISA as previously described (22). Murine recombinant IL-5 and anti-IL5 monoclonal antibodies (TRFK.5 and TRFK.4) were purchased from PharMingen. Bound anti-IL-5 antibodies were visualized with PNPP (Sigma Chemical Co.). The level of eotaxin, a member of the CC chemokine family of inflammatory and immunoregulatory cytokines, in the lungs was measured by ELISA with a Quantikine M kit (R&D Systems, Minneapolis, Minn.) and was expressed in picograms per milliliter. Bronchoalveaolar lavage fluids were collected, and cytospin preparations were prepared and stained with Diff-Quick (Dade International, Miami, Fla.). The numbers of eosinophils, lymphocytes, macrophages, and neutrophils were determined for each group of mice by examination of at least 400 leukocytes. Virus titration. Production of BRSV in the lungs after challenge was assessed by plaque titration (22, 24). The lungs were removed and homogenized four times for 45 s each in a tube containing microbeads (1.0-mm-diameter glass beads; Biospec Products, Inc.) and MEM. To prevent enzymatic degradation of virus, 10 _g of aprotinin and leupeptin per ml was added to the medium. Before each homogenization ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE the tubes containing the lungs were kept in alcohol chilled by dry ice. Tenfold serial dilutions of the lung homogenates were added to 70% confluent MDBK cell monolayers. Cells were incubated for 6 to 8 days at 37°C, and the BRSV plaques were visualized with 2% crystal violet. The BRSV titers were expressed as PFU per milliliter. Statistical analysis. The differences between the mean values for the vaccine groups were determined by a two-tailed Student t test with assumed equal variance. Differences were considered significant if the P value was _0.05. IgG1 and produced little IgG2a, but when K-BRSV was formulated with CpG ODN, higher IgG2a titers were observed, al-though there were no statistically significant differences between the two groups. RESULTS Humoral immune response to FI-BRSV and KBRSV. The ability of CpG ODNs to modulate the humoral immune responses induced by FI-BRSV and K-BRSV was investigated by measuring BRSVspecific IgG1 and IgG2a titers in the serum. All vaccinated groups produced higher antibody titers (P _0.05) than the saline group, both before (Fig. 1A) and after (Fig. 1B) viral challenge. However, there were no significant differences in IgG1 levels between any of the vaccinated groups. In contrast, before challenge the groups immunized with FIBRSV/CpG or FI-BRSV/CpG/Em had significantly higher IgG2a titers than the groups that received FIBRSV (P_ 0.01) or FI-BRSV/Em (P _ 0.005), respectively. The role of CpG ODN in inducing IgG2a was confirmed by the fact that the mice vaccinated with FI-BRSV/nonCpG/Em had significantly (P _ 0.005) lower IgG2a titers than animals immunized with FI-BRSV/CpG/Em. After challenge, the IgG2a titers were still significantly higher in the mice vaccinated with FIBRSV/CpG or FIBRSV/Em/CpG than in the animals immunized with FI-BRSV (P _ 0.01) or FI-BRSV/Em (P _ 0.0001). These results suggest that the groups that received FI-BRSV and CpG ODN developed a Th1 response, whereas the groups vaccinated with FI-BRSV had a Th2-biased response. Before challenge, the mice vaccinated with K-BRSV did not produce any Similarly, no significant difference was observed ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 93 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE between K-BRSV- and K-BRSV/CpG-vaccinated mice after challenge. These results were confirmed in a second trial, with the serum IgG2a/IgG1 ratio increasing upon addition of CpG ODN to either FIBRSV, FI-BRSV/Em, or K-BRSV. The presence of IgE is an additional indicator of the bias of the immune response (Fig. 2). Prior to and, in particular, after BRSV challenge, mice immunized with FI-BRSV, FI-BRSV/Em, or FI-BRSV/Em/nonCpG produced substantial amounts of IgE. Formulation of FI-BRSV with CpG ODN significantly (P _ 0.0005) reduced the serum IgE levels in vaccinated mice. Although the mice immunized with FI-BRSV/Em tended to have higher serum IgE titers, no significant difference was observed between this group and the one that received FIBRSV/Em/CpG. However, although before challenge there was no difference in IgE titers, mice vaccinated with K-BRSV/CpG produced significantly (P _ 0.01) less serum IgE than the animals that received K-BRSV alone after challenge. 94 In order to further evaluate the biological relevance of the BRSV-specific antibody responses, a virus neutralization assay was performed. As shown in Fig. 3, all vaccinated groups developed neutralizing antibody titers, whereas no neutralizing antibodies were detected in the saline group. Furthermore, the two groups immunized with CpG ODN-formulated FI-BRSV tended to develop higher neutralizing antibody titers than the corresponding groups immunized with FI-BRSV without CpG ODN or with FI-BRSV and non-CpG ODN. Similarly, KBRSV/CpG appeared to induce higher neutralizing antibody titers than K-BRSV. After challenge, these differences became more obvious, with a three- to eightfold increase in neutralizing antibody titers upon addition of CpG ODN to FI-BRSV, FI-BRSV/Em, or K-BRSV. The neutralizing antibody titers were very similar in the two trials. Cell-mediated immune response to FI-BRSV and K-BRSV. To further study the type of immune response elicited by the various vaccine formulations, BRSV-induced ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE secretion of IFN-_ and IL-4 by splenocytes was measured after viral challenge (Fig. 4). Low numbers of IFN-_-secreting cells were induced by immunization with FI-BRSV or FI-BRSV/Em. The addition of CpG ODN to FI-BRSV and FIBRSV/Em enhanced the number of BRSV-specific IFN-_ producing splenocytes (P _ 0.05), whereas non-CpG ODN did not have any effect. Although there was no significant difference, the KBRSVvaccinated group also had lower numbers of IFN-_secreting cells than the K-BRSV/CpG-immunized group. In contrast, the number of BRSV-specific IL-4secreting cells was higher in the K-BRSV-vaccinated mice than in the K-BRSV/CpG-immunized animals (P _ 0.05) (Fig. 4). These results confirm that the addition of CpG ODN to the vaccine formulations shifted the response from a Th2-biased to a balanced or Th1-type response. Cytokine and chemokine production and cell populations in the lungs. The effect of CpG ODN on the type of immune response induced was further examined by measuring the amount of IL-5 produced in the lungs of the mice. Mice vaccinated with FI-BRSV or FI-BRSV/Em produced significant amounts of IL-5 compared to animals that received the same vaccines formulated with CpG ODN (Fig. 5A). Indeed, IL-5 production was significantly reduced in the groups vaccinated with FI-BRSV/CpG and FI-BRSV/CpG/Em compared to the FI-BRSV (P _ 0.01)- and FI-BRSV/Em (P _ ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 95 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 0.0001)-immunized groups, respectively. Mice vaccinated with K-BRSV/CpG also tended to produce lower amounts of IL-5 than the animals that received K-BRSV, even if no statistical differences were observed. There was no effect of the non-CpG ODN on the amount of IL-5 in the lungs, which confirms that the modulatory effect is due to the CpG motifs in the ODN. Chemokines are considered to be one of the inflammatory factors playing an important role in mediating the extravasation and accumulation of selective leukocyte subsets in the process of inflammation. The level of eotaxin, a chemokine member of the inflammatory family, tended to be higher in the lungs of mice vaccinated with FI-BRSV, FI-BRSV/Em, FIBRSV/nonCpG/Em, or K-BRSV than that in the animals that received CpG ODNformulated FI-BRSV or K-BRSV, but no significant difference was observed between the groups (Fig. 5B). The efficacy of CpG ODN in modulating the immune response was further studied by measuring the percentages of various immune cells in the lung lavages from the mice. The percentage of eosinophils was 21 to 33% higher in the groups 96 vaccinated with FI-BRSV, FI-BRSV/Em, or FIBRSV/non-CpG/Em than in the groups that received FI-BRSV or FIBRSV/Em formulated with CpG ODN. Furthermore, cells present in the lung lavages of the mice vaccinated with KBRSV alone consisted of 15% eosinophils, while this was reduced to 1% in the group vaccinated with K-BRSV/CpG. The percentage of neutrophils was higher in the mice immunized with FI-BRSV/CpG/Em compared to the animals vaccinated with FI-BRSV/Em or FIBRSV/nonCpG/Em. Similarly, when formulated with CpG ODN, K-BRSV produced 22% more neutrophils (Fig. 6). The number of lymphocytes was low in all of the groups, while the percentage of alveolar macrophages was high. Very similar cell numbers were observed in the second trial, with a decrease in eosinophils of between 22 and 28% when CpG ODN was added to the FI-BRSV or K-BRSV formulations. Protection from BRSV challenge. In order to assess whether any of the vaccination strategies resulted in protection from virus infection, all groups of mice, except the negative control group, were challenged with BRSV after two vaccinations. The virus titers in the lungs were determined 4 days later. The group that did not receive any vaccine had the highest virus titer (Fig. 7). ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Some of these mice had a titer as high as 107 PFU/ml, while others had titers of 105 PFU/ml. The efficacy of the vaccines was demonstrated by a significant decrease in virus in the lungs of the vaccinated groups. Compared to the saline-immunized group, the most efficient inhibition was observed in the groups that received FIBRSV/CpG, FI-BRSV/CpG/Em, or K-BRSV/CpG (P _ 0.0001). Although the other groups of vaccinated mice also shed less virus than the salineimmunized group (P _ 0.01), they were not as well protected. These results were confirmed in a second trial, in which we observed a significant decrease in virus titer in the groups immunized with CpG ODNformulated BRSV vaccine. DISCUSSION Since the failure of the formalin-inactivated HRSV vaccine in the 1960s, which was characterized by massive lung lymphocyte infiltration and eosinophilia, as well as a Th2-biased response, a search for new RSV vaccines has been hampered by several challenges, including the difficulty of inducing protection early in life and the risk of exacerbating disease upon natural infection. Most adjuvants that have been used in vaccines against RSV, such as aluminum hydroxide and aluminum phosphate, promote a Th2-type immune response, which is characterized by the activation of T cells that express IL-4, IL-5, IL-9, and IL-13 and the induction of allergic inflammation due to IgG1 and IgE class switching (5, 14). CpG DNA is a novel adjuvant that induces secretion of Th1 cytokines, including IFN-_ and tumor necrosis factor beta, and production of antigen-specific IgG2a by B cells (10, 14, 30). In the present study, CpG ODNs presented all the characteristics of an adjuvant appropriate to balance or shift the immune response. FI-BRSV elicited a Th2-biased immune response regardless of whether Emulsigen was present in the formulation. However, when FI-BRSV was formulated with ODN 1826, a balanced or Th1-type immune response was demonstrated based on serum antibody isotypes and cytokine production. Although the immune response induced by K-BRSV was not as strongly Th2 biased, the addition of CpG ODN to this commercial vaccine also resulted in a more Th1-type response. This suggests that coadministration of CpG ODN with FIor K-BRSV resulted in a balanced or Th1-type immune response in vaccinated mice. Furthermore, the enhanced neutralizing antibody responses in the groups of mice vaccinated with FIBRSV/Em/CpG, FIBRSV/CpG, or K-BRSV/CpG compared to the mice immunized with FI-BRSV or K-BRSV without CpG ODN confirm that the addition of CpG ODN to the FIBRSV, FI-BRSV/Em, and K-BRSV vaccine formulations results in an improved immune response. IgE production is considered a hallmark of a type 2 immune response. HRSV-specific IgE has been detected in the nasal secretions of infants during the recovery phase of RSV bronchiolitis (62, 63). Indeed, IgE levels were high in infants with bronchiolitis and correlated with the degree of hypoxemia during acute RSV disease (15). In infected calves, BRSV has also been associated with production of BRSV-specific IgE, and IL-4 production has been commonly found in lymph node cells (18). In the present study, the groups of mice that were vaccinated with FI-BRSV without CpG ODN also had serum IgE titers prior to challenge. The IgE levels increased dramatically in the FI-BRSV groups and also developed in the K-BRSV group after challenge, which confirms that exacerbation of disease ccurred. CpG ODNs are known to play a key role in the shift of the immune response toward a Th1-type response, and therefore would be expected to reduce IgE levels. Indeed, CpG ODNs have been previously shown to reduce serum IgE in a murine model of asthma (1, 39). The reduced IgE levels in the mice vaccinated with FI-BRSV or K-BRSV formulated with CpG ODN correlated with previous observations (23) and supported the ability of the CpG ODN to reduce IgE levels. IFN-_ was increased in the mice vaccinated with FIBRSV or K-BRSV formulated with CpG ODN, whereas IL-4, a Th2 cytokine, was significantly decreased in the K-BRSV/CpG-vaccinated ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 97 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE mice, which further confirms the role of CpG ODN as an immune modulator (10, 33, 41, 42, 49, 60). Results from several studies have demonstrated the importance of a cellmediated immune response in protection from BRSV. The development of a Th1biased immune response is accompanied by a high level of antigen-specific T-cell proliferation as well as by the secretion of Th1 cytokines in an antigen-specific manner. In contrast, IL-4 secreted by Th2 cells selectively induces immunoglobulin gene switching to IgE and IgG1, whereas IFN-_ secreted by Th1 cells inhibits IL-4 and causes production of IgG2a. IFN-_ is also very important in viral clearance because it induces macrophage activation and increases expression of major histocompatibility complex class I and II molecules (29). Vaccination of calves with FI-BRSV prior to challenge appears to result in diminished IFN-_ production by T cells in response to BRSV infection, and decreased IFN-_ production may contribute to enhanced disease severity in FI-BRSV-vaccinated calves (64). The efficacy of CpG ODN in reducing IL-5 in the lungs is also very important, as IL-5 induces the proliferation of eosinophils both in vitro and in vivo (6). In the present study, as well as a previously reported study using the HRSV F protein vaccine (23), IL-5 levels and pulmonary eosinophilia were both significantly reduced when CpG ODN was added to the vaccines. Indeed, in the groups of mice vaccinated with FIBRSV or K-BRSV, the amounts of IL-5 were 5 to 20 times higher than those in the groups immunized with FI- or K-BRSV formulated with CpG ODN. Chemokines are important factors that control leukocyte function and are essential in mediating leukocyte trafficking and orchestrating cell activation and cytokine expression. They are also involved in RSV-mediated lung inflammation and pathology (21). To evaluate the role of CpG ODN in reducing eotaxin, a chemokine member of the inflammatory family, we measured its level in the lungs of the vaccinated and control mice. Overall, the level of eotaxin followed the same pattern as IL-5 in the lungs, which correlates with previous work in which 98 IL-5 and eotaxin were associated with acute exacerbation of disease in humans (45). Indeed, the groups of mice that received CpG ODN appeared to produce less eotaxin in the lung than the groups without CpG ODN, even if no statistical differences were observed. Eosinophils play a prominent role in promoting pathophysiologic conditions such as respiratory allergy and airway hyperreactivity (8). Enhanced disease and pulmonary eosinophilia associated with FI-HRSV were reported in the 1960s, when a disease-exacerbating FI vaccine was administered to infants and children in the United States (9, 17, 35, 61), and were also demonstrated in mice (12, 20, 25, 28, 44). In the present study, the percentage of eosinophils was 34% in the lungs of mice vaccinated with FI-BRSV, while this was reduced to 1% when CpG ODN was added. The same pattern was observed when FI-BRSV was codelivered with Em (29% eosinophils), in comparison to Em and CpG ODN (8% eosinophils), which correlated with the production of IL-5 and eotaxin, as previously reported (47). The effects of CpG were further confirmed when the non-CpG ODN did not reduce the amount of eosinophils when formulated with FIBRSV and Emulsigen (36% eosinophils). While the percentage of eosinophils decreased significantly in the presence of CpG ODN, the increase in numbers of neutrophils indicates a possible role of these cells in the clearance of the virus (59). We also determined whether the CpG ODNmediated modulation of the immune responses induced by vaccination would correlate with inhibition of virus replication. The coadministration of CpG ODN with FI- or K-BRSV vaccine resulted in a significant reduction in infectious virus in the lungs after BRSV challenge, so in this study, as in a previous study using the HRSV F protein vaccine (23), CpG ODN contributed to the reduction in virus replication, while non-CpG ODN did not. The results presented here demonstrate for the first time the ability of CpG ODN-formulated inactivated BRSV vaccines to generate balanced or Th1-biased immune responses. Indeed, the increases in serum ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE IgG2a titers and IFN-_ levels, followed by reduction of eosinophilia and IL-5 in the lung, in vaccinated mice correlated with reduced pulmonary immunopathology and ultimately led to protection from virus infection. ACKNOWLEDGMENTS We are grateful to Laura Latimer and Marlene Snider for technical assistance and to the animal care staff, in particular Barry Carroll, at the Vaccine and Infectious Disease Organization, University of Saskatchewan, Saskatoon, Canada, for care and handling of the animals. Financial support was provided by grants from the Natural Sciences and Engineering Research Council of Canada and the Canadian Institutes of Health Research. L.A.B. is the recipient of a Canada Research Chair in Vaccinology. REFERENCES 1. Agrawal, D. K., J. Edwan, E. R. Kandimalla, D. Yu, L. Bhagat, D. Wang, and S. Agrawal. 2004. Novel immunomodulatory oligonucleotides prevent development of allergic airway inflammation and airway hyperresponsi veness in asthma. Int. Immunopharmacol. 4:127–138. 2. Baker, J. C., J. A. Ellis, and E. G. Clark. 1997. Bovine respiratory syncytial virus. Vet. Clin. North Am. Food Anim. Pract. 13:425–454. 3. Ballas, Z. K., W. L. Rasmussen, and A. M. Krieg. 1996. Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J. Immunol. 157:1840–1845. 4. Brandenburg, A. H., H. J. Neijens, and A. D. Osterhaus. 2001. Pathogenesis of RSV lower respiratory tract infection: implications for vaccine development. Vaccine 19:2769–2782. 5. Brazolot Millan, C. L., R. Weeratna, A. M. Krieg, C. A. Siegrist, and H. L.Davis. 1998. CpG DNA can induce strong Th1 humoral and cell-mediated immune responses against hepatitis B surface antigen in young mice. Proc. Natl. Acad. Sci. USA 95:15553–15558. 6. Bright, H., T. Turnbull, G. L. Toms, and R. Scott. 1995. Comparison of the T helper cell response induced by respiratory syncytial virus and its fusion protein in BALB/c mice. Vaccine 13:915–922. 7. Bryson, D. G., M. S. McNulty, E. F. Logan, and P. F. Cush. 1983. Respiratory syncytial virus pneumonia in young calves: clinical and pathologic findings. Am. J. Vet. Res. 44:1648–1655. 8. Busse, W. W., and R. F. Lemanske, Jr. 2001. Asthma. N. Engl. J. Med. 344:350–362. 9. Chin, J., R. L. Magoffin, L. A. Shearer, J. H. Schieble, and E. H. Lennette. 1969. Field evaluation of a respiratory syncytial virus vaccine and a trivalent parainfluenza virus vaccine in a pediatric population. Am. J. Epidemiol. 89:449–463.2030 OUMOUNA ET AL. J. VIROL. Downloaded from http://jvi.asm.org/ on December 4, 2013 by guest 10. Chu, R. S., O. S. Targoni, A. M. Krieg, P. V. Lehmann, and C. V. Harding.1997. CpG oligodeoxynucleotides act as adjuvants that switch on T helper 1 (Th1) immunity. J. Exp. Med. 186:1623–1631. 11. Connors, M., P. L. Collins, C. Y. Firestone, A. V. Sotnikov, A. Waitze, A. R.Davis, P. P. Hung, R. M. Chanock, and B. R. Murphy. 1992. Cotton rats previously immunized with a chimeric RSV FG glycoprotein develop enhanced pulmonary pathology when infected with RSV, a phenomenon not encountered following immunization with vaccinia–RSV recombinants or RSV. Vaccine 10:475–484. 12. Connors, M., N. A. Giese, A. B. Kulkarni, C. Y. Firestone, H. C. Morse III, and B. R. Murphy. 1994. Enhanced pulmonary histopathology induced by respiratory syncytial virus (RSV) challenge of formalin-inactivated RSVimmunized BALB/c mice is abrogated by depletion of interleukin-4 (IL-4) and IL-10. J. Virol. 68:5321–5325. 13. Connors, M., A. B. Kulkarni, C. Y. Firestone, K. L. Holmes, H. C. Morse III, A. V. Sotnikov, and B. R. Murphy. 1992. Pulmonary histopathology induced by respiratory syncytial virus (RSV) challenge of formalininactivated RSVimmunized BALB/c mice is abrogated by depletion of CD4_ T cells. J. Virol. 66:7444–7451. 14. Davis, H. L., R. Weeratna, T. J. Waldschmidt, L. Tygrett, J. Schorr, A. M.Krieg, and R. Weeranta. 1998. CpG DNA is a potent enhancer of specific immunity in mice immunized with recombinant hepatitis B surface antigen. J. Immunol. 160:870– 876. 15. Domachowske, J. B., and H. F. Rosenberg. 1999. Respiratory syncytial virus infection: immune response, immunopathogenesis, and treatment. Clin. Microbiol. Rev. 12:298–309. 16. Filion, M. C., N. Saha, M. Gueddi, and N. C. Phillips. 2003. Development of short non-CpG phosphodiester oligonucleotides as immune stimulatory agents. Vaccine 21:983–989. 17. Fulginiti, V. A., J. J. Eller, O. F. Sieber, J. W. Joyner, M. Minamitani, and G. Meiklejohn. 1969. Respiratory virus immunization. I. A field trial of two inactivated respiratory virus vaccines; an aqueous trivalent parainfluenza virus vaccine and an alum-precipitated respiratory syncytial virus vaccine. Am. J. Epidemiol. 89:435–448. 18. Gershwin, L. J., R. A. Gunther, M. L. Anderson, A. R. Woolums, K.McArthur-Vaughan, K. E. Randel, G. A. Boyle, K. E. Friebertshauser, and P. S. McInturff. 2000. Bovine respiratory syncytial virus-specific IgE is associated with interleukin-2 and -4, and interferon-gamma expression in ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 99 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE pulmonary lymph of experimentally infected calves. Am. J. Vet Res. 61:291–298. 19. Graham, B. S. 1995. Pathogenesis of respiratory syncytial virus vaccineaugmented pathology. Am. J. Respir. Crit. Care Med. 152:S63–S66. 20. Graham, B. S., G. S. Henderson, Y. W. Tang, X. Lu, K. M. Neuzil, and D. G.Colley. 1993. Priming immunization determines T helper cytokine mRNA expression patterns in lungs of mice challenged with respiratory syncytial virus. J. Immunol. 151:2032–2040. 21. Haeberle, H. A., A. Casola, Z. Gatalica, S. Petronella, H. J. Dieterich, P. B.Ernst, A. R. Brasier, and R. P. Garofalo. 2004. I B kinase is a critical regulator of chemokine expression and lung inflammation in respiratory syncytial virus infection. J. Virol. 78:2232–2241. 22. Hancock, G. E., D. J. Hahn, D. J. Speelman, S. W. Hildreth, S. Pillai, and K.McQueen. 1994. The pulmonary immune response of Balb/c mice vaccinated with the fusion protein of respiratory syncytial virus. Vaccine 12:267–274. 23. Hancock, G. E., K. M. Heers, J. D. Smith, C. A. Scheuer, A. R. Ibraghimov, and K. S. Pryharski. 2001. CpG containing oligodeoxynucleotides are potent adjuvants for parenteral vaccination with the fusion (F) protein of respiratory syncytial virus (RSV). Vaccine 19:4874–4882. 24. Hancock, G. E., D. J. Speelman, P. J. Frenchick, M. M. Mineo-Kuhn, R. B.Baggs, and D. J. Hahn. 1995. Formulation of the purified fusion protein of respiratory syncytial virus with the saponin QS-21 induces protective immune responses in Balb/c mice that are similar to those generated by experimental infection. Vaccine 13:391–400. 25. Hancock, G. E., D. J. Speelman, K. Heers, E. Bortell, J. Smith, and C. Cosco. 1996. Generation of atypical pulmonary inflammatory responses in BALB/c mice after immunization with the native attachment (G) glycoprotein of respiratory syncytial virus. J. Virol. 70:7783–7791. 26. Hartmann, G., and A. M. Krieg. 2000. Mechanism and function of a newly identified CpG DNA motif in human primary B cells. J. Immunol. 164:944– 953. 27. Hartmann, G., R. D. Weeratna, Z. K. Ballas, P. Payette, S. Blackwell, I.Suparto, W. L. Rasmussen, M. Waldschmidt, D. Sajuthi, R. H. Purcell, H. L. Davis, and A. M. Krieg. 2000. Delineation of a CpG phosphorothioate oligodeoxynucleotide for activating primate immune responses in vitro and in vivo. J. Immunol. 164:1617– 1624. 28. Haynes, L. M., L. P. Jones, A. Barskey, L. J. Anderson, and R. A. Tripp. 2003. Enhanced disease and pulmonary eosinophilia associated with formalininactivated respiratory syncytial virus vaccination are linked to G glycoprotein CX3C-CX3CR1 interaction and expression of substance P. J. Virol. 77:9831–9844. 100 29. Ijzermans, J. N., and R. L. Marquet. 1989. Interferongamma: a review. Immunobiology 179:456–473. 30. Ioannou, X. P., S. M. Gomis, B. Karvonen, R. Hecker, L. A. Babiuk, and S.van Drunen Littel-van den Hurk. 2002. CpGcontaining oligodeoxynucleotides, in combination with conventional adjuvants, enhance the magnitude and change the bias of the immune responses to a herpesvirus glycoprotein. Vaccine 21:127–137. 31. Ioannou, X. P., P. Griebel, R. Hecker, L. A. Babiuk, and S. van Drunen Littel-van den Hurk. 2002. The immunogenicity and protective efficacy of bovine herpesvirus 1 glycoprotein D plus Emulsigen are increased by formulation with CpG oligodeoxynucleotides. J. Virol. 76:9002–9010. 32. Ioannou, X. P., P. Griebel, A. Mena, S. M. Gomis, D. L. Godson, G. Mutwiri, R. Hecker, L. A. Babiuk, and S. van Drunen Littel-van den Hurk. 2003. Safety of CpG oligodeoxynucleotides in veterinary species. Antisense Nucleic Acid Drug Dev. 13:157–167. 33. Jakob, T., P. S. Walker, A. M. Krieg, M. C. Udey, and J. C. Vogel. 1998. Activation of cutaneous dendritic cells by CpGcontaining oligodeoxynucleotides: a role for dendritic cells in the augmentation of Th1 responses by immunostimulatory DNA. J. Immunol. 161:3042–3049. 34. Kalina, W. V., A. R. Woolums, R. D. Berghaus, and L. J. Gershwin. 2004. Formalin-inactivated bovine RSV vaccine enhances a Th2 mediated immune response in infected cattle. Vaccine 22:1465–1474. 35. Kim, H. W., J. G. Canchola, C. D. Brandt, G. Pyles, R. M. Chanock, K.Jensen, and R. H. Parrott. 1969. Respiratory syncytial virus disease in infants despite prior administration of antigenic inactivated vaccine. Am. J. Epidemiol. 89:422–434. 36. Kimman, T. G., M. R. Daha, J. M. Brinkhof, and F. Westenbrink. 1989. Activation of complement by bovine respiratory syncytial virus-infected cells. Vet. Immunol. Immunopathol. 21:311–325. 37. Kimman, T. G., J. Sol, F. Westenbrink, and P. J. Straver. 1989. A severe outbreak of respiratory tract disease associated with bovine respiratory syncytial virus probably enhanced by vaccination with modified live vaccine. Vet.Q. 11:250–253. 38. Kimman, T. G., and F. Westenbrink. 1990. Immunity to human and bovine respiratory syncytial virus. Arch. Virol. 112:1– 25. 39. Klinman, D. M. 2004. Immunotherapeutic uses of CpG oligodeoxynucleotides. Nat. Rev. Immunol. 4:249–258. 40. Klinman, D. M., A. K. Yi, S. L. Beaucage, J. Conover, and A. M. Krieg. 1996. CpG motifs present in bacteria DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12, and interferon gamma. Proc. Natl. Acad. Sci.USA 93:2879–2883. 41. Krieg, A. M. 2000. The role of CpG motifs in innate immunity. Curr. Opin.Immunol. 12:35–43. ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 42. Krieg, A. M., L. Love-Homan, A. K. Yi, and J. T. Harty. 1998. CpG DNA induces sustained IL-12 expression in vivo and resistance to Listeria monocytogenes challenge. J. Immunol. 161:2428–2434. 43. Murphy, B. R., and E. E. Walsh. 1988. Formalin-inactivated respiratory syncytial virus vaccine induces antibodies to the fusion glycoprotein that are deficient in fusion-inhibiting activity. J. Clin. Microbiol. 26:1595–1597. 44. Openshaw, P. J., S. L. Clarke, and F. M. Record. 1992. Pulmonary eosinophilic response to respiratory syncytial virus infection in mice sensitized to the major surface glycoprotein G. Int. Immunol. 4:493–500. 45. Park, S. W., J. Kim Do, H. S. Chang, S. J. Park, Y. M. Lee, J. S. Park, I. Y.Chung, J. H. Lee, and C. S. Park. 2003. Association of interleukin-5 and eotaxin with acute exacerbation of asthma. Int. Arch. Allergy Immunol. 131:283–290. 46. Polack, F. P., M. N. Teng, P. L. Collins, G. A. Prince, M. Exner, H. Regele, D. D. Lirman, R. Rabold, S. J. Hoffman, C. L. Karp, S. R. Kleeberger, M. Wills-Karp, and R. A. Karron. 2002. A role for immune complexes in enhanced respiratory syncytial virus disease. J. Exp. Med. 196:859–865. 47. Rojas-Ramos, E., A. F. Avalos, L. Perez-Fernandez, F. Cuevas-Schacht, E.Valencia-Maqueda, and L. M. Teran. 2003. Role of the chemokines RANTES, monocyte chemotactic proteins-3 and -4, and eotaxins-1 and -2 in childhood asthma. Eur. Respir. J. 22:310–316. 48. Samani, T. D., B. Jolles, and A. Laigle. 2001. Best minimally modified antisense oligonucleotides according to cell nuclease activity. Antisense Nucleic Acid Drug Dev. 11:129–136. 49. Sasaki, S., F. Takeshita, K. Q. Xin, N. Ishii, and K. Okuda. 2003. Adjuvant formulations and delivery systems for DNA vaccines. Methods 31:243–254. 50. Sigurs, N., R. Bjarnason, F. Sigurbergsson, and B. Kjellman. 2000. Respiratory syncytial virus bronchiolitis in infancy is an important risk factor for asthma and allergy at age 7. Am. J. Respir. Crit. Care Med. 161:1501–1507. 51. Stein, R. T., D. Sherrill, W. J. Morgan, C. J. Holberg, M. Halonen, L. M.Taussig, A. L. Wright, and F. D. Martinez. 1999. Respiratory syncytial virus in early life and risk of wheeze and allergy by age 13 years. Lancet 354:541–545. 52. Stern, B. V., B. O. Boehm, and M. Tary-Lehmann. 2002. Vaccination with tumor peptide in CpG adjuvant protects via IFNgamma-dependent CD4 cell immunity. J. Immunol. 168:6099– 6105. 53. Stott, E. J., and G. Taylor. 1985. Respiratory syncytial virus. Arch. Virol. 84:1–52. 54. Stott, E. J., G. Taylor, L. A. Ball, K. Anderson, K. K. Young, A. M. King, and G. W. Wertz. 1987. Immune and histopathological responses in animals vaccinated with recombinant vaccinia viruses that express individual genes of human respiratory syncytial virus. J. Virol. 61:3855–3861. 55. Taylor, G., F. A. Rijsewijk, L. H. Thomas, S. G. Wyld, R. M. Gaddum, R. S Cook, W. I. Morrison, E. Hensen, J. T. van Oirschot, and G. Keil. 1998. Resistance to bovine respiratory syncytial virus (BRSV) induced in calves by a recombinant bovine herpesvirus-1 expressing the attachment glycoprotein of BRSV. J. Gen. Virol. 79:1759–1767. 56. Tjornehoj, K., A. Uttenthal, B. Viuff, L. E. Larsen, C. Rontved, and L.Ronsholt. 2003. An experimental infection model for reproduction of calf pneumonia with bovine respiratory syncytial virus (BRSV) based on one combined exposure of calves. Res. Vet. Sci. 74:55–65. 57. Valarcher, J. F., H. Bourhy, A. Lavenu, N. BourgesAbella, M. Roth, O.Andreoletti, P. Ave, and F. Schelcher. 2001. Persistent infection of B lymphocytes by bovine respiratory syncytial virus. Virology 291:55–67. 58. Van der Poel, W. H., A. Brand, J. A. Kramps, and J. T. Van Oirschot. 1994. Respiratory syncytial virus infections in human beings and in cattle. J. Infect. 29:215–228. 59. Viuff, B., K. Tjornehoj, L. E. Larsen, C. M. Rontved, A. Uttenthal, L.Ronsholt, and S. Alexandersen. 2002. Replication and clearance of respiratory syncytial virus: apoptosis is an important pathway of virus clearance after experimental infection with bovine respiratory syncytial virus. Am. J.Pathol. 161:2195–2207. 60. Walker, P. S., T. Scharton-Kersten, A. M. Krieg, L. LoveHoman, E. D.Rowton, M. C. Udey, and J. C. Vogel. 1999. Immunostimulatory oligodeoxynucleotides promote protective immunity and provide systemic therapy for leishmaniasis via IL-12- and IFN-gamma-dependent mechanisms. Proc.Natl. Acad. Sci. USA 96:6970–6975. 61. Weibel, R. E., J. Stokes, Jr., M. B. Leagus, C. C. Mascoli, and M. R.Hilleman. 1966. Respiratory virus vaccines. V. Field evaluation for efficacy of heptavalent vaccine. Am. Rev. Respir. Dis. 94:362–379. 62. Welliver, R. C., T. N. Kaul, and P. L. Ogra. 1980. The appearance of cell-bound IgE in respiratory-tract epithelium after respiratory-syncytialvirus infection. N. Engl. J. Med. 303:1198– 1202. 63. Welliver, R. C., D. T. Wong, M. Sun, E. Middleton, Jr., R. S. Vaughan, and P. L. Ogra. 1981. The development of respiratory syncytial virus-specific IgE and the release of histamine in nasopharyngeal secretions after infection. N. Engl. J. Med. 305:841–846. 64. Woolums, A. R., R. S. Singer, G. A. Boyle, and L. J. Gershwin. 1999. Interferon gamma production during bovine respiratory syncytial virus (BRSV) infection is diminished in calves vaccinated with formalin-inactivated BRSV. Vaccine 17:1293–1297 ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 101 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO-DZ GUEST COURSE Dr. Smail MEZIANI Président de l'Institut Européen des Antioxydants (IEA) 102 Responsable de la Licence d'Ingénierie de la Santé «Nutrition Humaine » Laboratoire d'Ingénierie des Biomolécules (LIBio) Faculté de Médecine - Université de Lorraine - 2 Avenue de la Forêt de Haye 54 500 Vandoeuvre les Nancy [email protected] : +33 (0) 3 83 68 36 83 : +33 (0) 6 01 30 27 66 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 103 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ISOM PRESS Orthomolecular Medicine News Service, January 27, 2014 NOT TAKING SUPPLEMENTS CAUSES MISCARRIAGE, BIRTHING PROBLEMS, INFANT MORTALITY BY ANDREW W. SAUL, EDITOR (OMNS Jan 27, 2014) It is simply incredible what people have been told about vitamins. Now the press is trying to scare women away from prenatal supplements. (1,2) Didn't see that one coming, now, did you? Several friends who work as missionaries asked me if vitamin C supplementation would help the indigenous peoples they work with in South American rainforests. Since I think supplemental C is valuable for all humans, I said "yes." They took it from there, and for years now have been giving multi-thousand-milligram doses of ascorbic acid powder to the natives daily. The result is that miscarriage and infant mortality rates have plummeted. VITAMIN C PROTECTS MOTHER AND BABY Far from being an abortifacient, vitamin C in fact helps hold a healthy pregnancy right from the start. Pediatrician Lendon Smith, M.D., known to TV audiences nationwide as "The Children's Doctor, had this to say: "Vitamin C is our best defense and everyone should be on this one EVEN BEFORE BIRTH. Three thousand mgs daily for the pregnant woman is a start. The baby should get 100 mg per day per month of age." For centuries, postpartum hemorrhage was a leading cause of death in childbed. Hemorrhage very often occurs in scorbutic (vitamin C deficient) patients. (3) Optimum dosing with vitamin C prevents hemorrhage and saves women's lives. One way it may do this is by strengthening the walls of the body's large and small blood vessels. "HARMFUL EFFECTS HAVE BEEN MISTAKENLY ATTRIBUTED TO VITAMIN C, INCLUDING HYPOGLYCEMIA, REBOUND SCURVY, INFERTILITY, MUTAGENESIS, AND DESTRUCTION OF VITAMIN B(12). HEALTH PROFESSIONALS SHOULD RECOGNIZE THAT VITAMIN C DOES NOT PRODUCE THESE EFFECTS." (Levine M et al, JOURNAL OF THE AMERICAN MEDICAL ASSOCIATION, April 21, 1999. Vol 281, No 15, p 1419) 104 Dr. Frederick R. Klenner, M.D., gave very large doses of vitamin C to over 300 pregnant women and reported virtually no complications in any of the pregnancies or deliveries (4). Indeed, the hospital nurses around Reidsville, North Carolina, noted that the infants who were healthiest and happiest were the "Vitamin C babies." Abram Hoffer, M.D., has similarly reported that he has observed a complete absence of birth defects in babies born to his vitamin-C taking mothers-to-be. Specifically, Klenner gave: (1) 4,000 mg each day during the first trimester (first three months of pregnancy) (2) 6,000 mg each day during the second trimester (3) 8,000 to 10,000 mg each day during the third trimester Some women got 15,000 mg daily during the third trimester. There were no miscarriages in this entire group of 300 women. Klenner gave "booster" injections of vitamin C to 80% of the women upon admission to the hospital for childbirth. But just with oral supplemental vitamin C, the results were wonderful. First, labor was shorter and less painful. (My children's mother, with her 2 hr 45min and 1hr 45 min labor times, can confirm this.) Second, stretch marks were seldom to be seen. (Yes, I can vouch for this, too.) Third, there were no postpartum hemorrhages at all. And, there were no toxic manifestations and no cardiac distress. Among Klenner's patients were the Fultz quadruplets, which at the time were the only quads in the southeastern U.S. to have survived. Vitamin C even helps with conception. Vitamin C supplementation increases sperm production. More sperm, stronger sperm and better swimming sperm all manifested within only FOUR DAYS, at 1,000 mg daily C doses, in a University of Texas study. And this has been known now for over 30 years; it was first reported in MEDICAL TRIBUNE, May 11, 1983. (5) SEX: ANOTHER REASON TO TAKE VITAMIN C SUPPLEMENTS? A randomized, double-blind, placebo-controlled 14 day trial of 3,000 mg per day of vitamin C reported greater frequency of sexual intercourse. The vitamin C group (but not the placebo group) also experienced a decrease in Beck Depression scores. This is probably due to the fact that vitamin C "modulates catecholaminergic activity, decreases stress reactivity, approach anxiety and prolactin release, improves vascular function, and increases oxytocin release. These processes are relevant to sexual behavior and mood." (6) ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Supplemental vitamin C is also good for rapidly reproducing rabbits and fabulously fertile fish. (7,8) And the odd thing here is that fish and rabbits make their own vitamin C, inside their bodies, 24/7. Humans don't, and can't. If animals that make vitamin C benefit from more of it, then people who cannot make C (and that is all of us) will benefit more. VITAMIN E SUPPLEMENTATION PREVENTS MISCARRIAGE This has been well known for nearly 80 years. "1922 WAS THE YEAR THE USSR WAS FORMED AND ALEXANDER GRAHAM BELL DIED. AND IT WAS THE YEAR THAT VITAMIN E WAS DISCOVERED BY H. M. EVANS AND K. S. BISHOP. IN 1936, EVANS' TEAM HAD ISOLATED ALPHA TOCOPHEROL FROM WHEAT GERM OIL AND VITAMIN E WAS BEGINNING TO BE WIDELY APPRECIATED, AND THE CONSEQUENCES OF DEFICIENCY BETTER KNOWN. HEALTH CULTURE MAGAZINE FOR JANUARY, 1936 SAID, "THE FERTILITY FOOD FACTOR IS NOW CALLED VITAMIN E. THE EXPECTANT MOTHER REQUIRES VITAMIN E TO INSURE THE CARRIAGE OF HER CHARGE TO A COMPLETE AND NATURAL TERM. IF HER DIET IS DEFICIENT IN VITAMIN E, THE WOMAN IS VERY APT TO ABORT. IT IS MORE DIFFICULT TO INSURE A LIBERAL VITAMIN E SUPPLY IN THE DAILY AVERAGE DIET THAN TO INSURE AN ADEQUATE SUPPLY OF ANY OTHER KNOWN VITAMIN." "AS EARLY AS 1931, VOGT-MOLLER OF DENMARK SUCCESSFULLY TREATED HABITUAL ABORTION IN HUMAN FEMALES WITH WHEAT GERM OIL VITAMIN E. BY 1939 HE HAD TREATED SEVERAL HUNDRED WOMEN WITH A SUCCESS RATE OF ABOUT 80%. IN 1937, BOTH YOUNG IN ENGLAND AND THE SHUTES IN CANADA REPORTED SUCCESS IN COMBATING THREATENED ABORTION AND PREGNANCY TOXEMIAS AS WELL. A. L. BACHARACH'S 1940 STATISTICAL ANALYSIS OF PUBLISHED CLINICAL RESULTS "SHOW QUITE DEFINITELY THAT VITAMIN E IS OF VALUE IN RECURRENT ABORTIONS." "YET WHEN THE MDR'S (MINIMUM DAILY REQUIREMENTS) FIRST CAME OUT IN 1941, THERE WAS NO MENTION OF VITAMIN E. IT WAS NOT UNTIL 1959 THAT VITAMIN E WAS RECOGNIZED BY THE U.S. FOOD AND DRUG ADMINISTRATION AS NECESSARY FOR HUMAN EXISTENCE, AND NOT UNTIL 1968 THAT ANY GOVERNMENT RECOMMENDATION FOR VITAMIN E WOULD BE ISSUED." (9) Taking supplemental vitamin E (at least 200 IU and perhaps 400 IU daily) greatly reduces the chance of miscarriage. By the end of WW II, there were already dozens of medical studies confirming this. (10) VITAMINS VITAL FOR PREGNANCY Vitamins deliver healthier babies. The first few weeks of pregnancy are especially crucial to the developing embryo. Yet many women only begin to eat right and take necessary vitamin supplements once they know they are pregnant. This is weeks or even months too late. Nutrition needs rise during pregnancy. Even the RDA's are higher. This may be obvious to you, but many women eat really poor diets in general. Then, in a vain attempt to "get all the nutrition they need from a balanced diet" while "eating for two," they tend to eat more of that same poor diet. Telling them to not take prenatal supplements is a genuine tragedy, for which the media and the medical professions cannot easily be excused. One can only wonder why the media continually, repeatedly fails to even mention how vitamin supplementation benefits mother and baby. Here is what they missed: If you REALLY want to avoid miscarriages and birth defects, avoid drugs of all kinds, prescription and over-the-counter. Avoid alcohol, cigarettes, and all but the most essential medications. Vitamins are safer, vastly safer, than any drug. A really good diet, properly supplemented with a daily multivitamin plus appropriate quantities of other vitamins, will go a very long way to protect mother and baby. (ANDREW W. SAUL FOUNDED THE ORTHOMOLECULAR MEDICINE NEWS SERVICE AT THE REQUEST OF DRS. ABRAM HOFFER AND HUGH RIORDAN. OMNS IS CELEBRATING ITS 10TH YEAR OF CONTINUOUS, FREE ACCESS, PEERREVIEWED PUBLICATION. SOME OF THE TEXT OF THIS ARTICLE HAS PREVIOUSLY APPEARED IN ANDREW W. SAUL'S BOOKS Doctor Yourself AND Fire Your Doctor! THAT COPYRIGHTED MATERIAL IS REPRINTED HERE WITH PERMISSION OF THE AUTHOR AND BASIC HEALTH PUBLICATIONS, INC.) ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 105 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE REFERENCES: 1. http://www.dailymail.co.uk/health/article2546477/Taking-multivitamins-raise-risk-miscarriageMothers-likely-lose-baby-taking-supplements-six-weeksconception.html 2. http://ije.oxfordjournals.org/content/early/2014/01/21/ije. dyt214.abstract 3. http://www.doctoryourself.com/mccormick.html 4. http://www.doctoryourself.com/klennerpaper.html See also: Stone, I. (1972) The Healing Factor. New York: Grosset and Dunlap. Chapter 28. http://vitamincfoundation.org/stone/ 5. http://jama.jamanetwork.com/article.aspx?articleid=386 823 See also: Dawson EB, Harris WA, Rankin WE, Charpentier LA, McGanity WJ. Effect of ascorbic acid on male fertility. Ann N Y Acad Sci. 1987;498:312-23. PMID: 3476000 http://www.ncbi.nlm.nih.gov/pubmed/3476000 ; and: Dawson EB, Harris WA, Teter MC, Powell LC. Effect of ascorbic acid supplementation on the sperm quality of smokers. Fertil Steril. 1992 Nov;58(5):10349. http://www.ncbi.nlm.nih.gov/pubmed/1426355. 6. Brody S. High-dose ascorbic acid increases intercourse frequency and improves mood: a randomized controlled clinical trial. Biol Psychiatry 2002 Aug 15; 52(4):3714)http://www.ncbi.nlm.nih.gov/pubmed/12208645 7. Yousef MI, Abdallah GA, Kamel KI. Effect of ascorbic acid and vitamin E supplementation on semen quality and biochemical parameters of male rabbits. Anim Reprod Sci. 2003. PMID:12559724http://www.ncbi.nlm.nih.gov/pubmed/1255 9724 8. Ciereszko A, Dabrowski K. Sperm quality and ascorbic acid concentration in rainbow trout semen are affected by dietary vitamin C: an across-season study. Biol Reprod. 1995. PMID:7626724http://www.ncbi.nlm.nih.gov/pubmed/76267 24 9. Saul AW. Vitamin E: A cure in search of recognition, by Andrew W. Saul. Reprinted with permission from the Journal of Orthomolecular Medicine, 2003; 18: 3-4, p. 205212. http://orthomolecular.org/library/jom/2003/pdf/2003v18n0304-p205.pdf 10. Bicknell F and Prescott F. (1953) The Vitamins in Medicine, Third Edition. William Heinemann Medical Books Ltd. http://www.worldcat.org/title/vitamins-inmedicine/oclc/8581908/editions?referer=di&editionsView=t rue 106 MORE ABOUT THE HISTORY OF VITAMIN SUPPLEMENTATION DURING PREGNANCY: Dr. F. R. Klenner's megavitamin vitamin C therapy: http://www.doctoryourself.com/klennerpaper.html and http://www.doctoryourself.com/klenner_table.html Case HS. Vitamins and Pregnancy: The Real Story. Basic Health Publications, CA. In press. Hillemann, H. H. (1961) "The Spectrum of Congenital Defect, Experimental and Clinical" Journal of Applied Nutrition 14:1,2. Smith, L., ed. (1988) Clinical Guide to the Use of Vitamin C: The Clinical Experiences of Frederick R. Klenner, M.D. Tacoma, WA: Life Sciences Press. http://www.whale.to/a/smith_b.html andhttp://www.s eanet.com/~alexs/ascorbate/198x/smith-lhclinical_guide_1988.htm ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ISOM PRESS Orthomolecular Medicine News Service, February 15, 2014 A TIMELINE OF VITAMIN MEDICINE BY ANDREW W. SAUL, EDITOR (OMNS Feb 15, 2014) Don't get bogged down by silly claims that multiple vitamins kill, or that antioxidants are bad for you. It is high time to take a look at the record, and review what published medical research actually has been saying for eight decades. Year Research 1935 Claus Washington Jungeblut, MD, professor of bacteriology at DYSFUNCTION. 1950 Vitamin E is shown to be an effective treatment for lupus erythematosus, varicose veins, and severe body burns. 1951 Vitamin D treatment is found to be effective against Hodgkin's disease (a cancer of the lymphatic system) and epithelioma. 1954 Abram Hoffer, MD, PhD, and colleagues demonstrate that niacin (vitamin B3) can cure schizophrenia; the Shutes' medical textbook ALPHA TOCOPHEROL IN CARDIOVASCULAR DISEASE is published; and Dr. McCormick reports that cancer patients tested for vitamin C were seriously deficient, often by as much as 4,500 milligrams. 1955 Niacin is first shown to lower serum cholesterol. 1956 Mayo Clinic researcher William Parsons, MD, and colleagues confirm Hoffer's use of niacin to lower cholesterol and prevent cardiovascular disease; Dr. Harrell demonstrates that supplementation of the pregnant and lactating mothers' diet with vitamins increases the intelligence quotients of their offspring at three and four years of age. 1957 Dr. McCormick publishes on how vitamin C fights cardiovascular disease. Columbia University, first publishes on vitamin C as prevention and treatment for polio; in the same year, Jungeblut also shows that vitamin1960 Dr. Hoffer meets Bill W., cofounder of Alcoholics Anonymous, and uses C inactivates diphtheria toxin. niacin to eliminate Bill's longstanding severe depression. 1936 Evan Shute, MD, and Wilfrid Shute, MD, demonstrate that vitamin E- 1963 Vitamin D is shown to prevent breast cancer. rich wheat germ oil cures angina. 1937 Dr. Jungeblut demonstrates that ascorbate (vitamin C) inactivated tetanus toxin. 1939 William Kaufman, MD, PhD, successfully treats arthritis with niacinamide (vitamin B3). 1940 The Shute brothers publish that vitamin E prevents fibroids and endometriosis, and is curative for atherosclerosis. 1964 Vitamin D is found to be effective against lymph nodal reticulosarcoma (a non-Hodgkin's lymphatic cancer). 1968 Linus Pauling, PhD, publishes the theoretical basis of high-dose nutrient therapy (orthomolecular medicine) in psychiatry in SCIENCE, and soon after defines orthomolecular medicine as "the treatment of disease by the provision of the optimum molecular environment, especially the optimum concentrations of substances normally present in the human body." 1942 Ruth Flinn Harrell, PhD, measures the positive effect of added thiamine 1969 Robert F. Cathcart, MD, uses large doses of vitamin C to treat (B1) on learning. 1945 Vitamin E is shown to cure hemorrhages in the skin and mucous membranes, and to decrease the diabetic's need for insulin. 1946 Vitamin E is shown to greatly improve wound healing, including skin pneumonia, hepatitis, and, years later, acquired immune deficiency syndrome (AIDS). 1970 Dr. Pauling publishes VITAMIN C AND THE COMMON COLD and Dr. Williams publishesNUTRITION AGAINST DISEASE. ulcers. It is also demonstrated that vitamin E strengthens and regulates 1972 Publication of THE HEALING FACTOR: "VITAMIN C" AGAINST heartbeat, and is effective in cases of claudication, acute nephritis, DISEASE by Irwin Stone, PhD. thrombosis, cirrhosis, and phlebitis; also, William J. McCormick, MD, shows how vitamin C prevents and also cures kidney stones. 1973 Dr. Klenner publishes his vitamin supplement protocol to arrest and reverse multiple sclerosis. So does Dr. HT Mount, reporting on 27 1947 Vitamin E is successfully used as therapy for gangrene, inflammation of years of success using thiamine. blood vessels (Buerger's disease), retinitis, and choroiditis; Roger J. Williams, PhD, publishes on how vitamins can be used to treat 1975 Hugh D. Riordan, MD, and colleagues successfully use large doses of alcoholism. intravenous vitamin C against cancer. 1948 Frederick R. Klenner, MD, a board-certified specialist in diseases of the1976 Ewan Cameron, MD, and other physicians in Scotland show that chest, publishes cures of 41 cases of viral pneumonia using very high doses of vitamin C. 1949 Dr. Kaufman publishes THE COMMON FORM OF JOINT intravenous vitamin C improved quality and length of life in terminal cancer patients 1982 In Japan, Murata, Morishige, and Yamaguchi show that vitamin C ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 107 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE greatly prolonged the lives of terminal cancer patients. 2014 In patients with mild to moderate Alzheimer's disease, 2,000 IU of 1984 Robert F. Cathcart, MD, publishes on the vitamin C treatment of AIDS. 1986 Publication of HOW TO LIVE LONGER AND FEEL BETTER by Linus Pauling. natural vitamin E slows the decline compared to placebo. Data from 561 patients showed that those taking vitamin E function significantly better in daily life, and required the least care. Vitamin C greatly reduces chemotherapy side effects and improves cancer patient survival. 1988 Dr. Lendon H. Smith publishes VITAMIN C AS A FUNDAMENTAL For specific references on these subjects, just copy and paste MEDICINE: ABSTRACTS OF DR. FREDERICK R. KLENNER, any of the brief descriptions above into a search engine and M.D.'S PUBLISHED AND UNPUBLISHED WORK, now known press "enter." Doctors and reporters that say "they have not as CLINICAL GUIDE TO THE USE OF VITAMIN C. seen any good evidence that vitamins cure disease" are telling 1990 American doctors successfully use vitamin C to treat kidney cancer, you the truth: yes, they have never seen it. That's not because it and in 1995 and 1996, other cancers. isn't available; it's because they have never done even this 1993 Large-scale studies show that vitamin E supplementation reduces the simple step. risk of coronary heart disease in men and women. 1995 Dr. Riordan and colleagues publish their protocol for intravenous vitamin C treatment of cancer. 2002 Vitamin E shown to improve immune functions in patients with advanced colorectal cancer, by immediately increasing T helper 1 cytokine production. 2004 Doctors in America and Puerto Rico publish more clinical cases of vitamin C successes against cancer. 2005 Research sponsored by the U.S. National Institutes of Health shows that high levels of vitamin C kill cancer cells without harming normal cells. 2006 Canadian doctors report intravenous vitamin C is successful in treating cancer. 2007 Harold D. Foster and colleagues publish a double-blind, randomized clinical trial showing that HIV-positive patients given supplemental nutrients can delay or stop their decline into AIDS. 2008 Korean doctors report that intravenous vitamin C "plays a crucial role in the suppression of proliferation of several types of cancer," notably melanoma. And, natural vitamin E is demonstrated to substantially reduce risk of lung cancer by 61%. 2009, Intravenous Vitamin C and Cancer Symposiums filmed and made 2010, available for free-access 2012 online. http://www.riordanclinic.org/education/symposium/s2009 (twelve lectures), http://www.riordanclinic.org/education/symposium/s2010 (nin e lectures) andhttp://www.riordanclinic.org/education/symposium/s2012 (eleven lectures) 2011 Each 20 micromole/liter (µmol/L) increase in plasma vitamin C is associated with a 9% reduction in death from heart failure. Also, B complex vitamins are associated with a 7 percent decrease in mortality, vitamin D with an 8 percent decrease in mortality. 2012 Vitamin C shown to prevent and treat radiation-damaged DNA. 2013 B-vitamin supplementation seen to slow the atrophy of specific brain regions that are a key component of the Alzheimer's disease process and are associated with cognitive decline. 108 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ISOM PRESS Orthomolecular Medicine News Service, March 18, 2014 S U P PL EM EN T S AC C EL ER A T E BEN Z OD I AZ EP I N E W I T H D R AW A L A CASE REPORT AND BIOCHEMICAL RATIONALE BY W. TODD PENBERTHY, PHD AND ANDREW W. SAUL (OMNS March 18, 2014) A middle-aged male had success rapidly reducing fast-acting alprazolam (Xanax) dosage by taking very high doses of niacin, along with gamma aminobutyric acid (GABA) and vitamin C. The individual had been on 1 mg/day Xanax for two years, a moderate dose but a long duration. As a result, he had been presenting increased anxiety, personality changes, and ringing in the ears (tinnitus), all side effects likely due to long-term alprazolam use. Typical withdrawal from this drug would involve substitution medication, about a 10% dose reduction per week, and take a matter of months.[1] A fast withdrawal is a 12.5 to 25% reduction per week.[2] On very high doses of niacin, vitamin C, and also GABA, this individual reported being able to cut the dose 60% down to 0.4 mg in one week. The dose was reduced by 90% (to 0.1 mg/day) in less than a month. He reported residual anxiety, but that it was substantially less than when fully medicated. After a total of five weeks, the medication intake was zero, with minimal residual anxiety. DOSAGE Niacin doses were between 6,000 and 12,000 mg/day. The individual reported reduced anxiety when taking the highest levels of niacin. Bowel-tolerance levels of vitamin C were taken daily, along with 750 mg of GABA twice daily. The individual also drank a quart of beet/cabbage soup broth daily for the first week, took 400 mg magnesium citrate/day, and took sublingual methylcobalamin (hi-absorption B-12), 5,000 mcg twice a week. During the initial total withdrawal from alprazolam, intake of GABA was 750 mg three times daily. The patient experienced side effects of daily but manageable anxiety. He also reported occasional nausea, possibly attributable to the GABA and almost certainly attributable to the extremely high niacin intake. He experienced increased frequency of urination, especially at night. Evening niacin doses as inositol hexaniacinate (a semi-sustained release, no-flush niacin) reduced nighttime urination. The individual used regular flush niacin about three-quarters of the time; inositol hexaniacinate constituted the balance. Dosage was divided into eight to ten 1,000 mg 8-10 such doses in 24 hours. Niacinamide was specifically not used, as its nausea threshold is low (under 6,000 mg day). NIACIN MECHANISM OF ACTION Dr. Abram Hoffer had observed beneficial anticonvulsant activity by performing coadministration of niacinamide with anticonvulsants to treat epileptics in the early 1950s (personal communication). The dosage of the anticonvulsant could be reduced by 50% when 1,0002,000 mg of niacin was administered with each meal. Hoffer noted that this was beneficial to patients because at the lower dose of anticonvulsant they were not nearly as drowsy. In the late 1970s niacinamide was reported to be a ligand for the benzodiazepine receptor with physiological activities. Later studies suggested that the effect is not based on a direct specific interaction between niacinamide and benzodiazepine receptors.[3-5] However, ten years later a completely different benzodiazepine-binding receptor was identified in the peripheral nervous system.[6] This peripheral benzodiazepine receptor, known as translocator protein (TSPO), can modulate neurosteroids, which can alter neuronal excitability through interactions with GABA neurotransmitter ion channels. This can enhance GABA receptor function.[7] A common question is, how exactly GABA taken orally can help if it does not readily cross the blood brain barrier (BBB). While GABA receptors are primarily known for their CNS locations and functions, there are also GABA receptors in the liver, immune cells, and lung cells that are accessible to bind GABA without crossing the BBB. The peripheral benzodiazepine receptor TSPO, as mentioned above, is one example. This can activate neurons in peripheral nerves that ultimately affect the CNS as well. This case report described however, showed a positive result when using niacin. The common theme here is nicotinamide adenine dinucleotide (NAD) since both niacin and niacinamide are converted to NAD by the body. This indicates that therapeutic benefit is most likely being mediated via the increase in NAD levels, not through activation of the high affinity niacin G-protein coupled receptor, GPR109a, which niacinamide does not bind. NAD is used in over 450 reactions by the body, which is more than any other vitamin-derived molecule. The ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 109 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE following are just a small list of the pathways that are dependent on it: drug/xenobiotic metabolism, steroid metabolism, basic glycolysis/TCA ATP generation, and many more. These pathways are quite complicated, but one thing is for certain. We are susceptible to niacin deficiency as exemplified by the deadly pellagra epidemics in the first two decades of the 20 century, which killed over 100,000 people in the southern United States. Due to this epidemic, President Roosevelt commissioned epidemiologists to begin working on this serious problem. Many people with skin disorders were placed in sanitariums because common subclinical pellagra symptoms are dermatitis and sensitivity to sunlight. Niacin is thought to help maintain homeostasis of neurotransmitters that are commonly unbalanced in the brains of those with anxiety [8], and it may also alter the metabolism of Xanax. As a primary participant in the hydroxylation reaction characteristic of phase 1 drugmetabolizing enzymes, NAD can speed up the metabolism of toxic waste products arising from the metabolism of the foreign alprazolam molecule.[8,9] Specifically, Xanax is metabolized by the enzyme CYP3A4. Xanax induces CYP3A4 expression, meaning the body responds to Xanax administration by making more of the enzyme that degrades the Xanax molecule. The enzymatic reaction is dependent on the presence of the cofactor NAD, which is derived from niacin in the diet. The drug metabolizing enzyme reaction cannot proceed without the presence of all 3: the substrate (Xanax), the enzyme (CYP3A4), and the cofactor in NAD (derived from niacin). Individuals taking Xanax are likely to have high levels of the drug and the enzyme. But the metabolic reaction utilizing this enzyme that degrades the drug is commonly limited by insufficient levels of the cofactor, NAD. By administering high doses of niacin, the concentration of NAD is increased, which then accelerates the rate of the drug-metabolizing reaction, ultimately clearing the drug from the body faster. The niacin flush / vasodilation is likely to aid in delivery to otherwise hard to reach anatomical locations as well as increase physical flow of the drug metabolites. GABA GABA seems likely to be a safer replacement to withdraw from as compared to simple weaning off of alprazolam. Using GABA is an orthomolecular approach, involving manipulating a substance normally present in the body. 110 Ingested GABA will be metabolized by the normal endogenous mechanisms, for which humans have evolved to control properly. GABA will likely be cleared better than alprazolam and not be afflicted with the non-specific affects associated with the foreign molecule that GABA is. GABA is one of the main inhibitory neurotransmitters in the brain. Oral GABA does not cross the blood brain barrier (BBB), but yet GABA oral ingestion still exerts the calming effect that is attributed to GABA activity. Low GABA is detectable in Xanax withdrawal, while plenty of GABA enables one to feel calm and to sleep better. GABA has been successfully used to assist with Xanax withdrawal .[10] Another molecule, picamilon, is a niacin molecule bonded to GABA as one single molecule that may be useful. Picamilon crosses the BBB and then is broken down to niacin and GABA. Picamilon can help restore GABA receptor levels. Also GABA is degraded into succinate, which in its own right can provide a significant source of energy as it directly enters the TCA cycle. Even though the exact reason is unknown, people taking GABA have noticed calming effects. The placebo effect may be responsible for part of the benefit. However, it is likely at high doses some GABA does get into the CNS. VITAMIN C Because ascorbate in high doses is a strong antitoxin [11], it is considered to be an important inclusion. Flu-like symptoms common in benzodiazepine withdrawal may be ameliorated with vitamin C. Ascorbate also provides support for the liver, ranging from 500 mg/day preventing fatty buildup and cirrhosis to 5,000 mg of vitamin C per day appearing to actually flush fats from the liver, to 50,000 mg/day eliminating jaundice in under a week. [12] MAGNESIUM Magnesium depletion is common in nearly all examples of people ingesting drugs. Thus, magnesium supplements are helpful. Nightly Epsom salt baths and 400 mg of magnesium citrate, once in the morning and once in the afternoon can facilitate a smooth transition away from alprazolam. Also realize that if you desire to measure your magnesium levels, be sure to do either the red blood cell test or the ionized magnesium test. However, do not test for serum magnesium levels. Serum magnesium concentrations are so tightly controlled that the results are invariably normal, so the test has been removed from the standard blood test suite. ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE SUMMARY Collectively this case history and biochemical rationale indicate that very high doses of niacin, GABA, and vitamin C together may greatly speed detox and reduce withdrawal symptoms from alprazolam. Additional therapeutic trials are warranted. It is emphasized that every person is different and that this experience may not be applicable to all. Alprazolam is a seriously addictive drug and withdrawal symptoms may be severe. Every individual should work closely with their healthcare provider. (Dr. Todd Penberthy is a research consultant, medical writer and niacin researcher. A list of his recent papers is posted at http://www.cmescribe.com/resume/ Andrew W. Saul, OMNS Editor, is the general editor of the comprehensive textbook, The Orthomolecular Treatment of Chronic Disease, to be published in late June, 2014. http://www.doctoryourself.com/treatmentreviews.htm l) REFERENCES: 1. http://nationalpaincentre.mcmaster.ca/opioid/cgop_b_ap p_b06.html 2. http://pharmacy.oregonstate.edu/drug_policy/sites/defau lt/files/ROAD/ Modules/Benzodiazepines/BenzodiazepinesSlideSet.pdf 3. Lapin IP. (1981) Nicotinamide, inosine and hypoxanthine, putative endogenous ligands of the benzodiazepine receptor, opposite to diazepam are much more effective against kynurenine-induced seizures than against pentylenetetrazol-induced seizures. Pharmacology Biochemistry and Behavior, 14(5): 589-593. 4. Möhler H, Polc P, Cumin R, Pieri L, Kettler R. (1979) Nicotinamide is a brain constituent with benzodiazepinelike actions. Nature, 278(5704):563-5. 5. Tallman JF, Paul SM, Skolnick P, and Gallager DW. (1980) Receptors for the age of anxiety: pharmacology of the benzodiazepines. Science, 207(4428): 274-281. 6. Riond J, Mattei MG, Kaghad M, et al. (1991) Molecular cloning and chromosomal localization of a human peripheral-type benzodiazepine receptor. Eur J Biochem. 195(2):305-311. 7. Belelli D and Lambert JJ. (2005) Neurosteroids: endogenous regulators of the GABA(A) receptor. Nat Rev Neurosci, 6(7): 565-575. 8. Prousky JE. (2004) Niacinamide's Potent role in alleviating anxiety with its benzodiazepine-like properties: a case report. J Orthomol Med, 19(2): 104-110. 9. Prousky J and Seely D. (2005) The treatment of migraines and tension-type headaches with intravenous and oral niacin (nicotinic acid): systematic review of the literature. Nutr J, 4:3. 10. Bronson PJ. (2011) A Biochemists Experience with GABA. J Orthomolecular Med, 26:11-14. 11. Levy TE (2009) Curing the Incurable: Vitamin C, Infectious Diseases, and Toxins, 3rd Edition, Livon Books, ISBN: 978-0977952021 12. Cathcart, Robert F. III. (1981) The method of determining proper doses of vitamin C for the treatment of disease by titrating to bowel tolerance. Journal of Orthomolecular Psychiatry. 10:125-132. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 111 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO-DZ Dr Fatima El Zahra AMIA Pharmacien hospitalier EPH de Koléa [email protected] Tel professionnel : 0557.97.99.82 Hypercalcémie médicamenteuse Plan ; 1. Rappel et généralités sur : La physiologie. La régulation de l‟équilibre phosphocalcique. Physiopathologie. 2. Hypercalcémie. 3. Hypercalcémie médicamenteuse : Médicaments incriminés et mécanisme. 4. Prise en charge de l‟hypercalcémie. Résumé : -Plusieurs mécanismes sont impliqués ; selon les causes, soit par une augmentation de l‟absorption intestinale du calcium ou par ingestion ou par une présence augmentée de la vitamine D ou une augmentation de la résorption osseuse ; ou par une diminution de l‟élimination urinaire de calcium. -Ces différents mécanismes sont sous l‟action de l‟hormone parathyroïdienne : de ce fait les concentrations plasmatiques de calcium influencent la production de l‟hormone parathyroïdienne. -Le métabolisme du calcium est étroitement lié à celui du phosphore, on note des signes cliniques avec une hypercalcémie au delà de 3 mmol/l, types ; soif, polyurie, anorexie, en allant jusqu‟aux arythmies cardiaques, coma et mort…. -Des facteurs de survenue sont multiples ; on cible essentiellement les hypercalcémies médicamenteuses ; plusieurs médicaments sont incriminés, ainsi l‟hyperthyroïdie et les cancers représentent plus de 90% des cas d‟hypercalcémie, d‟autres causes sont ; l‟hypercalcémie familiale bénigne, ….etc. -Des mesures à prendre ne doivent pas être négligées. -A la fin des modalités de prise en charge de l‟hypercalcémie sont recommandées. Summary : Hypercalcemia can be defined by the excessive concentration of calcium in the blood is the result of an influx of calcium in the blood than to its elimination in the urine or its incorporation into bone. Several mechanisms are involved, depending on the causes or by increasing intestinal calcium absorption, or by ingestion by an increased presence of the vitamin D or an increase of bone resorption or by a decrease in urinary calcium excretion. These various mechanisms are under the action of parathyroid hormone, thus the plasma calcium concentrations influence the production of parathyroid hormone. Calcium metabolism is closely linked to that of phosphorus. Clinical signs there with hypercalcemia beyond 3 mmol / l kinds; thirst, polyuria, anorexia going to the cardiac arrhythmias, coma and subsequently died. Factors occurred are manifold are targeted primarily: hypercalcemia Drug, several drugs are criminalized. Other causes such note, hyperthyroidism and cancer account for over 90 % of cases of hypercalcemia, familial benign hypercalcemia ...... etc. Measures to be taken before any hypercalcemia should not be neglected. At the end, the modalities of management of hypercalcemia are recommended. -On peut définir l‟hypercalcémie par la concentration excessive de calcium dans le sang ; c‟est la résultante d‟une entrée du calcium dans le sang supérieur à son élimination dans les urines ou à son intégration dans l‟os. 112 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Mots clés: Français Hypercalcémie Allemand Hyperkalzamie Anglais Hypercalcemia Arabe ارتفاع نسبة الكالسيوم فرط/ في الدم Tamazigh Calcium atas ag dhamane الكالسيوم في الدم Hyperthyroidie Hyperthyreose Hyperthyroidism فرط نشاط الغدة الدرقية Anorexie Anorexie- Magersucht Anorexia – loss of appetite Osteolysis فقدان الشهية Ostéolyse Osteolyse Ostéoporose Calculs urinaires Osteoporoseknochenschwund. Harnsteine Osteoporosis ىشاشة العظام Polyurie Polyurie Vesical Calculs, stone in the bladder. Polyuria Résorption osseuse Métabolisme phosphocalcique Knochenresorption Bony resorption Mineralstoffwechsel Calcium and phosphorus metabolism Hormone parathyroidienne Parathyroid hormone. تحلل العظام حصى كلوية/ حصى 1. Rappel et Généralités : Physiologie : Le calcium est présent dans l‟organisme sous différentes formes : Calcium libre ionisé (55%). Calcium lié à l‟albumine (40%). Calcium lié à des anions (5%). 99% du calcium est présent dans l‟os Les valeurs normales ; 2.20-2.60 mmol/l. Yelka Felmakla Ighasane Yefthothase Ahthothane Ighasane Agarage Tigasalt. كثرة التبول Amane Tasa atas ارتشاف العظام Arkane Ighasane عملية ايض للفوسفور Parathyroid hormones Thaghvalt Ath Khadam atas و الكالسيوم ىرمون الغدة ما فوق الدرقية Yetvedil phosphore ok calcium Hormone Parathaghvalt Trois types d‟hormones sont impliquées dans la régulation ; 1°Parathormone : Action via AMP cyclique en augmentant la concentration du calcium et en diminuant la concentration du phosphore [] 2° Calcitriol : dérivé de la vitamine D, 1,25 (OH)2 Vit D3 : ↗ [Ca ++] ; ↘ [P]. 3°Calcitonine : secrétée par les cellules C de la thyroïde Régulation de l’équilibre phosphocalcique : ayant une action inhibitrice par diminution de la Le métabolisme du calcium est étroitement lié à celui du concentration des 2 ions ; calcium et phosphore. phosphore ; on parle du métabolisme phosphocalcique. [Ca++] ↘↘ → ↗ de la parathormone → excrétion rénale Lorsque les concentrations plasmatiques de l‟un du calcium + ↗ de la mobilisation du calcium à partir de diminuent celles de l‟autre augmentent et inversement. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 113 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE squelette et tissus mous→ ↗ de la synthèse du Calcitriol b. Clinique : d‟où l‟absorption intestinale du calcium. Signes neurologiques : NB : l‟hormone parathyroïdienne agit sur trois mécanismes Troubles de sommeil et de la concentration. pour maintenir une calcémie alentour de 2.5 mmol. De ce fait les concentrations plasmatiques du calcium influencent Céphalées. la production de l‟hormone parathyroïdienne. Confusion. Physiopathologie : Dépression. Rôle du calcium dans : Coma. Signes cardiovasculaires : Le métabolisme phosphocalcique. L‟excitabilité neuromusculaire. Diminution de l‟espace QT. La fonction cardiaque. Bradycardie. La contraction des muscles lisses. Arythmie. La coagulation. HTA en cas de situation chronique. Les réactions enzymatiques. 2. Hypercalcémie : Polyurie- polydipsie. a. Biologie : Lithiase rénale. Atteintes rénales : [Ca++] > 2.60 mmol/l IRA ou IRC. Il faut toujours rechercher une fausse Néphrocalcinone. hypercalcémie par ↗ de la fixation aux Hypercalcémie chronique à l‟ origine d‟une néphropathie protéines plasmatiques (Albumine, interstitielle et des calculs urinaires calciques avec un globuline). dépôt de calcium qui se forme dans les vaisseaux L‟interprétation des résultats de calcémie sanguins et les reins d‟où l‟insuffisance rénale. et en fonction de l‟albuminémie et la Signes gastro-intestinaux : protidémie. Constipation-Diarrhée. Devant une hypercalcémie, on effectue ; Nausées-Vomissements. Un bilan étiologique ; PTH, Ulcères digestifs. FNS, Vs, R osseuse. Pancréatites. Un bilan de retentissement ; ECG, bilan de déshydratation. 114 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ Autres signes : Prurit. Douleurs osseuses. Calcification. ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE L’hypercalcémie médicamenteuse : Le tableau ci-dessous regroupe les médicaments incriminés dans l‟hypercalcémie Médicaments Mécanisme -Tériparatide. -Hormone parathyroïdienne recombinante. Augmentent le taux d‟hormone parathyroïdienne. -Lithium (stabilisateur de l‟humeur). -Vitamine D et ses dérivés : Calcipotriol, Calcitriol, Tacalcitol. -Calcium. Augmentent l‟absorption intestinale du calcium. -Anti-acides à base de carbonate de calcium. -Une résine échangeuse d‟ions. -Polystyrène sulfonate de calcium. -Chélateurs du phosphore ; Lanthane (carbonate), Acétate de calcium. -Vitamine A et rétinoïdes. Diminuent la phosphatémie. - Augmentent la résorption osseuse. -Bronchodilatateurs ; théophylline en surdose. -Diurétiques thiazidiques. -Testostérone et autres androgènes. -Anti-cancéreux ; Estramustine. -Capécitabine ; Agoniste et antagoniste de la Diminuent l‟élimination urinaire de calcium. gonadoréline en cas de métastase. -Diéthylstilbestrol ; Tamoxifène ; Torémifène, etc. De ce fait ; des mesures à prendre avant de choisir un l’excrétion urinaire et inhiber la résorption osseuse, médicament qui expose aux hypercalcémies ; on doit pour cela ; on dispose les moyens suivants : examiner avec le patient ses antécédents et l‟ensemble Moyens : des traitements à la recherche d‟autres facteurs qui Moyens médicaux : exposent aux hypercalcémies. La réhydratation ; Sérum salé isotonique. Prise en charge de l‟hypercalcémie : Les antagonistes de la vitamine D/ Prédnisone. Traitement : Les diurétiques de l‟anse/ Furosémide. Objectif : le but du traitement consiste surtout à La Calcitonine. diminuer l’absorption intestinale, d’augmenter Les Biphosphonates : ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 115 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE o ZOLEDRONATE : ZOMETA. administrée par perfusion intraveineuse o PAMIDRONATE : AREDIA. unique d‟au moins 15 minutes. o ETIDRONATE : DIDRONEL. o Les patients doivent être correctement Chimiothérapie. hydratés avant et après l‟administration de Moyens substitutifs : ZOMETA. -Dialyse si insuffisance rénale aigue. o Clodronate (CLASTOBAN) : 4-6mg/Kg en perfusion de sérum salé isotonique en 3- Moyens chirurgicaux ; 6h. -Parathyroïdectomie. Indications : Devant une hypercalcémie++<3.5 mmol/l (<140mg/l) : Les indications thérapeutiques dépendent essentiellement on adopte un autre schéma du taux de la calcémie et de la gravité des signes Prédnisone : 10-30mg/j : efficace en quelques jours. cliniques ; Devant une hypercalcémie++> 3.5 mmol/l (140mg/l) ; Phosphate en PO. on suit le schéma suivant Réhydratation. Sérum salé isotonique ; 1 à 2 L en une heure. Le traitement chirurgical : la Parathyroïdectomie ; pour Furosémide : 20 -80 mg toutes les 2 h en IV. chaque patient avec adénome non jugulé par le traitement Cela permet : médical. Une baisse de la calcémie en 2 à 3h. Bibliographie : Une normalisation de la calcémie dans -Biochimie clinique (Pharma- Memo) ; V.HADDAD, les 12h à 24h. R.MAS. Calcitonine : 5 à 10 UI/Kg/J en perfusion dans -Le milieu intérieur en pratique clinique : Philippe Anstuz, le sérum salé isotonique : efficace en 2 à 3h. Christophe Vinsonneau, Vincent DAS, Hafid AIT Biphosphonates : OUFELLA. o o Pamidronate : AREDIA ; 90mg, 6 -Guide des interactions médicamenteuses 2013 ampoules/1 litre de soluté isotonique en (Prescrire). 24h. -www.memobio.fr Acide zoledronique : ZOMETA diluée -L’équipe de traduction: je tiens à remercier ; dans 100ml de solution stérile de chlorure *Dr AMIA M.A, M° VAN OOYEN F., AMIA S.H. de sodium à 0.9% ou de glucose à 5% et *M° SEFSAFA M.R, et la famille HABBOUCHE pour la traduction en Tamazight. 116 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO-DZ La prise en charge nutritionnelle des Stéatopathies hépatiques non alcoolique (métaboliques) caractérisées par une surcharge graisseuse hépatique dont le spectre va de la stéatose à la stéatohépatite, la cirrhose et le carcinome hépatocellulaire. Elles sont également désignées par le terme de «foie gras non alcoolique» (Non AlcoholicFattyLiverDisease, NAFLD), soulignant ainsi les similitudes histologiques que partage cette pathologie avec les maladies alcooliques du foie. La prise en charge diététique et la pratique d’une activité physique régulière sont à la base du traitement des stéatopathies métaboliques. L’objectif habituellement fixé est une perte pondérale de 10%. L’amaigrissement a un effet bénéfique sur l’insulinorésistance et le diabète, diminue le risque cardiovasculaire, et améliore les lésions histologiques hépatiques. Mots clés : Les stéatopathies hépatiques non alcoolique, syndrome métabolique, surcharge graisseuse hépatique, stéatose, stéatohépatite, prise en charge diététique, perte pondérale. Abstract Dr Lotfi RAHAL Laboratoire de physiologie cliniqueExplorations fonctionnelles métabolique Et Nutrition CHU Frantz-Fanon, Blida [email protected] Résumé Lesstéatopathies hépatiques non alcoolique ou stéatopathies métaboliques, regroupent l’ensemble des manifestations hépatiques associées au syndrome métabolique et à l’insulinorésistance. Elles sont Nonalcoholic fatty liver diseaseNAFLD or metabolic liver steatopathies, includes all of hepatic events associated with metabolic syndrome and insulin resistance. They are characterized by hepatic fat overload whose spectrum ranges from steatosis to steatohepatitis, cirrhosis and hepatocellular carcinoma. They are also designated by the term " non- alcoholic fatty liver disease, NAFLD ‘’, highlighting the histological similarities shared by this disease with alcoholic liver disease. The dietetic management and practice of regular physical activity are the mainstay of treatment of metabolic steatopathies . The goal is usually set a weight loss of 10 %. The weight loss has a beneficial effect on insulin resistance and diabetes, reduces cardiovascular risk and improves liver histological lesions. Keywords:Nonalcoholic fatty liver diseaseNAFLD, metabolic syndrome, hepatic fat overload, steatosis, steatohepatitis, dietetic management, regular physical activity, weight loss. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 117 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Introduction: Avec la prévalence croissante du diabète de type 2, de l‟obésité et du syndromemétabolique, de plus en plus de patients présentent une stéatose hépatique non alcoolique (ou NAFLD), qui est un spectreétendu de maladies .Alors que certains patients sont atteintsde stéatose simple non évolutive, d‟autres évolueront vers la stéatohépatite nonalcoolique (ou NASH), la cirrhose ou le carcinomehépatocellulaire.Pour cette raison, il est recommandé que les patients atteints de stéatosehépatique non alcoolique ou de stéatohépatite non alcoolique se soumettentà des contrôles annuels avec détermination des valeurs hépatiqueset dépistage d‟autres manifestations du syndrome métabolique. 1. Définition : Il existe deux formes de stéatopathies hépatiques nonalcooliques: la stéatose hépatique non alcoolique (NAFLD), caractériséepar une stéatose pure du tissu hépatique (dégénérescencegraisseuse de >5% des hépatocytes), sansinflammation ni fibrose. En cas de stéatohépatite nonalcoolique (NASH), la stéatose s‟accompagne d‟une inflammationdu tissu hépatique, avec ou sans fibrose. Seul un examenhistologique permet de faire la distinction entreune NAFLD et une NASH. Par ailleurs, la distinctionentre la NASH et la stéatohépatite alcoolique est uniquement possible par la réalisation d‟uneanamnèse ciblée, car les deux affections sont identiquessur le plan histologique. Ainsi, il existe une NAFLD/NASH par définition lorsque l‟anamnèse n‟a pas mis enévidence de consommation d‟alcool ou uniquement uneconsommation quotidienne limitée (<20 g/j chez lesfemmes et <30 g/j chez les hommes). 118 De nombreuses autres conditions sont responsables du même spectre lésionnel, comme les troubles du métabolisme lipidique (abétalipoprotéinémies, Syndrome de Weber-Christian), ou les déficits enzymatiques congénitaux (glycogénoses), les nutritions parentérales exclusives, la prise de certains médicaments (amiodarone, tamoxifène, diltiazem…) et l‟exposition a certain solvants industrielles. La NAFLD et la NASH peuvent aussi survenir concomitammentà d‟autres hépatopathies chroniques, dansquel cas une différenciation biochimique et histologiqueest possible. 2. Physiopathologie : La physiopathologie de stéatopathies hépatiques non alcoolique est complexe et multifactorielle. A l‟état normal le tissu adipeux est sensible à l‟action de l‟insuline, qui se fixe à son récepteur localisé sur la membrane adipocytaire et assure le stockage des acides gras et l‟inhibition de la lipolyse.Le tissu adipeux a un rôle endocrine majeur via la sécrétion de nombreuses adipokines comme l‟adiponectine, la leptine et la visfatine. L‟adiponectine a un effet anti inflammatoire en inhibant la production de tumornecrosis factor α (TNFα), cette adipokine est retrouvé diminue chez les patients présentant une simple stéatose hépatocytaire ou une stéatohépatite, ce qui suggère que la diminution de l‟adiponectine pourrait jouer un rôle pro-inflammatoire. Les lipides cytoplasmiques hépatocytaire et notamment les triglycérides constituant la stéatose provient de l‟afflux élevé d‟acides gras libres, lié àl‟apport alimentaire important, à la libération accrue àpartir des tissus adipeux viscérale et à la lipogenèse hépatocytaire de novo renforcée.Les troubles de l‟oxydation des acides gras oude la synthèse des lipoprotéines de très basse densité VLDL, jouent un rôle de moindre importance. ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Chez le sujet obèse, le flux d‟acides gras parvenant au foieest augmenté, en raison de l‟augmentation de masse de tissuadipeux mais également du fait d‟une diminution de l‟effetantilipolytique de l‟insuline. L‟exportation de ces acides gras sous forme de VLDL est également diminuée. L‟apo B-100 est moins synthétisée du fait de l‟action conjuguée del‟insulinorésistance et du TNF-α dont la sécrétion par le tissuadipeux est augmentée. Un excès de synthèse de novo detriglycérides hépatiques peut également expliquer la stéatose(lipogenèse de novo). L‟acétyl-CoA permettant cette synthèseprovient dans ce cas soit de l‟alcool, soit des glucides. Cettevoie reste sensible à l‟insuline.L‟hyperinsulinémie favorise donc cette transformation. La dégradation des acides gras par le foie est également altérée.La diminution de la bêta-oxydation des acides gras est aussiexpliquée par l‟insulinorésistance.Le second temps correspond à l‟apparition d‟une inflammation et d‟une nécrose hépatocytaire suite à la peroxydation lipidique et au stress oxydant qui résulte d‟un déséquilibre entre molécules pro et antioxydants, conduisant à des lésions cellulaires par le biais de plusieurs mécanismes : création de lésions de l‟acide désoxyribonucléique ADN, diminution du stock d‟ATP, altération membranaires et relargage de cytokines pro inflammatoires (Fig.1), ainsi par les cytokines d‟origine adipeuseou intra hépatique, notamment le TNF-α. Les acides gras libres ont un effet toxique sur les cellules carils peuvent être peroxydes. Il en résulte des altérations membranaireset la production de métabolites réactifs, comme lemalondialdehyde (MDA), ou le 4-hydroxynonenal (HNE), responsablesd‟altération du métabolisme cellulaire.Enfin, le fer, pro-oxydant, pourrait jouer un rôle importantdans ce processus. Une augmentation des dépôts hépatiques defer a été constatée au cours de la SHNA. Par son actionpro-oxydante, le fer en excès dans le foie stéatosique majore lestress oxydant et la peroxydation des acides gras polyinsaturésà longue chaîne (AGPLC). Figure 1. Implication du stress oxydant et des principaux facteurs impliqués dans lřévolution de la stéatose vers la stéatohépatite non alcoolique. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 119 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 3. Présentation clinique et diagnostic : - Athérosclérose, complications cardiovasculaires La SHNA est, le plus souvent, asymptomatique et découverte fortuitement lord d‟un bilan échographique ou lors d‟un bilanbiologique effectué à titre systématique ou en raison d‟une pathologie autre (bilan hépatique légèrement perturbé avec un rapport ASAT/ALAT < 1 et élévation du taux de γGT <5N). Le bilan biologique initial doit comprendre, outre la biologie hépatique standard : Une douleur au quadrant supérieur droit, une fatigue, une hépatomégalie ou lesstigmates du syndrome métabolique, dont le tour de taille augmenté, peuvent compléter le tableau clinique.Le clinicien doit d‟abord éliminer les causes toximédicamenteuses, virales,auto-immunes et génétiques pouvant être à l‟origine de la perturbation du bilan hépatique.Le diagnostic doit être suspecté chez un patient à risque, après une période desix mois d‟abstinence d‟alcool. Le diagnostic repose sur la mise en évidence d‟un syndrome métabolique : -Surpoids (poids corporel, calcul de l‟index de massecorporel [poids kg/taille m2] > 25 kg/m2). - Obésité androïde (tour de taille > 102 cm chez l‟homme ;88 cm chez la femme). - Diabète connu. - Hypertension artérielle (pression artérielle > 130/85 mmHg). - Glycémie à jeun > 6,1 mmol/L, insulinémie à jeun, index deHOMA. - Triglycérides > 1,7 mmol/L ; HDL cholestérol < 1 mmol/L (hommes) ; 1,3 mmol/L(femmes). - Antécédents familiaux de diabète, de surpoids, decomplications cardiovasculaires. 120 - un hémogramme : une thrombopénie fait évoquer une cirrhose constituée, - les sérologies d‟hépatite B et C, - la mesure de la transferrine désialylée en cas de doute avec une maladie alcoolique, - la mesure du coefficient de saturation de la transferrine et de la ferritine. Une hyperferritinémie secondaire est fréquente, définissant l‟hépatosidérose métabolique. Seul un coefficient de saturation >45% doit faire rechercher une mutation du gène HFE. L‟échographie abdominale est un excellent moyen de dépistage. Elle montre un foie hyperéchogène par rapport au parenchyme rénal droit. Sa sensibilité dépend de l‟intensité de la stéatose : 80% pour une stéatose > 30% des hépatocytes, elle décroît à 55% pour une stéatose < 20%. Elle recherche des signes de cirrhose constituée : dysmorphie hépatique, hypertension portale. La TDM et l‟IRM peuvent égalementpermettre de mettre en évidence une stéatose>20%, mais ces examens ne permettent pas de faire ladistinction entre une NAFLD et une NASH ni de déterminerle stade de la fibrose. La ponction biopsie hépatique reste un examen essentiel à la prise en charge des stéatopathies métaboliques, tant pour établir de façon formelle le diagnostic étiologique. Trois critèreshistologiques de la stéatohépatite : la stéatose, l‟inflammation lobulaire polymorphe et la ballonnisation hépatocytaire. ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 4. Prise en charge thérapeutique : L‟objectif du traitement est d‟obtenir la régression ou la limitation des lésions hépatiques et, de prévenir ou de faire régresser la fibrose hépatique,La prise en charge nutritionnelle et la pratique d‟une activité physique régulière sont à la base du traitement des stéatopathies métaboliques. Néanmoins aucune thérapeutique médicamenteuse ne permet à ce jour de contrôler durablement la maladie. a. Prise en charge médicamenteuse : - Les hypoglycémiants : La metformine régule la glycogénogenèse hépatique et favorise la β oxydation des acides gras au détriment de la production de triglycérides. La metformine améliore significativement les transaminases et diminue la stéatose et améliore l‟insulinosensibilité des patients présentant une NASH selon plusieurs études. Les thiazolinediones améliorent l‟insulinosensibilité par leur action agoniste sur les récepteurs PPARγ. Ils redistribuent la graisse hépatique et musculaire vers le tissu adipeux périphérique et augmentent le taux d adiponectine circulante. - Les antioxydants : la vitamine E et la vitamine C ont un effet inhibiteur du stress oxydant et sont utilisés dans le traitement de la NASH. la combinaison de ces deux vitamines permet l‟amélioration de la fibrose hépatique et les transaminases. L‟administration de la vitamine E (L‟α-tocophérol) a la dose de 300 à 400 mg /jr et de la vitamine C a la dose de 3 à 4 g par jour pendant six mois permet une amélioration significative des lésions de la SNHA. La L-carnithine a aussi une action sur le stress oxydatif, ainsi que sur le métabolisme du glucose et des lipides, elle permet la diminution de l‟insulinorésistance et des taux du C ractiveProtein CRP. b. Prise en charge nutritionnelle : le but de cette prise en charge est la réduction pondérale. Le principe estd‟obtenir un bilan énergétique négatif en diminuant les apportsalimentaires et/ou en augmentant les dépenses énergétiques sur une durée varie selon l‟importance du déficit énergétique proposé. Une perte de poids de 5 à 10% peut être envisagée en six mois.Un kilogramme de tissu adipeux représentant environ 7880 kcal, ilfaut donc créer un déficit de 500 kcal/j pour diminuer le poidsde 2 kg/mois.La courbe de poids finit par décrire un plateau, car la dépensecalorique diminue au fur et à mesure de l‟amaigrissement.Durant la phase de stabilisation pondérale, le bilanénergétique est par définition, équilibré (entrées = sorties). Paradoxalement,cette étape est beaucoup plus difficile à gérer quela précédente, car le patient est déçu de ne plus maigrir, malgréla poursuite de la restriction. C‟est le niveau du déficit énergétique qui conditionne l‟ampleur de la perte de poids et non la répartition en macronutriments.Néanmoins, le type de régime et les conseils donnésinfluencent l‟adhésion initiale et l‟observance à long terme et lacomposition de l‟alimentation pourrait jouer un rôle direct surla SHNA. Les régimes sévères à basses calories (moins de 1000 kcal/jour) sont à proscrire, car l‟amaigrissement brutal peut entraîner une aggravation des lésions histologiques. Le seuil de perte de poids à ne pas dépasser serait d‟environ 1 kg par semaine. Une augmentationde l‟inflammation et de la fibrose a, en effet, été constatéelorsque la perte de poids excède 230 g par jour. Les régimes peu restrictifs personnalisés semblent les plus adaptés chez les sujets présentant une SHNA. Par rapport auxrégimes plus sévères, l‟observance est meilleure et les résultatssont comparables àmoyen terme. Ils sont prescrits pour quelquesmois (trois à six mois). La réduction des apports lipidiques et des graisses saturéesdoit apparaître comme la priorité, ainsi que ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 121 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE la réduction dela consommation de glucides à haut index glycémique (boissonssucrées, glucides complexes hautement raffinés. . .) et laconsommation d‟alcool. - Conseils nutritionnels pour la perte de poids etpour la stéato-hépatite non alcoolique : Eviter la consommation de lipides et, notamment, degraisses saturées (graisses animales) : graisses, beurre, lait entier, fromages à plus de 20 % de matière grasse. fritures, sauces, mayonnaise, mouton gras, agneau gras… Privilégier les aliments riches en acides gras monoinsaturés et oméga-3 : Huile d‟olive, huile de colza, huile de grain de lin et les poissons comme : Saumon, maquereau, hareng, sardines, thon… Eviter les aliments a index glycémique élevée : Pain à la farine blanche, gâteaux, confiture, sucre, miel, bonbons, chocolat, glaces… privilégier les glucides à faible index glycémique : glucidescomplexes (amidons) sous forme brute plutôt que raffinée(céréales complètes, légumineuses). Eviter la consommation de fructose et de saccharose :limiter les sucres simples et les boissons sucrées : boissons gazeuses, yogourts aromatisés, céréales à déjeuner, fruits en conserve, ketchup, confitures et gelées de fruits… privilégier la consommation de légumes et de fruits, sourcesde micronutriments (antioxydants) ; Arrêter la consommation d‟alcool. Manger à l‟occasion des repas en prenant conscience dessignaux physiologiques de régulation : faim, rassasiement,satiété ; Manger peu salé Préparer les aliments à l‟eau, au four ou au grill Prendre le temps de manger 122 o structurer les prises alimentaires en repas et en collations enfonction des nécessités du mode de vie du sujet (en général,trois repas principaux et une collation éventuelle) ; ne passauter de repas pour éviter les grignotages extraprandiauxcomportant des aliments souvent gras et sucrés. En plus de la prise en charge nutritionnelle, desmesures paraissent essentielles : - pratiquer une activité physique quotidienne suffisante; l‟exercice physique permet d‟améliorer la sensibilité à l‟insuline. Une activité physique régulière (30 minutes par jour à 60–70%de leur fréquence cardiaque maximale) permet d‟améliorer de façon significative le taux de transaminases de patients atteints de SHNA. L‟association à un régime peu restrictif peut permettre une normalisation du bilan biologique hépatique. - se peser régulièrement (d‟une fois par semaine à une fois par mois). - ne pas avoir soif, boire à volonté de préférence entre les repas. Veiller a assuré une diurèse minimale de 1,5 l par jour. Conclusion : La stéatopathie non alcoolique (SHNA) est une affection de plus en plus fréquente car liée au syndrome d‟insulinorésistance dont la prévalence augmenterapidement. Cependant, le diagnostic impose une démarche rigoureuse et l‟exclusion des autres causes d‟hépatopathies chroniques. Le pronostic de la stéatose pure est excellent. A l‟inverse, la stéatohépatite non alcoolique expose au risque d‟évolution vers la cirrhose et le carcinome hépatocellulaire. La prise en charge est essentiellement nutritionnelle et diététique avec la pratique d‟une activité physique régulière. Aucun traitement médicamenteux n‟a prouvé son utilité dans cette pathologie. La prise en charge est multidisciplinaire pour prévenir la surmortalité hépatique mais aussi cardiovasculaire et par cancer. ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Mots clés : Les stéatopathies hépatiques non alcoolique, syndrome métabolique, insulinorésistance, obésité, stéatose hépatique, stéatohépatite, stress oxydatif, ponction biopsie hépatique, critères histologiques, prise en charge nutritionnelle, antioxydants, activité physique. Keywords:Non-alcoholic liver steatopathies, metabolic syndrome, insulin resistance, obesity, hepatic steatosis, steatohepatitis, oxidative stress,liver biopsy, histological criteria, nutritional care, antioxidants, physical activity. Keywords: Nicht-alkoholische Leber stéatopathies, MetabolischesSyndrom, Insulinresistenz, Fettsucht, Fettleber, Fettleberhepatitis, oxidativer Stress,Leberbiopsie,histologischeKriterien, Ernährungsversorgung, Antioxidantien, körperlicheAktivität. Bibliographie: 1. Bugianesi E, Leone N, Vanni E, Marchesini G, Brunello F, Carucci P, Musso A, DePaolis P, Capussotti L, Salizzoni M, Rizzetto M. Expanding the natural history ofnonalcoholic steatohepatitis: from cryptogenic cirrhosis to hepatocellular carcinoma.Gastroenterology 2002;123:134-40. Ratziu V, Bonyhay L, Charlotte F, Poynard T. Stéatohépatite non alcoolique. Aspects cliniques. Hépato-Gastro 2002;9 :191-8. Paredes AH, Torres DM, Harrison SA. Non alcoolicFattyliverdiseases. Clin LiverDis. 2012 May;16(2):397-419. Fargion S, Mattioli M, Fracanzani ALet al. Hyperferritinemia, iron overload,and multiple metabolic alterationsidentify patients at risk for nonalcoholicsteatohepatitis. AmJ Gastroenterol2001;96:2448-55. Angulo P. Nonalcoholic fatty liverdisease. N Engl J Med 2002; 346:1221-31. Cortez-Pinto H, Jesus L, Barros H,Lopes C, Moura MC, Camilo ME. Howdifferent is the dietary pattern in nonalcoholicsteatohepatitis patients? ClinNutr 2006. Andersen T, Gluud C, Franzmann MB,Christoffersen P. Hepatic effects ofdietary weight loss in morbidly obesesubjects. J Hepatol 1991;12:2249. Capanni M, Calella F, Biagini MR et al.Prolonged n3 polyunsaturated fattyacid supplementation ameliorateshepatic steatosis in patients with nonalcoholicfatty liver disease: a pilotstudy. Aliment PharmacolTher2006;23:1143-51. Luyckx FH, Desaive C, ThiryA et al.Liver abnormalities in severely obesesubjects: effect of drastic weight lossafter gastroplasty. Int J ObesRelatMetabDisord 1998;22:222-6. Hasegawa T, Yoneda M, Nakamura K,Makino I, Terano A. Plasma transforminggrowth factorbeta1 leveland efficacy of alpha-tocopherol inpatients with non-alcoholic steatohepatitis:a pilot study. AlimentPharmacolTher 2001;15:166772. Sreenivasa Baba C, Alexander G, Kalyani B, et al. Effect of exercise anddietary modification on serum aminotransferase levels in patients with non-alcoholicsteatohepatitis. J GastroenterolHepatol 2006;21:191–8. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 123 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO-DZ Hygiène de vie d’une gastrectomie Mohamed Rachad BOUMOKOHLA Diététicien de santé publique Etablissement Hospitalier Spécialisé en Cancérologie “Pierre & Marie Curie” Alger 16000 [email protected] Résumé La gastrectomie est réalisée au cours des traitements des cancers de l'estomac. Sachant que ce dernier n'est pas un organe noble l'ablation totale ou partielle a plus d'avantage que d'inconvénient surtout à un stade avancé de la maladie. Sans omettre les conséquences physiologiques, les troubles fonctionnelles et l'altération de l'absorption de certains oligo-éléments et vitamines. De ce fait, il est important d'adopter un schéma nutritionnel spécifique, pour atténuer certain troubles fonctionnelle. 124 La supplémentation en vitamine B6,B9,B12 est indispensable, en proposant des règles hygiénodiététiques que le malade doit suivre et respecter. Abstract Gastrectomy is performed in the treatment of cancers of the stomach. Knowing that he is not a noble organ total or partial ablation has more advantage than disadvantage especially at an advanced stage of the disease. Not to mention the physiological consequences, functional disorders and impaired absorption of certain trace elements and vitamins. Therefore, it is important to adopt a specific nutritional regimen to mitigate some functional disorders. The vitamin B6, B9, B12 is essential, offering diet and lifestyle rules that the patient must follow and respect. ملخص مع العلم انه.يتم إجراء استئصال املعدة يف عالج سرطانات املعدة ليس جهاز نبيل االستئصال الكلي أو اجلزئي لديه ميزة أكثر من ناهيك عن العواقب.العيب وخصوصا يف مرحلة متقدمة من املرض واضطرابات وظيفية واالستيعاب وضعف يف العناصر،الفسيولوجية وبالتايل فمن املهم أن اعتماد نظام التغذية حمدد لتخفيف،الضروريه الفيثاميناث وتقدميB12 ،B9 ، B6بعض االضطرابات الوظيفية .النظام الغذائي ومنط احلياة حبكم أن املريض جيب أن يتبع وحيرتم Mots clés: gastrectomie, cancer, brassage, parentérale, entérale, dyspepsie, dumping syndrome, absorption, carence, facteur intrinsèque, alimentation. Keywords: gastrectomy, cancer, brewing, parenteral, enteral, dyspepsia, dumping syndrome, absorption, lack,intrinsic factor,food. ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE الكلمات الرئيسية , عدم وجود عامل جوهري، االستيعاب, املعوية، الوريدية, استئصال املعدة اإلغراق, متالزمة،عسر اهلضم,السرطان, النظام الغذائي La gastrectomie est l'ablation chirurgicale totale ou partielle de l'estomac. Elle est réalisée pour traiter les cancers, ulcère peptique(moins peptique), et les perforations de la paroi stomacale. Conséquences physiologiques de lřintervention : Diminution de la capacité gastrique ; Diminution ou perte des possibilités de brassage du bol alimentaire ; Diminution ou absence de sécrétion d‟acide chlorhydrique et de pepsine ; Suppression ou non de la fonction du pylore avec accélération du transit et de la vidange gastrique(VG) ; Altération de l‟absorption du fer, calcium et vit B12 et manque de facteurs intrinsèque ; Accélération du transit. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ Réalimentation per-op /post-op Le patient ne pourra pas s‟alimenter par la bouche pendant plusieurs jours ; Dans ce cas la nutrition parentérale, éventuellement complétée ou suivie après plusieurs jours par la nutrition entérale. La réalimentation en post-opératoire dépendra de la capacité restante de l‟estomac (volume) et des troubles fonctionnels liés à la perte de la régulation de la vidange gastrique. Trouble fonctionnels Dyspepsie la sensation de lourdeur oblige le patient à abandonner le repas ; Dumping Syndrome la (VG) est fortement accélérée, il s‟ensuit une arrivée massive et brutale au niveau du duodénum, accompagnée de diarrhées et douleurs abdominales dans les 30 à 60 minutes après le repas ; Hypoglycémie l'absorption intestinale rapide de glucose et une réponse insulinique excessive. Il s‟ensuit une hypoglycémie transitoire et les malaises; o Prendre les Repas peu volumineux et fractionnés ; o Eviter de boire en mangeant ; o Eviter les repas hyperosmolaires(les sucres simples). Fer et calcium L‟absorption du fer et du calcium est souvent altérée Facteurs de risque Une fatigue, des vertiges, une sensation d‟ébriété ; Des lipothymies (perte de connaissance incomplète), des bouffées de chaleur ; 125 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Une somnolence, des bourdonnements d‟oreille ; Des troubles vasomoteurs (sueurs, tachycardie, palpitation) ; Des troubles dyspeptiques (douleurs abdominales, diarrhées, vomissements). Alimentation saine et équilibrée Choisir une alimentation variée et adaptée aux besoins ; Respecter les heures de repas ; Avoir une bonne hygiène dentaire, et une bonne mastication des aliments ; Prendre le temps de manger ; Eviter les excès ; Arrêter le tabac. Rôle de la diététique Nourrir au mieux les patients pour éviter une dégradation de leur état nutritionnel ; Fournir le support nutritionnel le plus adéquat ; Tenir compte des tolérances personnelles. Règles à respecter Manger lentement, en mastiquant plus longtemps les aliments ; surveiller régulièrement l‟état de la dentition ; Fractionner l‟alimentation : faire 5 à 6 repas de préférence d‟égale importance (3 petits repas et 2 à 3 belles collations). Eviter de boire pendant les repas mais en dehors en plusieurs fois (6 à 8 prises) dans la journée à chaque fois la valeur d‟un demiverre d‟eau (1/2 heure avant les repas c‟est bon) ; S‟allonger après les principaux repas si nécessaire ; 126 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ Eviter les aliments trop salés, trop sucrés et trop épicés ; Eviter de manger trop chaud et trop froid ; Eviter les poissons fumés et les conserves ; Eviter les aliments à gros volume et peu énergétiques (grosse ration de crudités ou potages non enrichi) ; Eviter l‟eau gazeuse ; Eviter l‟excès de matières grasses cuites et les fritures ; Augmenter la ration de protéines (viandes, poissons et œufs) ; Vérifier la tolérance du lait (s‟il est mal toléré sa réintroduction restera possible mais plus tardive et progressive) ; Eviter le tabac ; En cas de sueurs avec faim intense 2 à 3 heures après les repas (prendre du sucre afin de calmer le malaise et du son de blé pour éviter la récidive. Le contenu des repas L‟apport systématique d‟aliments protidiques doit être une priorité à chaque repas : Sous forme de viande rouge, volaille, poisson, œuf au moins pour 2 repas. Sous forme de laitage (fromage, et autres dérivés tolérés) ; les féculents doivent être consommés à chaque repas (les féculents pour les 2 repas principaux, le pain et les fruits pour le petit déjeuner et les collations ; Les rations très limitées au début pourront être progressivement augmentées suivant la tolérance individuelle ; Les légumes verts : au moins à un repas et en petite quantité ; ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Les fruits seront consommés dans les premiers temps en collation (augmente trop le volume du bol alimentaire en fin de repas) ; Ration hydrique : 1.5 L par jour, en dehors des repas. Conseillés Déconseillés Produits laitiers Lait écrémé ou ½ Lait entier ; écrémé Crème glacée ; Laitage (yaourt : Fromages fermentés : nature ou fruité, petit Munster, Livarot ; suisse, fromage Fromage à moisissure : blanc, crème dessert Roquefort ; et entremet) ; Fromage aux épices : Fromage pâte Boursin au poivre. cuite ou pressée : Pyrénées, Gruyère,Tome, Cantal ; Fromage pâtes molle non fermentés : Camembert, Brie ; Spécialité fromagère à pâte fondue : crème de Gruyère. Viandes, Poissons, œufs, Abats Viandes maigres Viandes grasses : de bœuf, veau, mouton, oie ; cheval, lapin, Viandes en sauce ; volaille, agneau Viandes fumées ; maigre ; Plats du commerce trop Foie, langue, gras ou épicés ; cœur ; Charcuteries ; Tous les Poissons en conserve poissons, à l‟huile, au vinaigre, en coquillages et saumure ; crustacés ; Poissons frits. Tous les œufs : pochés, coque, durs, en omelette Féculents Pain blanc, Pain chaud ou top grillé ou frais ; biscottes ; Pain complet ; Pomme de terre Pomme de terre vapeur, purée ; frites, sautées, Pâtes, riz, chips ; semoule, farine, Légumes secs ; maïzena, corn Céréales complètes ; flakes et Préparations à base dérivés ; de pâtes feuilletée ; Biscuits secs ; Pâtisseries grasses Pâtisseries de avec crème ou type biscuits. beurre ; Meringues. Légumes verts Carotte, Légumes riches en courgette, fibres ou à goût fort : betteraves céleri, radis, choux, cuite, haricot poivron, navet, vert, endive ou fenouil ; salade cuites, Oignon, ail (suivant épinards ; tolérance). Crudités suivant l‟état du transit : carotte râpée, salade, tomate ; Potages : volume limité à 100ml. Fruits Fruits cuits en Fruits oléagineux : compote ou en noix, cacahuètes, sirop ; amandes… ; Fruits crus bien Fruits secs ; mûrs et Fruits crus non épluchés ; épluchables : prunes, Banane bien raisins, cerises. mûre ; Agrumes en petite quantité suivant le ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 127 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE transit. Beurre ; Crème fraiche ; Huiles : toutes. Matières grasses Fritures ; Graisse d‟oie ; Mayonnaise. Produits sucres En quantité Sorbets, glaces. modérée : sucre, gelée, confiture, chocolat, bonbons. Boissons Eau du robinet, Eaux minérales de source, gareuses et sodas ; minérale non Boissons glacées gareuse ; ou trop chaudes. Jus de fruits selon tolérance personnelle ; Café et thé léger, infusion, tisane : en petit volume. Divers Epices, Piment, curry et condiments, épices fortes. poivron selon tolérance. 128 Conclusion : la prise en charge nutritionnelle des patients, en cancérologie digestive, s'intègre dans les soins de support et doit faire partie de la prise en charge multidisciplinaire cancérologique, plus particulièrement la prise en charge péri-opératoire ,elle représente un appoint important dans les pathologies les plus graves et chez les patients dénutris, en améliorant significativement les suites opératoires. En revanche ne pas négliger les complications de la nutrition artificielle , et les carence dû a la mal absorption. Enfin de meilleurs résultats peuvent être possible par une maîtrise des techniques et de leur associations. Bibliographie Albert-François Creff(2007).Manuel de diététique en pratique médicale courante,Paris,Masson,151-158p M.-A.Piquet,X.Hébuterne(2007).Nutrition en pathologie digestive,Paris,doin éditeurs,17-38p http://www.passeportsante.net http://www.infirmiers.com Alimentation conseillée après une gastrectomie, cours étudiant en soins infirmier ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO-DZ RHODIOLA ROSEA OU LA RACINE DřOR Composition : est composée essentiellement de rosavine, salidrosive, flavonoïdes, 12 AA, 20 minéraux et multivitaminés, tanins. Elle est riche en antioxydant ce qui lui donne une action très favorable pour combattre le vieillissement, retarde l‟apparition des maladies dénégatrices et prévenir le cancer. ORIGINE : Elle pousse dans les régions Dr : Zohra SIDENNAS MASCARA : MEDECIN GENERALISTE [email protected] Classification APG III (2009) Règne Plantae Clade Angiospermes Clade Dicotylédones vraies Clade Noyau des Dicotylédones vraies Ordre Saxifragales Famille Crassulaceae Genre Rhodiola Noms communs : Rhodiola, racine doré, orpin rosé. Nom botanique:rhodiola rosa, anciennement sedum rosa. Nom anglais : golden rot, Rhodiola, astic rot, rose rot. Nom chinois : Chongjin tian. La partie utilisée : Le rhizome. Origine : Rhodiola rosa pousse dans les régions très froides les hautes montagnes. froides telles l'Arctique, les montagnes d'Asie centrale, Les Rocky Mountains, et les régions montagneuses d'Europe, telles les Alpes, les Pyrénées, et les Carpates, la Scandinavie, l'Islande, le Royaume-Uni et l'Irlande. Cette plante vivace pousse jusqu'à 2280 mètres d'altitude. Plusieurs rejets poussent de la même racine épaisse. Les rejets font entre 5 et 35 cm de haut. Rhodiola rosea est dioïque – une plante mâle et femelle séparée. Introduction : La rhodiola est une plante adaptogène qui travaille à la façon d‟un coach et s‟adapte aux besoins de l‟organisme. Elle peut être comparée à un coach de sa capacité défensive et antistress en indiquant à l‟organisme ou, quand et comment agir. Rhodiola Is an adaptogène herba That has ore lie a coach and adaptas to Evry nées of the organisme, It Can be compare to a coach of hais défensive avilit and antistress indication to the body here ;When and how to react. رىوديوال ىو عشب أدبت وغن التي عملت مثل مدرب وتتكيف مع كل احتياجات المنظمة ويمكن مقارنة مثل مدرب لو القدرة الدفاعية والمضادة لإلجهاد مما يشير إلى الجسم أين ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ومتى وكيف التصرف 129 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE français anglais arabe adaptogène adaptogène أدابتوغن رهوديول rhodiola rhodiolala اإلجهاد Anti-stress Antistress الجسن L‟organisme organisme Indication : Stimuler les fonctions cognitives en situation de stress se de la fatigue. Atténuer l‟anxiété et la dépression. Prévenir les infections et traite l‟aménorrhée, l‟infertilité, les dysfonctionnements sexuels, le rhume, la grippe, la dépression, l‟asthénie et la neurasthénie. Combattre la fatigue notamment en période de convalescence. Augmenter la résistance au stress et les performances physiques, intellectuelles et sexuelles. Historique de la rhodiola : sa réputation de la plante médicinale. On lui attribuait le pouvoir d‟accroitre l‟endurance physique, la longévité, la vigueur sexuelle, la mémoire et d‟autres facultés cognitives. Les médecins de Mongolie la prescrivent pour combattre la grippe, la tuberculose et le cancer. En Suède, on affirme que les Vikings lui devaient leur légendaire force physique et leur remarquable endurance. Les recherches sur la rhodiole. La médecine moderne a commencé à s‟intéresser à la rhodiole qu‟au début des années 1960 et il a fallu attendre 1965 pour que soient entreprises les premières études scientifiques si bien que la majorité des articles a été rédigée dans les langues slaves ou scandinaves. Ces articles ont été publiés dans les revues peu lues par les tenants de la médecine occidentale moderne, tout cela explique que la plante est peu connue en occident. 130 C‟est en Sibérie et Scandinavie que la rhodiola a gagné Pendant des siècles sa racine a été utilisée dans la médecine traditionnelle russe et scandinave. Les chercheurs et les médecins occidentaux n‟ont commencé a s‟intéresser a cette plante que dans les années 70, ce qui explique qu‟elle n‟est encore largement diffusée et peu connue du grand public. Aujourd‟hui ; la rhodiola est utilisée comme tonique et remède a la fatigue pour augmenter la vigilance et accroitre la productivité des travailleurs. Certains tribus sibériennes confectionnent des boissons chaudes a base de rhodiola rosea pour résister a la rudesse du climat et limiter la dépression engendrée par des conditions de vie difficile. Une plante adaptogène : En 1947, un éminant chercheur russe du nom Lazarev formulait le concept ( adaptogène) :Elle permet de mieux supporter le stress engendrer par un changement de situation quel qu‟il soit. - fonction cognitives en situation de stress et de fatigue : Des essais utilisant un extrait normalisé de rhodiola on été menés entre 2000 et 2003 sur des médecins surmenés ,des étudiants en période d‟examen et des jeunes hommes volontaires placés en situation de stress et de fatigue, les participants ont vu leur état s‟améliorer significativement.( concentration, bien être, réduction de la fatigue. - Anxiété et dépression : des chercheurs russes ont observé que les patients traités avec les antidépresseurs tricycliques voyaient une amélioration de leur état et soufraient moins des effets indésirables de leur médication lorsqu‟ils recevaient de la rhodiola à des doses de 170 mg ou 340mg deux fois par jour pendant 06 semaines ont réduit les symptômes chez les ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE patients soufrant de dépression légère et modérée. - performance physique : Dans la première moitie des années 2000 , les essais cliniques russes et belges avaient conclu qu‟elle améliorait l‟adaptation à l‟effort, la coordination motrice et l‟endurance . - aménorrhée et infertilité : au cours d‟une étude, les chercheurs russes ont rapporté que la rhodiola avait le pouvoir de faire réapparaitre des menstruations normales chez 25 sur 40 femmes souffrant d‟aménorrhée, les règles sont revenues au bout de 2à 8 semaines de traitement et la suite une grossesse est survenue chez 11 des femmes. - dysfonction érectile : au cours d‟un essai mené en Russie auprès de 35 hommes souffrant de dysfonction érectile ou d‟éjaculation précoce, les 26 hommes ont connu une nette amélioration de la fonction sexuelle grâce à la rhodiola. - Divers : La Rhodiola est un fortifiant musculaire : elle amplifie la résistance à l’effort. Elle a été testée avec succès chez les athlètes russes et par les cosmonautes. La Rhodiola est un cardio-protecteur et un régulateur du muscle cardiaque. Elle normalise les battements du cœur immédiatement après un effort physique intense. La Rhodiola corrige l’hypoxie (le manque d’oxygène distribué par le sang dans les tissus). Cet effet oxygénant a été attribué à l’augmentation des réserves sanguines d’oxygène ainsi qu’à un meilleur rendement des mitochondries des cellules des muscles de soutien. Stimulante de l’humeur et anti-déprime : la rosavine et la salidroside, deux principes actifs essentiels présents dans cette racine, stimulent le transport des précurseurs de la sérotonine, et augmentent sa disponibilité au niveau du cerveau. La Rhodiola s’avère, d’après ces études, un remède efficace contre la dépression saisonnière due au manque de lumière en période hivernale. La Rhodiola renforce l’activité du système immunitaire en activant la production des cellules NK (Natural Killers). La Rhodiola est un protecteur hépatique. Des travaux russes ont mis en évidence cette propriété par des tests de toxicité, faibles ou négatifs en présence d’extraits de cette plante. La Rhodiola présente des vertus anti-mutagènes. Elle favorise les mécanismes réparateurs de l’ADN. Des études sont en cours pour confirmer cette découverte. La Rhodiola est un anti-radicalaire : ses activités antioxydantes ont fait l’objet de nombreuses études et plusieurs composants, responsables de cette propriété, ont été analysés. Posologie de la rhodiole : La racine de Rhodiola s’utilise à raison de une à trois gélules, soit environ 0,3 g à 1 g., chaque matin sur 10 à 15 jours, renouvelables. Précautions : Pas d’effet secondaire connu aux dosages recommandés, mais par prudence, elle est déconseillée chez les femmes enceintes ou allaitant, ainsi que chez les enfants. Par manque de recul. CONCLUSION :Un grand nombre de psychiatres et de médecins pensent que la rhodiola rosa est l‟avenir de phytothérapie, cette plante à la fois capable de réduire le mal-être psychologique et physique sans effets secondaires est une solution a beaucoup de problèmes rencontrés aujourd‟hui dans nos sociétés moderne tels que le surmenage, le stress Bibliographie : -wikipedia -Révision scientifique par la société canadienne de recherche sur le psn, recherche et rédaction passeport santé net - Plante/santé. -rhodiola rosea par :amade j2008 liscence. -la vie naturelle ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 131 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO-DZ LřAluminium dans les emballages alimentaires et les ustensiles de cuisine, quel risque pour la santé ? TITRE : INTRODUCTION La vie moderne et l'augmentation du nombre de la population mondiale et le manque de disponibilité du consommateur ont mené aux changements des habitudes de la consommation alimentaire et ont fait croitre la demande de produits plus sûrs et plus solides sur l'étagère ce qui a aboutit au développement de nouveaux traitements physiques et l'utilisation d‟aliments mis en boîte, emballés, « prêts à manger». Depuis quelques années, un nombre croissant d'effets toxiques a été établis chez l‟homme, un contribuant possible à ces effets toxiques est l‟aluminium (Al), un métal non-essentiel largement utilisé). En effet, il est possible que la consommation excessive d‟aliments emballés avec l'Al puisse comporter un risque sanitaire en raison de sa migration [1]. GENERAMLITES SUR LřALUMINUIM AUTEUR : Nesrine SEDJELMACI, Pharmacienne spécialiste en Toxicologie, CHU Tlemcen. RESUME : La plus part des emballages alimentaires et des articles de conditionnement sont fabriqués en Aluminium, certaines études ont montré que la chaleur, l‟acidité et la composition des aliments et des emballages peuvent augmenter sa dissolution et donc sa concentration dans la nourriture entrainant des risques toxiques à long terme. MOTS-CLES : Aluminuim, Emballages alimentaires, Ustensiles de cuisine, Risque toxique. 132 L'aluminium est un élément omniprésent constituant environ 8% de la croûte terrestre. C‟est un métal léger, maniable, d‟aspect brillant et attirant, il est caractérisé par une bonne conduction thermique et électrique, une bonne résistance à la corrosion et à l‟oxydation et une réflectivité élevée. Les sources d‟exposition à l'Al incluent l'eau et les boissons contaminées, les aliments et les additifs alimentaires, les produits cosmétiques, les médicaments gastro-protecteurs, l‟eau de dialyse et l‟utilisation d‟articles de cuisine en Al. En moyenne, la prise quotidienne d‟Al chez un individu est d‟environ 20 mg par voie digestive et de 3 à 15 mg par inhalation. La prise hebdomadaire tolérable d‟Al suggérée par lřEuropean Food Safety Authority (EFSA 2010) et n‟entrainant aucun risque évident chez le consommateur adulte est de 1mg/kg [2]. ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE PROBLEMATIQUE Les données sur la concentration en Al dans les produits alimentaires sont rares, bien que les récipients en Al soient très utilisés pour faire cuire, congeler, ou envelopper des aliments. En revanche, il y a un intérêt continu portant sur la relation possible entre sa présence dans les aliments et sa toxicité particulièrement chez les enfants, les personnes âgées et les patients présentant une insuffisance rénale chronique. En effet, l‟Al a été considéré comme un agent neurotoxique (facteur de risque de la maladie d'Alzheimer) depuis 1980, il a été également associé à des maladies osseuses telles que l‟ostéomalacie [3]. Bien que des relations directes entre l'Al dans la nourriture et ces maladies n'aient pas été établies, les facteurs diététiques, physiologiques et pathologiques qui affectent l'absorption et la toxicité de l'Al dans les produits alimentaires doivent être définis [4]. LřALUMINIUM DANS LřINDUSTRIE ALIMENTAIRE L‟aluminium est très utilisé dans l'emballage et le stockage des aliments ainsi que dans la fabrication des ustensiles de cuisine. Il est habituellement employé pour les récipients destinés au stockage long et sans réfrigération des boissons, laitages et des aliments. Il présente plusieurs avantages : 1)- Agit comme une barrière complète contre l‟oxydation des graisses ce qui empêche leur rancissement 2)- Protège contre les odeurs et les saveurs 3)- Résiste à la plupart des formes de corrosion telles que l'humidité, les produits chimiques, l'air, la température et les micro-organismes. 4)- Il est flexible, résilient et malléable [5]. INTERACTION ALUMINIUM ŔALIMENTS Il est important d'identifier les interactions entre un aliment et son emballage, en particulier quand il est consommé de façon régulière. Ces interactions sont le résultat de l‟effet entre l‟aliment, son emballage, et son environnement ce qui entraine des conséquences sur l‟aliment et/ou l‟emballage. L‟importance du passage de l‟Al est fortement liée à plusieurs facteurs tels que le type d'ustensile, le pH, la composition des aliments et/ou du milieu de cuisson, la durée de contact ou de cuisson et la présence de fluorures [6]. Sa biodisponibilité biologique (quantité réelle absorbée) dépend des facteurs humains (différences des barrières cellulaires, le pH de l'intestin grêle, le bol alimentaire,….) Les ions d'Al sont plus solubles en milieu acide comme les acides aminés des viandes, acide lactique du lait, acide citrique des fruits et l‟acide acétique (vinaigre). Par contre, la présence d‟agents complexant limite leur solubilité. Le film protecteur constitué par l‟oxyde d‟Al (Al2O3) résultant de l‟oxydation des surfaces montre un comportement passif dans les solutions. Cependant, sa solubilité augmente dans le milieu acide et alcalin. PEUT-ON ENCORE CUIRE NOS ALIMENTS DANS DES USTENSILES EN ALUMINIUM ? Il y a un certain désaccord au sujet d'utilisation des ustensiles de cuisine en Al, quelques études le déconseillent particulièrement lors de préparation de nourritures acides [7]. Les résultats de quelques études montrent que : 1)-Les aliments cuits dans des ustensiles en Al ont des concentrations de ce métal plus hautes que d‟autres cuits dans d'autres ustensiles. 2)- La migration de l‟Al à partir de l‟ustensile s'est avérée maximale dans un milieu acide (pH=2) (acétique, citrique, oxalique et tartrique) et contenant des ions fluorures [8]. Dans la vie réelle, pendant la cuisson, on peut ajouter de la sauce tomate, du jus de citron, le sel de table et d'autres épices ce qui augmente la libération de l‟Al à partir de l‟ustensile. Le pH devient acide aussi lors de la fermentation [9]. Même la solubilité du film protecteur Al2O3 augmente quand le pH diminue. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 133 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Concernant l‟eau bouillante dans des ustensiles d'Al, les résultats sont controversés, certaines études montrent qu‟elle augmente la libération d‟Al ce qui a été expliqué par la présence de fluorures dans l‟eau. Dans d‟autres études, l‟eau bouillante peut réduire sa libération de 60%. Lors de la cuisson, les aliments riches en graisses favorisent la libération de l‟Al des ustensiles de cuisine [9]. 3)- La température de cuisson influe plus sur la libération de l‟Al que le temps de cuisson. En effet, lorsque la température de cuisson est élevée, la couche d'oxyde (Al2O3) devient plus épaisse et se transforme en une structure cristalline ce qui stimule la libération de l‟Al. LřALUMINIUM DANS LES EMBALLAGES ALIMENTAIRES L‟Al est le constituant principal des emballages des boissons. Les boites ainsi fabriquées ont plusieurs avantages à savoir la facilité de stérilisation, de manipulation, du transport et la minimisation de la perte des vitamines. Scellées, elles préservent également l'environnement anaérobie des produits alimentaires [9]. Ces boites sont faites d'environ 99,7% d‟Al et sont garnies d'un revêtement qui peut être composé d'un grand choix de substances. Chaque société de fabrication détermine la quantité de revêtement à employer de sorte que la corrosion des boîtes ne se produise pas [10]. La libération d‟Al du matériau d'emballage augmente avec les alliages de mauvaise qualité (Aluminiumplomb), le pH acide, la présence des ions chlorures et fluorures, la concentration en CO2 (surtout dans les boissons gazeuses), la température et la durée du stockage qui peut exercer un effet sur le procédé de corrosion [6]. Les fabricants sont invités à mentionner la « date d'échéance » sur chaque boite pour qu'il soit clair au consommateur qu'il y a une durée de conservation pour l‟aliment [6]. 134 Les acides minéraux concentrés ne sont pas emballés dans des récipients en Al en raison des effets corrosifs possibles. ET LE PAPIER ALUMINIUM ? Pour avoir du papier aluminium, le métal pur est roulé en feuilles très minces puis recuit, il possède les mêmes propriétés que le métal et fournit une bonne protection, une manipulation plus facile et une meilleure présentation [8]. Durant ces dernières années, il est d‟une pratique commune d'envelopper la viande et les poissons avant de les faire cuire au four. En raison de la relation possible entre l‟Al et les maladies mentionnées ci-dessus, il est important de déterminer la concentration en Al dans les aliments enveloppés et cuits. Des études ont montré que les concentrations en Al des viandes rouges ou blanches et des filets de poissons enveloppés dans le papier aluminium puis grillés ou cuits au four augmentent clairement pendant le chauffage [9]. CONCLUSION De nos jours, les matériaux d'emballage les plus utilisés sont faits de papier et/ou d‟aluminium. Ce dernier a été considéré auparavant comme un élément sans risque toxique mais actuellement il est bien plus important de rassembler et d‟analyser les données des études sur ce sujet. Les conditions appropriées où l'Al peut être considéré comme un facteur de risque des maladies nerveuses et/ou osseuses n'ont pas été encore spécifiées à ce jour, des mesures préventives sont donc recommandées. Les sociétés de production d‟aliments emballés devraient se rendre compte des résultats des études scientifiques afin de développer des revêtements intérieurs plus résilients de sorte qu‟aucune contamination ne se produise de l‟emballage à la nourriture. De plus, les conditions de stockage doivent être prises en compte pour une meilleure qualité des aliments en boîtes. Il est recommandé d'assurer une ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE bonne stérilisation et d'employer les paquets de haute qualité qui répondent aux exigences EC 1935/2004 applicables à tous les matériaux en contact direct avec les aliments. THESAURUS Mot en Français Mot en Arabe Mot en Anglais Aluminium قصدير Aluminium Emballages علب Food alimentaires الطعام packaging Toxique هسون Toxic Dissolution تحلل Dissolution Oxydation/ اكسدة Oxidation corrosion Acide حوضي Acid BIBLIOGRAPHIE 1) Rivas-Cañedo A, Fernández-García E, Nuñez M. Volatile compounds in fresh meats subjected to high pressure processing: Effect of the packaging material. Meat Science. 2009; 81: 321–328. 2) Turhan S. Aluminium contents in baked meats wrapped in aluminium foil. Meat Science. 2006; 74: 644–647. 3) Joshi S, Toma R, Medora N, O‟Connor K. Detection of aluminium residue in sauces packaged in aluminium pouches. Food Chemistry. 2003; 83: 383–386. 4) Henriquez C, Cordova A, Lutz M, Saavedra J. Storage stability test of apple peel powder using two packaging materials: High-density polyethylene and metalized films of high barrier. Industrial Crops and Products.2013; 45: 121– 127. 5) Barlow C, Morgan D. Polymer film packaging for food: An environmental assessment Resources. Conservation and Recycling. 2013; 78: 74– 80. 6) Vela M, Toma R, Reiboldt W, Pier A. Detection of aluminum residue in fresh and stored canned beer. Food Chemistry. 1998; 63: 235-239. 7) Al Juhaiman. Estimating Aluminum leaching from Aluminum cook wares in different meat extracts and milk. Journal of Saudi Chemical Society. 2010; 14:131–137. 8) Zafeiraki E, Costopoulou D , Vassiliadou I, Bakeas E, Leondiadis L. Determination of perfluorinated compounds (PFCs) in various foodstuff packaging materials used in the Greek market. Chemosphere. 2014; 94: 169– 176. 9) O¨zogul F, Go¨kbulut G, O¨zogul Y, O¨zyurt G. Biogenic amine production and nucleotide ratios in gutted wild sea bass (Dicentrarchus labrax) stored in ice, wrapped in aluminium foil and wrapped in cling film at 4° C. Food Chemistry. 2006; 98: 76–84. 10) Parkar J, Rakesh M. Leaching of elements from packaging material into canned foods marketed in India. Food Control. 2014; 40: 177184. Quelques images ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 135 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO-DZ De Hiroshima à Hamoudia ! Du Japon à l'Algérie pour des recommandations vis à vis des radiations nucléaires ! Dr Ilyes BAGHLI. Président de la SANMO déclassée du secret defense par l'armée française démontre les données suivantes: - Le 14/02/1960: In Salah en Algérie, Agadez au Niger et N'Djamena au Tchad furent contaminées en raison d'un vent sud-est le jour de l'explosion de la Gerboise bleue. - Le 15/02/1960: Yaoundé au Cameroun fut contaminée. - Le 16/02/1960: Tamanrasset en Algérie, Niamey au Niger, Ougadougou au Bukina Fasso furent contaminées. - Le 17/02/1960: Bamako du Mali, Abidjan en Côte d'Ivoire, Accra au Ghana et Lagos au Nigéria furent contaminées. - Le 18/02/1960: Conakry de la Guinée fut contaminée. - Le 19/02/1960: Tindouf en Algérie, Nouakchout en Mauritanie, Tripoli en Libye furent contaminées. - Le 20/02/1960: Ouargla en Algérie, Dakar au Sénégal furent contaminées. - Le 21/02/1960: Bechar fut contaminée. - Le 24/02/1960: Alger, Oran, Tlemcen en Algérie, Oujda, Fès au Maroc, Alicante en Espagne furent contaminées. - Le 25/02/1960: Rabat, Tétouane au Maroc, Setif, Constantine, Annaba en Algérie, Bedja, Tunis en Tunisie, le sud de la Sicile, le sud de la Corse et le sud de l'Espagne furent contaminées. Au soir du 25/02/1960: Toute l'étendue de l'Algérie fut totalement contaminée. Trois autres explosions furent effectuées en ce lieu par la suite: Si la bombe à l'uranium de Hiroshima appelé "Little Boy"du 06/08/1945 fût de 15 kilo-tonnes, et si la bombe au plutonium de Nagasaki "Fat Man" du 09/08/1945 fût de 17 kilotonnes, il faut savoir que la première bombe française testée en Algérie au plateau de Hamoudia à Reggane appelé "Gerboise bleue" du 13/02/1960 fût de 70 kilotonnes, donc plus du double des bombes de Hroshima et de Nagazaki réunis. Il faut savoir que selon la cartographie 136 01/04/1960 Gerboise blanche moins de 5 kt 27/12/1960 Gerboise rouge moins de 5 kt 25/04/1961 Gerboise verte moins de 5 kt Après le dernier essai atmosphérique Gerboise verte, les 13 tirs souterrains qui suivirent furent effectués plus au sud près d'In Ecker, dans le massif du Hoggar. Quatre essais souterrains sur treize n'ont pas été totalement contenus ou confinés: Béryl du 01/05/1962, Améthyste du 30/03/1963, Rubis du 20/10/1963 et Jade du 30/05/1965. Les essais Béryl et Améthyste ont ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ conduit à une irradiation dépassant le seuil réglementaire. La France procédera finalement à 17 essais nucléaires dans le Sahara de 1960 à 1966. Les conséquences néfastes pour la faune, la flore, l'homme et l'environnement. Faut-il le rappeler que la demi-vie de l'uranium 235 est de 24 000 ans. D'ailleurs, sur le terrain, la radiation est toujours aussi forte, plusieurs dizaines de fois plus forte que la radioactivité naturelle. Différentes pathologies dont les cancers (cancer de la thyroïde, cancer du poumon, cancer du sein, leucémie) et certaines anomalies congénitales, etc. peuvent avoir été induites par l'irradiation ainsi subie. Des poussières radioactives répandues dans les eaux souterraines et la flore représentent un danger pour la santé humaine et animale. Il est important de savoir que la contamination initiale est de 20% par exposition directe aux radiations nucléaires et que la contamination tardive représente 80% par contamination particulièrement de l'eau, de l'alimentation, du bétail et des matériaux de constructions. Finalement, toute l'Algérie est concernée par la prévention vis à vis des radiations nucléaires, sans oublier les radiations provoquées par les examens radiologiques qui peuvent être source de rayonnements: - Radiographie d'un membre, l'équivalent d'un jour et demi. - Panoramique dentaire, l'équivalent de 4 jours. - Radiographie pulmonaire, l'équivalent de 7 jours. - Mammographie, l'équivalent de 20 jours. - Scanner du crâne et radiographie abdominale, l'équivalent de 300 jours. - Scanner du thorax, l'équivalent de 900 jours. - Scanner abdomino-pelvien l'équivalent de 1500 jours. Suite aux premières mesures thérapeutiques préventives effectuées à: - Tchernobyl en Ukraine à la suite de l'accident nucléaire du 26/04/1986 où ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE l'acide lipoïque et la vitamine E furent administrés par voie orale ! - Fukushima au Japon suite à l'accident nucléaire du 13/03/2011 suite au séisme et tsunami du 11/03/2011 où la vitamine C à 25 grammes par voie intra-veineuse a été administré à 16 employés qui ont eu grâce à cette méthode et celles classiques une préservation des facteurs cancérigènes par rapport au reste des employés qui n'ont eu recours qu'aux méthodes classiques: tenue spéciale, douche et nettoyage. Suite à ceci le JCIT: Collège Japonais de Thérapie Intra-veineuse, présidé par le Pr Atsuo Yanagisawa et co-signé par: - Pr Burton Burkson. - Thomas Edward Levy. - Ronald Hunnighake. - Bradford Weeks. - Steven Hickey. - Masachi Uwabu. a émis le 29/03/2011 les recommandations suivantes pour la prévention vis à vis des radiations nucléaires: - Vitamine C 1 à 3 grammes 3 à 4 fois par jour. ou - Vitamine C liposphérique; 1 à 2 grammes deux fois par jour. - Acide alpha-lipoique: 100 à 300 mg deux fois par jour. - Sélénium 50 ug à 200 ug deux fois par jour. - Vitamine E 100 à 200 mg deux fois par jour. Pour ceux qui travaillent au niveau des zones contaminées, en plus de ces recommandations, une perfusion de vitamine C de 25 grammes par voie intraveineuse. Ce protocole a été approuvé par la SANMO suite aux deux presentations du Pr Atsuo Yanagisawa, Président de la JCIT et de l'ISOM: Société Internationale de Médecine Orthomoléculaire, dont la SANMO est member depuis février 2011, lors des séminaires organisés à Alger, le 24 janvier 2013 et le 25 janvier 2014 en présence des membres de la SANMO et des médecins de la direction centrale de la santé militaire ! A ce protocole, 80 mg de NADH ou CoEnzyme1 ou vitamine B3 enrichie à l'hydrogène élaborée grâce aux travaux du Pr George Birkmayer en Autriche est également préconisé, vu les études ayant prouvé l'effet potentiel du NADH sur la vitamine C et vis-versa effectuées au niveau du Laboratoire de Biologie de l'Université de Tlemcen dirigé par le Pr Hafida Merzouk et vu les études effectuées en Chine qui ont prouvé l'efficacité du NADH dans la protection vis à vis des radiations nucléaires. La SANMO préconise de combiner ces deux méthodes, pour optimiser la prévention. Parmi la prévention alimentaire, les aliments riches en vitamine C restent insuffisants our assurer une protection optimum: 170 mg de vitamine C par 100 grammes de persil. 100 mg de vitamine C par 100 grammes de kiwi. 55 mg de vitamine C par 100 grammes de fraise. 55 mg de vitamine C par 100 grammes d'orange. Pour ceci, il est nécessaire d'aller vers des supplémentassions préventives quotidiennes pour assurer une médecine préventive à chaque citoyen dans un esprit serein et pour assurer une réduction des pathologies chroniques dégénératives dues aux radiations nucléaires et aux radiations radiologiques d'origine iatrogène sans oublier les effets de la pollution atmosphérique due au monoxydes de carbone et de la pollution électromagnétique due aux différents réémetteurs de télécommunications qui nous permettent par contre de vous communiqué ces recommandations ! Prendre soin de soi-même est possible, loin d'un esprit de thématique tabou mais dans un esprit de prévention rigoureux et efficace. Dr. Ilyès BAGHLI Président SANMO 24/02/2014 – 54 ans après la contamination de la zone nord de l'Algérie ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO-PRESSBOOK El Watan - Dimanche 4 mai 2014 – 5 SÉMINAIRE SUR LA TRAGÉDIE NUCLÉAIRE DE LA FRANCE DANS LE HOGGAR « Les explosions nucléaires, la catastrophe de Béryl et le droit international humanitaire» est l‟intitulé du séminaire organisé, avant-hier, par l‟association Taourirt des victimes de la tragédie nucléaire de la France, dans l‟Ahaggar. Organisée avec le concours du Centre Universitaire et la Direction des Oeuvres Universitaires de la wilaya, la rencontre, à laquelle ont pris part des chercheurs, des experts en nucléaire, des juristes et des représentants de l‟Association des victimes de Reggane (Adrar), était une occasion pour sonner, pour la énième fois, le tocsin face au désastre survenu sur les monts de Tan Affl a et Tan Ataram dans la région d‟In Ekker, à 180 km au nord de Tamanrasset, où furent effectués 13 tirs nucléaires, dont 12 ont échoué, parmi lesquels l‟essai baptisé du nom de Béryl, le 1er mai 1962. Mais aussi pour accabler la France pour avoir utilisé des Algériens comme cobayes pour mener à terme ses expériences en les faisant passer pour des mannequins. 150 ALGÉRIENS UTILISÉS COMME COBAYES «Pas moins de 150 prisonniers algériens, conduits de l’établissement pénitentiaire de Sidi Bel Abbès à In-Ekker par un militaire allemand qui travaillait pour la France en qualité de chauffeur», dénonce maître Benbraham Fatma-Zohra, avocate à la cour d‟Alger. Et de poursuivre : «Le dossier est entre les mains de personnes honnêtes qui ne se laisseront jamais duper par la France. Mieux, le dossier mis sur la table du Parlement français en janvier dernier est à jour. Il est temps de passer à la vitesse supérieure et de montrer au monde entier que le service rendu à la France a été récompensé par la mort et le génocide. L’Etat algérien doit s’immiscer pour mieux avancer dans cette affaire.» Et d‟insister sur la levée du sceau du secret-défense sur toutes les archives se rapportant aux explosions et expérimentations nucléaires françaises dans le Sahara algérien, afin qu‟«elles servent de documents de référence aux chercheurs et experts en la matière et 137 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE surtout pour connaître le nombre exact d’Algériens impliqués dans le programme nucléaire de la France ainsi que la population sédentaire et nomade concernée par les conséquences sanitaires des explosions». Ces archives permettront également de localiser les lieux des essais, le matériel contaminé et les endroits d‟entreposage des déchets radioactifs enfouis ou laissés sur place après le départ de la France, en 1967, conformément aux Accords d‟Evian. Me Benbraham a appelé l‟assistance, composée essentiellement d‟historiens et d‟étudiants, à s‟organiser et à se mettre à la recherche des précieux documents et témoignages des victimes encore en vie, en plus de toute attestation servant de pièce à conviction afin d‟étoffer le dossier. Benseddik Boudjemaâ, que la France exploitait pour une minable rémunération dans la construction des galeries d‟explosion, était dans la salle. Il a fourni une pièce précieuse à maître Benbraham et lui a promis d‟en envoyer d‟autres qu‟il a toujours en sa possession. L‟association Taourirt, 52 ans après cette tragédie que la France ne veut toujours pas réparer, dresse un réquisitoire contre un crime inouï dans l‟histoire de l‟humanité et en appelle à l‟ONU pour rétablir les victimes dans leur droit à l‟indemnisation morale et matérielle. La loi promulguée en janvier 2010, dite Morin, où il est clairement fait abstraction de victimes algériennes et des dégâts importants occasionnés à l‟environnement, ne répond aucunement aux aspirations des concernés, puisqu‟«elle occulte un principe aussi fondamental que la présomption d’origine et limite le seuil d’exposition et le nombre de pathologies radio-induites. Cette loi scélérate instaure faussement la caution de la science pour masquer son objectif portant limitation des indemnisations pour des raisons purement budgétaires. Il faut retenir que les explosions nucléaires sur une population pacifique demeurent un parfait crime contre l’humanité et restera de ce fait imprescriptible donc voué à contraindre leurs auteurs à reconnaître d’abord puis à réparer les dommages 138 constatés, car l’histoire rattrape toujours les hommes et les Etat malgré leur négationnisme», ajoute encore Mme Benbraham. Pour sa part, Bendaoud Abdelkader, professeur de droit à l‟université d‟Oran a, tout en regrettant l‟absence des autorités locales à cette rencontre, plaidé pour la mise en place d‟un plan d‟urgence impliquant les ministères de la Justice et des Affaires religieuses et des Wakfs afin de subventionner les associations et organisations activant dans ce cadre. Comme il a préconisé d‟en appeler au Comité international de la Croix-Rouge, «plus efficace» que l‟ONU, avec pour but d‟accélérer les procédures liées à ce dossier. La plaidoirie de M. Bendaoud portait aussi sur la nécessité «de mettre en place une bonne assise juridique dotée d’une base de données dans le cadre de la commission internationale humanitaire. Toutefois, la mise en place d’une stratégie territoriale visant à rentabiliser les méthodes de supervision est plus qu’impérative pour la sauvegarde de la mémoire et une indemnisation durable. Il est donc utile de prévoir des rencontres et coopérations de recherche sur, entre autres thématiques, Béryl, les dommages et les solutions». Dans son intervention, Mansouri Amar, docteur en physique à l‟université d‟Alger, a fait voyager l‟assistance dans l‟histoire du nucléaire de par le monde avant de terminer par des prises de vue aussi percutantes que choquantes, réalisées dans des sites impropres à toute forme de vie à cause de la menace radioactive, à l‟exemple de Hammoudia (40 km de Reggane) polluée pour 244 000 ans, soit 10 fois la période du plutonium utilisé lors des essais d‟In Ekker. Abdul Kadhum AlAboudi, expert en nucléaire, a, quant à lui, évoqué les dernières révélations des médias français pour évaluer les risques radioactifs auxquels est exposé le Sahara algérien. Le conférencier – originaire d‟Irak mais épris du Sahara algérien où il a réalisé plusieurs oeuvres scientifiques au point d‟émettre le désir d‟y être inhumé – a invité les associations de victimes à se constituer en collectif ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ national afin de parvenir à tracer une feuille de route permettant de dépoussiérer ce dossier et d‟exhumer nos martyrs du cimetière de l‟oubli. En conclusion, les participants ont recommandé de nettoyer et de réhabiliter les sites des essais. Ils ont mis l‟accent sur le suivi médical des victimes des rayonnements ionisants via la construction par la France de structures sanitaires spécialisées à même de prendre en charge les pathologies radioinduites chez les personnes impliquées directement et leur descendance, et ce, depuis le stade de diagnostic. Selon une étude réalisée récemment par des experts, 21,28% des femmes de cette région sont atteintes de cancer du sein et 10,13% de cancer de la thyroïde. Pour cette raison, ils ont insisté pour la mise en place d‟un système de surveillance des sites, à l‟instar de ce qui s‟est fait en Polynésie française, et exigé de la France la formation de spécialistes algériens en décontamination et l‟indemnisation des victimes suivant «le principe du parallélisme des formes». L‟introduction de cette calamité dans le programme de l‟éducation nationale a été soulignée par le président de l‟Association des victimes de Reggane, El Hamel Omar, qui a félicité son homologue de Taourirt pour cette première initiative et le défi relevé contre la France, le déni de l‟histoire et… les autorités locales. R. Ighil Entrée d’une galerie au mont Tan Affl a dans la région à In Ekker (Tamanrasset) ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Carter of ISOM, Dr. Ilyes Baghli of SANMO and other well-known pioneers of orthomolecular medicine from all over the world. President: Dr. Atsuo Yanagisawa Members: 499 Japanese doctors + 18 international board members International Board members: Japanese College of Intravenous Therapy (JCIT) was established by Dr. Atsuo Yanagisawa in Oct 2007. The organization has offered knowledge and technologies of cutting-edge IV therapy to Japanese doctors and dentists since then. JCIT currently holds 500 members, building a strong network of like-minded professionals all over Japan. In addition to Japanese members, JCIT has 18 international board members, including Mr. Steven Marques Masashi Pr Atsuo YANAGISAWA Hiroyuki Abe Kudan Dr. Damian Dawning (UK) Dr. Ilyes Baghli (Algeria) Dr. Aileen Burford-Mason(Canada) Dr. Burton Berkson (USA) Mr. Steven Carter (Canada) ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ Dr. James Greenblatt (USA) 139 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Dr. Ronald Hunninghake (USA) Dr. Thomas Levy (USA Dr. Steven Hickey (UK) Dr. Liu Hui-hsiung (Taiwan) Dr. John Hoffer(Canada) Dr. Roberto Ortiz (Mexico) Dr. Welman Schrader (USA) Dr. Michael Jansen (USA) Dr. Neil Riordan (USA) Dr. Bradford Weeks (USA) 140 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ Mr. Andrew W. Saul (USA) Dr. Gert Schuitemaker(Netherland) ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 141 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 142 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 143 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 144 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 145 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Pr Takuji SHIRASAWA et Daniela Chan seront parmi nous pour le séminaire du 26 au 27 décembre 2014. 1982-1986 Residency for Chest medicine in Chiba University Hospital 1986-1990 Graduate school for Immunology in Chiba University 1990 PhD in immunology in Chiba University 1990-1997 Research fellow in Molecular Pathology in Tokyo Metropolitan Institute of Gerontology (TMIG) 1997-2003 Laboratory Chief for Molecular Genetics of Gerontology in TMIG 2003-2007 Director in Molecular Genetics of Gerontology in TMIG 2007-present Professor in Ageing Control Medicine, Juntendo University Academic Activities Japan Anti-Aging Association, Director Japan Biogerontology, Director Biorehabilitation Association, Director Journal Editorial Journal of Neuroscience Research Scientific Interests 1. Molecular Biology of Aging & Gerontology 2. Molecular Genetics of Alzheimer‟s Diseases 3. Analysis of Athletic Gene Publications Curriculum Vitae Name: Takuji SHIRASAWA, M.D. & Ph.D. Date of Birth: March 10th, 1958 Position: Professor Faculty: Department of Ageing Control Medicine, Juntendo University HP: http://www.shirasawa-acl.net CV updated: Jan 2014 Dr. Takuji Shirasawa is an Anti-Aging Practitioner and the Professor of Aging Control Medicine at Juntendo University, Graduate School of Medicine in Japan. He obtained his Ph.D. in immunology at Chiba University Graduate School of Medicine and has been researching molecular pathology and the molecular genetics of gerontology for the past 20 years. He is the Director of the Japan Anti-Aging Association, Japan Biogerontology and Biorehabilitation Association. He is the Editor of the Journal of Neuroscience Research. His research interests include the molecular biology of aging and gerontology, the molecular genetics of Alzheimer‟s Disease, and telomere research. He is regarded as one of Japan‟s top specialists in preventive medicine for aging and has written over 150 books becoming the most published doctor in Japan. Over 2 million copies of his books have been sold in Japan and many books have been translated and published abroad. Academic Carrier 1982 Graduated from Chiba University, School of Medicine 146 1. Takemori, T., Miyazoe, I., Shirasawa, T., Taniguchi, M., and Graf, T. 1987. A temperature-sensitive mutant of Abelson murine leukemia virus confers inducibility of IgM expression to transformed lymphoid cells. EMBO J 6:951-956. 2. Kikuchi, N., Onozaki, I., and Shirasawa, T. 1989. [Community acquired pulmonary infections in a general hospital]. Nihon Kyobu Shikkan Gakkai Zasshi 27:166-172. 3. Kimoto, H., Shirasawa, T., Taniguchi, M., and Takemori, T. 1989. B cell precursors are present in the thymus during early development. Eur J Immunol 19:97-104. 4. Takemori, T., Mizuguchi, J., Miyazoe, I., Nakanishi, M., Shigemoto, K., Kimoto, H., Shirasawa, T., Maruyama, N., and Taniguchi, M. 1990. Two types of mu chain complexes are expressed during differentiation from pre-B to mature B cells. EMBO J 9:2493-2500. 5. Fujita, T., Shirasawa, T., Uchida, K., and Maruyama, N. 1992. Isolation of cDNA clone encoding rat senescence marker protein-30 (SMP30) and its tissue distribution. Biochim Biophys Acta 1132:297-305. 6. Itoh, Y., Maruyama, N., Kitamura, M., Shirasawa, T., Shigemoto, K., and Koike, T. 1992. Induction of endogenous retroviral gene product (SU) as an acute-phase protein by IL-6 in murine hepatocytes. Clin Exp Immunol 88:356-359. 7. Kikuchi, N., Igari, H., Kawashima, T., Onozaki, I., and Shirasawa, T. 1992. [Diagnosis of pulmonary tuberculosis in general hospital "a study of 114 cases"]. Kekkaku 67:495-507. 8. Shirasawa, T., Miyazoe, I., Hagiwara, S., Kimoto, H., Shigemoto, K., Taniguchi, M., and Takemori, T. 1992. Heavy chain variable (VH) region diversity generated by VH gene replacement in the progeny of a single precursor cell transformed with a temperature-sensitive mutant of Abelson murine leukemia virus. J Exp Med 176:1209-1214. 9. Shirasawa, T., Sakamoto, K., Akashi, T., Takahashi, H., and Kawashima, A. 1992. Nucleotide sequence of rat elongation factor-1 alpha cDNA. Nucleic Acids Res 20:909. 10. Tsunetsugu-Yokota, Y., Minekawa, T., Shigemoto, K., Shirasawa, T., and Takemori, T. 1992. Characterization of a new subgroup of human Ig V lambda cDNA clone and its expression. Mol Immunol 29:723-728. 11. Usuda, S., Takemori, T., Matsuoka, M., Shirasawa, T., Yoshida, K., Mori, A., Ishizaka, K., and Sakano, H. 1992. Immunoglobulin V gene replacement is caused by the intramolecular DNA deletion mechanism. EMBO J 11:611-618. 12. Ikeda, T., Shirasawa, T., Esaki, Y., Yoshiki, S., and Hirokawa, K. 1993. Osteopontin mRNA is expressed by smooth muscle-derived foam cells in human atherosclerotic lesions of the aorta. J Clin Invest 92:28142820. ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 13. Kasai, M., Shirasawa, T., Kitamura, M., Ishido, K., Kominami, E., and Hirokawa, K. 1993. Proenzyme from of cathepsin L produced by thymic epithelial cells promotes proliferation of immature thymocytes in the presence of IL-1, IL-7, and anti-CD3 antibody. Cell Immunol 150:124-136. 14. Kitamura, M., Shirasawa, T., Mitarai, T., Muramatsu, T., and Maruyama, N. 1993. A retinoid responsive cytokine gene, MK, is preferentially expressed in the proximal tubules of the kidney and human tumor cell lines. Am J Pathol 142:425-431. 15. Shirasawa, T., Akashi, T., Sakamoto, K., Takahashi, H., Maruyama, N., and Hirokawa, K. 1993. Gene expression of CD24 core peptide molecule in developing brain and developing non-neural tissues. Dev Dyn 198:1-13. 16. Shirasawa, T., Ohnishi, K., Hagiwara, S., Shigemoto, K., Takebe, Y., Rajewsky, K., and Takemori, T. 1993. A novel gene product associated with mu chains in immature B cells. EMBO J 12:1827-1834. 17. Akashi, T., Shirasawa, T., and Hirokawa, K. 1994. Gene expression of CD24 corepolypeptide molecule in normal rat tissues and human tumor cell lines. Virchows Arch 425:399-406. 18. Asao, H., Tanaka, N., Ishii, N., Higuchi, M., Takeshita, T., Nakamura, M., Shirasawa, T., and Sugamura, K. 1994. Interleukin 2-induced activation of JAK3: possible involvement in signal transduction for c-myc induction and cell proliferation. FEBS Lett 351:201-206. 19. Kitamura, M., Maruyama, N., Shirasawa, T., Nagasawa, R., Watanabe, K., Tateno, M., and Yoshiki, T. 1994. Expression of an endogenous retroviral gene product in human placenta. Int J Cancer 58:836-840. 20. Kitamura, M., Shirasawa, T., and Maruyama, N. 1994. Gene transfer of metalloproteinase transin induces aberrant behavior of cultured mesangial cells. Kidney Int 45:1580-1586. 21. Mori, H., Ishii, K., Tomiyama, T., Furiya, Y., Sahara, N., Asano, S., Endo, N., Shirasawa, T., and Takio, K. 1994. Racemization: its biological significance on neuropathogenesis of Alzheimer's disease. Tohoku J Exp Med 174:251-262. 22. Ohno, H., Goto, S., Taki, S., Shirasawa, T., Nakano, H., Miyatake, S., Aoe, T.,Ishida, Y., Maeda, H., Shirai, T., et al. 1994. Targeted disruption of the CD3 eta locus causes high lethality in mice: modulation of Oct-1 transcription on the opposite strand. EMBO J 13:1157-1165. 23. Shirasawa, T., Sakamoto, K., and Tkahashi, H. 1994. Molecular cloning and evolutional analysis of a mammalian homologue of the Distal-less 3 (Dlx-3) homeobox gene. FEBS Lett 351:380-384. 24. Tagawa, M., Shirasawa, T., Fujimura, S., and Sakiyama, S. 1994. Identification of a rat protein tyrosine phosphatase gene preferentially expressed in the embryonal brain. Cell Mol Biol Res 40:627-631. 25. Tagawa, M., Shirasawa, T., Fujimura, S., and Sakiyama, S. 1994. Expression of protein tyrosine phosphatase genes in the developing brain of mouse and rat. Biochem Mol Biol Int 33:1221-1227. 26. Takahashi, T., and Shirasawa, T. 1994. Molecular cloning of rat JAK3, a novel member of the JAK family of protein tyrosine kinases. FEBS Lett 342:124-128. 27. Tomiyama, T., Asano, S., Furiya, Y., Shirasawa, T., Endo, N., and Mori, H. 1994. Racemization of Asp23 residue affects the aggregation properties of Alzheimer amyloid beta protein analogues. J Biol Chem 269:10205-10208. 28. Fujita, T., Mandel, J.L., Shirasawa, T., Hino, O., Shirai, T., and Maruyama, N. 1995. Isolation of cDNA clone encoding human homologue of senescence marker protein-30 (SMP30) and its location on the X chromosome. Biochim Biophys Acta 1263:249-252. 29. Hosoya, H., Shimazaki, K., Kobayashi, S., Takahashi, H., Shirasawa, T., Takenawa, T., and Watanabe, K. 1995. Developmental expression of the neural adhesion molecule F3 in the rat brain. Neurosci Lett 186:8386. 30. Ishijima, S.A., Zeng, Y.X., Kurashima, C., Utsuyama, M., Shirasawa, T., Sakamoto, K., and Hirokawa, K. 1995. Expression of ZAP-70 gene in the developing thymus and various nonlymphoid tissues of embryonic and adult mice. Cell Immunol 165:278-283. 31. Karasawa, T., Aizawa, Y., Zeniya, M., Kuramoto, A., Shirasawa, T., and Toda, G. 1995. Genetic heterogeneity in the precore region of hepatitis B virus in hepatitis B e antigen-negative chronic hepatitis B patients: spontaneous seroconversion and interferon-induced seroconversion. J Med Virol 45:373-380. 32. Park, S.Y., Saijo, K., Takahashi, T., Osawa, M., Arase, H., Hirayama, N., Miyake, K., Nakauchi, H., Shirasawa, T., and Saito, T. 1995. Developmental defects of lymphoid cells in Jak3 kinase-deficient mice. Immunity 3:771-782. 33. Shirasawa, T., Endoh, R., Zeng, Y.X., Sakamoto, K., and Mori, H. 1995. Protein L-isoaspartyl methyltransferase: developmentally regulated gene expression and protein localization in the central nervous system of aged rat. Neurosci Lett 188:37-40. 34. Takahashi, T., Shirasawa, T., Miyake, K., Yahagi, Y., Maruyama, N., Kasahara, N., Kawamura, T., Matsumura, O., Mitarai, T., and Sakai, O. 1995. Protein tyrosine kinases expressed in glomeruli and cultured glomerular cells: Flt-1 and VEGF expression in renal mesangial cells. Biochem Biophys Res Commun 209:218-226. 35. Watanabe, K., Fukuchi, T., Hosoya, H., Shirasawa, T., Matuoka, K., Miki, H., and Takenawa, T. 1995. Splicing isoforms of rat Ash/Grb2. Isolation and characterization of the cDNA and genomic DNA clones and implications for the physiological roles of the isoforms. J Biol Chem 270:13733-13739. 36. Fujita, T., Shirasawa, T., and Maruyama, N. 1996. Isolation and characterization of genomic and cDNA clones encoding mouse senescence marker protein-30 (SMP30). Biochim Biophys Acta 1308:4957. 37. Fujita, T., Shirasawa, T., Uchida, K., and Maruyama, N. 1996. Gene regulation of senescence marker protein-30 (SMP30): coordinated upregulation with tissue maturation and gradual down-regulation with aging. Mech Ageing Dev 87:219-229. 38. Kondo, T., Shirasawa, T., Itoyama, Y., and Mori, H. 1996. Embryonic genes expressed in Alzheimer's disease brains. Neurosci Lett 209:157160. 39. Sahara, N., Yahagi, Y., Takagi, H., Kondo, T., Okochi, M., Usami, M., Shirasawa, T., and Mori, H. 1996. Identification and characterization of presenilin I-467, I-463 and I-374. FEBS Lett 381:7-11. 40. Takahashi, T., Shirasawa, T., Miyake, K., Yahagi, Y., Matsumura, O., Abe, A., Natori, Y., Yamabe, H., Utsunomiya, Y., Maruyama, N., et al. 1996. Jak3 expression in glomerular epithelia of IgA nephropathy (IgA-N) patients. Clin Exp Immunol 104:517-524. 41. Takano, T., Yamanouchi, Y., Sahara, N., Shirasawa, T., and Mori, H. 1996. Assignment of Alzheimer's presenilin-1 (PS-1) gene to 14q24.3 by fluorescence in situ hybridization. Neurosci Lett 214:69-71. 42. Tomoda, T., Shirasawa, T., Yahagi, Y.I., Ishii, K., Takagi, H., Furiya, Y., Arai, K.I., Mori, H., and Muramatsu, M.A. 1996. Transforming growth factor-beta is a survival factor for neonate cortical neurons: coincident expression of type I receptors in developing cerebral cortices. Dev Biol 179:79-90. 43. Yahagi, Y., Tagawa, M., Tomoda, T., and Shirasawa, T. 1996. Binary expression of olfactory bulb-protein tyrosine phosphatase in rat central ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 147 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE nervous system: developmental gene regulation in neonate cerebral cortex and constitutive expression in olfactory-rhinencephalon. Neurosci Lett 211:125-128. 44. Yamamoto, A., Sahara, N., Usami, M., Okochi, M., Kondo, T., Kametani, F., Tanaka, K., Yahagi, Y., Shirasawa, T., Itoyama, Y., et al. 1996. Abnormal gel-electrophoretic behavior of presenilin 1 and it's fragment. Biochem Biophys Res Commun 226:536-541. 45. Hishikawa, T., Ogasawara, H., Kaneko, H., Shirasawa, T., Matsuura, Y., Sekigawa, I., Takasaki, Y., Hashimoto, H., Hirose, S., Handa, S., et al. 1997. Detection of antibodies to a recombinant gag protein derived from human endogenous retrovirus clone 4-1 in autoimmune diseases. Viral Immunol 10:137-147. 46. Karasawa, T., Shirasawa, T., Okawa, Y., Kuramoto, A., Shimada, N., Aizawa, Y., Zeniya, M., and Toda, G. 1997. Association between frequency of amino acid changes in core region of hepatitis B virus (HBV) and the presence of precore mutation in Japanese HBV carriers. J Gastroenterol 32:611-622. 47. Mukouyama, Y., Kuroyanagi, H., Shirasawa, T., Tomoda, T., Saffen, D., Oishi, M., and Watanabe, T. 1997. Induction of protein tyrosine phosphatase epsilon transcripts during NGF-induced neuronal differentiation of PC12D cells and during the development of the cerebellum. Brain Res Mol Brain Res 50:230-236. 48. Sakai, T., Kawamura, T., and Shirasawa, T. 1997. Mizoribine improves renal tubulointerstitial fibrosis in unilateral ureteral obstruction (UUO)-treated rat by inhibiting the infiltration of macrophages and the expression of alpha-smooth muscle actin. J Urol 158:2316-2322. 49. Sakai, T., Tanaka, H., and Shirasawa, T. 1997. Two distinct epithelial responses may compensate for the ureteral obstruction in early and late phase of unilateral ureteral obstruction-treated rat: cellular proliferation in acute phase and osteopontin expression in chronic phase. Nephron 77:340-345. 50. Shimizu, E., Shirasawa, H., Kodama, K., Kuroyanagi, H., Shirasawa, T., Sato, T., and Simizu, B. 1997. Glutamate dehydrogenase mRNA is immediately induced after phencyclidine treatment in the rat brain. Schizophr Res 25:251-258. 51. Smith, C.D., Barchue, J., Mentel, C., DeLucas, L., Shirasawa, T., and Chattopadhyay, D. 1997. Crystallization and preliminary cryogenic X-ray diffraction analyses of protein L-isoaspartyl O-methyltransferase from human fetal brain. Proteins 28:457-460. 52. Tagawa, M., Shirasawa, T., Yahagi, Y., Tomoda, T., Kuroyanagi, H., Fujimura, S., Sakiyama, S., and Maruyama, N. 1997. Identification of a receptor-type protein tyrosine phosphatase expressed in postmitotic maturing neurons: its structure and expression in the central nervous system. Biochem J 321 ( Pt 3):865-871. 53. Fujita, T., Shirasawa, T., Inoue, H., Kitamura, T., and Maruyama, N. 1998.Hepatic and renal expression of senescence marker protein-30 and its biological significance. J Gastroenterol Hepatol 13 Suppl:S124-131. 54. Kuroyanagi, H., Tagawa, M., and Shirasawa, T. 1998. [Structure, expression and functions of receptor-type protein tyrosine phosphatase RPTP-BK in central nervous system]. Tanpakushitsu Kakusan Koso 43:1162-1168. 55. Kuroyanagi, H., Yan, J., Seki, N., Yamanouchi, Y., Suzuki, Y., Takano, T., Muramatsu, M., and Shirasawa, T. 1998. Human ULK1, a novel serine/threonine kinase related to UNC-51 kinase of Caenorhabditis elegans: cDNA cloning, expression, and chromosomal assignment. Genomics 51:76-85. 56. Shindo, M., Nakano, H., Kuroyanagi, H., Shirasawa, T., Mihara, M., Gilbert, D.J.,Jenkins, N.A., Copeland, N.G., Yagita, H., and Okumura, K. 1998. cDNA cloning, expression, subcellular localization, and chromosomal assignment of mammalian aurora 148 homologues, aurora-related kinase (ARK) 1 and 2. Biochem Biophys Res Commun 244:285-292. 57. Suzuki, G., Nakata, Y., Dan, Y., Uzawa, A., Nakagawa, K., Saito, T., Mita, K., and Shirasawa, T. 1998. Loss of SDF-1 receptor expression during positive selection in the thymus. Int Immunol 10:1049-1056. 58. Yamamoto, A., Takagi, H., Kitamura, D., Tatsuoka, H., Nakano, H., Kawano, H., Kuroyanagi, H., Yahagi, Y., Kobayashi, S., Koizumi, K., et al. 1998. Deficiency in protein L-isoaspartyl methyltransferase results in a fatal progressive epilepsy. J Neurosci 18:2063-2074. 59. Yan, J., Kuroyanagi, H., Kuroiwa, A., Matsuda, Y., Tokumitsu, H., Tomoda, T., Shirasawa, T., and Muramatsu, M. 1998. Identification of mouse ULK1, a novel protein kinase structurally related to C. elegans UNC-51. Biochem Biophys Res Commun 246:222-227. 60. Akashi, T., Miyagi, T., Ando, N., Suzuki, Y., Nemoto, T., Eishi, Y., Nakamura, K., Shirasawa, T., Osa, N., Tanaka, N., et al. 1999. Synthesis of basement membrane by gastrointestinal cancer cell lines. J Pathol 187:223-228. 61. Asaumi, S., Kuroyanagi, H., Seki, N., and Shirasawa, T. 1999. Orthologues of the Caenorhabditis elegans longevity gene clk-1 in mouse and human. Genomics 58:293-301. 62. Atsuta, R., Akiyama, K., Shirasawa, T., Okumura, K., Fukuchi, Y., and Ra, C.1999. Atopic asthma is dominant in elderly onset asthmatics: possibility for an alteration of mast cell function by aging through Fc receptor expression. Int Arch Allergy Immunol 120 Suppl 1:76-81. 63. Fujita, T., Shirasawa, T., and Maruyama, N. 1999. Expression and structure of senescence marker protein-30 (SMP30) and its biological significance. Mech Ageing Dev 107:271-280. 64. Fukuda, H., Shimizu, T., Nakajima, M., Mori, H., and Shirasawa, T. 1999. Synthesis, aggregation, and neurotoxicity of the Alzheimer's Abeta1-42 amyloid peptide and its isoaspartyl isomers. Bioorg Med Chem Lett 9:953-956. 65. Nakano, H., Sakon, S., Koseki, H., Takemori, T., Tada, K., Matsumoto, M., Munechika, E., Sakai, T., Shirasawa, T., Akiba, H., et al. 1999. Targeted disruption of Traf5 gene causes defects in CD40- and CD27-mediated lymphocyte activation. Proc Natl Acad Sci U S A 96:9803-9808. 66. Ohno, H., Tomemori, T., Nakatsu, F., Okazaki, Y., Aguilar, R.C., Foelsch, H., Mellman, I., Saito, T., Shirasawa, T., and Bonifacino, J.S. 1999. Mu1B, a novel adaptor medium chain expressed in polarized epithelial cells. FEBS Lett 449:215-220. 67. Shirasawa, T. 1999. [Characterization of protein isoaspartyl methyltransferase (PIMT)-deficient mice]. Seikagaku 71:134-140. 68. Tomoda, T., Bhatt, R.S., Kuroyanagi, H., Shirasawa, T., and Hatten, M.E. 1999. A mouse serine/threonine kinase homologous to C. elegans UNC51 functions in parallel fiber formation of cerebellar granule neurons. Neuron 24:833-846. 69. Yan, J., Kuroyanagi, H., Tomemori, T., Okazaki, N., Asato, K., Matsuda, Y., Suzuki, Y., Ohshima, Y., Mitani, S., Masuho, Y., et al. 1999. Mouse ULK2, a novel member of the UNC-51-like protein kinases: unique features of functional domains. Oncogene 18:5850-5859. 70. Gonzalez, L.J., Shimizu, T., Satomi, Y., Betancourt, L., Besada, V., Padron, G., Orlando, R., Shirasawa, T., Shimonishi, Y., and Takao, T. 2000. Differentiating alpha- and beta-aspartic acids by electrospray ionization and low-energy tandem mass spectrometry. Rapid Commun Mass Spectrom 14:2092-2102. 71. Kobayashi, S., Morimoto, K., Shimizu, T., Takahashi, M., Kurosawa, H., and Shirasawa, T. 2000. Association of EXT1 and EXT2, hereditary ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE multiple exostoses gene products, in Golgi apparatus. Biochem Biophys Res Commun 268:860-867. 72. Nakajima, M., Shimizu, T., and Shirasawa, T. 2000. Notch-1 activation by familial Alzheimer's disease (FAD)-linked mutant forms of presenilin-1. J Neurosci Res 62:311-317. 73. Shimizu, T., Watanabe, A., Ogawara, M., Mori, H., and Shirasawa, T. 2000. Isoaspartate formation and neurodegeneration in Alzheimer's disease. Arch Biochem Biophys 381:225-234. 74. Tomemori, T., Seki, N., Suzuki, Y., Shimizu, T., Nagata, H., Konno, A., and Shirasawa, T. 2000. Isolation and characterization of murine orthologue of PTP-BK. Biochem Biophys Res Commun 276:974-981. 75. Ikegaya, Y., Yamada, M., Fukuda, T., Kuroyanagi, H., Shirasawa, T., and Nishiyama, N. 2001. Aberrant synaptic transmission in the hippocampal CA3 region and cognitive deterioration in protein-repair enzyme-deficient mice. Hippocampus 11:287-298. 76. Koizumi, K., Nakajima, M., Yuasa, S., Saga, Y., Sakai, T., Kuriyama, T., Shirasawa, T., and Koseki, H. 2001. The role of presenilin 1 during somite segmentation. Development 128:1391-1402. 77. Nakai, D., Yuasa, S., Takahashi, M., Shimizu, T., Asaumi, S., Isono, K., Takao, T., Suzuki, Y., Kuroyanagi, H., Hirokawa, K., et al. 2001. Mouse homologue of coq7/clk-1, longevity gene in Caenorhabditis elegans, is essential for coenzyme Q synthesis, maintenance of mitochondrial integrity, and neurogenesis. Biochem Biophys Res Commun 289:463-471. 78. Nakajima, M., Miura, M., Aosaki, T., and Shirasawa, T. 2001. Deficiency of presenilin-1 increases calcium-dependent vulnerability of neurons to oxidative stress in vitro. J Neurochem 78:807-814. 79. Takahashi, M., Asaumi, S., Honda, S., Suzuki, Y., Nakai, D., Kuroyanagi, H., Shimizu, T., Honda, Y., and Shirasawa, T. 2001. Mouse coq7/clk-1 orthologue rescued slowed rhythmic behavior and extended life span of clk-1 longevity mutant in Caenorhabditis elegans. Biochem Biophys Res Commun 286:534-540. 80. Tomita, K., Saijo, K., Yamasaki, S., Iida, T., Nakatsu, F., Arase, H., Ohno, H.,Shirasawa, T., Kuriyama, T., O'Shea, J.J., et al. 2001. Cytokine-independent Jak3 activation upon T cell receptor (TCR) stimulation through direct association of Jak3 and the TCR complex. J Biol Chem 276:25378-25385. 81. Ikegami, T., Suzuki, Y., Shimizu, T., Isono, K., Koseki, H., and Shirasawa, T.2002. Model mice for tissue-specific deletion of the manganese superoxide dismutase (MnSOD) gene. Biochem Biophys Res Commun 296:729-736. 82. Ishigami, A., Fujita, T., Handa, S., Shirasawa, T., Koseki, H., Kitamura, T.,Enomoto, N., Sato, N., Shimosawa, T., and Maruyama, N. 2002. Senescence marker protein-30 knockout mouse liver is highly susceptible to tumor necrosis factor-alpha- and Fas-mediated apoptosis. Am J Pathol 161:1273-1281. 83. Morimoto, A., Irie, K., Murakami, K., Ohigashi, H., Shindo, M., Nagao, M., Shimizu, T., and Shirasawa, T. 2002. Aggregation and neurotoxicity of mutant amyloid beta (A beta) peptides with proline replacement: importance of turn formation at positions 22 and 23. Biochem Biophys Res Commun 295:306-311. 84. Morimoto, K., Shimizu, T., Furukawa, K., Morio, H., Kurosawa, H., and Shirasawa, T. 2002. Transgenic expression of the EXT2 gene in developing chondrocytes enhances the synthesis of heparan sulfate and bone formation in mice. Biochem Biophys Res Commun 292:999-1009. 85. Murakami, K., Irie, K., Morimoto, A., Ohigashi, H., Shindo, M., Nagao, M., Shimizu, T., and Shirasawa, T. 2002. Synthesis, aggregation, neurotoxicity, and secondary structure of various A beta 1-42 mutants of familial Alzheimer's disease at positions 21-23. Biochem Biophys Res Commun 294:5-10. 86. Odaka, C., Mizuochi, T., Shirasawa, T., Morain, P., and Checler, F. 2002. Murine T cells expressing high activity of prolyl endopeptidase are susceptible to activation-induced cell death. FEBS Lett 512:163-167. 87. Ogawara, M., Takahashi, M., Shimizu, T., Nakajima, M., Setoguchi, Y., and Shirasawa, T. 2002. Adenoviral expression of protein-Lisoaspartyl methyltransferase (PIMT) partially attenuates the biochemical changes in PIMT-deficient mice. J Neurosci Res 69:353-361. 88. Shimizu, T., Fukuda, H., Murayama, S., Izumiyama, N., and Shirasawa, T. 2002. Isoaspartate formation at position 23 of amyloid beta peptide enhanced fibril formation and deposited onto senile plaques and vascular amyloids in Alzheimer's disease. J Neurosci Res 70:451-461. 89. Shimizu, T., Ikegami, T., Ogawara, M., Suzuki, Y., Takahashi, M., Morio, H., and Shirasawa, T. 2002. Transgenic expression of the proteinL-isoaspartyl methyltransferase (PIMT) gene in the brain rescues mice from the fatal epilepsy of PIMT deficiency. J Neurosci Res 69:341-352. 90. Smith, C.D., Carson, M., Friedman, A.M., Skinner, M.M., Delucas, L., Chantalat, L., Weise, L., Shirasawa, T., and Chattopadhyay, D. 2002. Crystal structure of human L-isoaspartyl-O-methyl-transferase with Sadenosyl homocysteine at 1.6-A resolution and modeling of an isoaspartyl-containing peptide at the active site. Protein Sci 11:625-635. 91. Suzuki, Y., Shimizu, T., Sakai, H., Tamaki, M., Koizumi, K., Kuriyama, T.,Tsuchida, E., Koseki, H., and Shirasawa, T. 2002. Model mice for Presbyterian hemoglobinopathy (Asn(beta108)-->Lys) confer hemolytic anemia with altered oxygen affinity and instability of Hb. Biochem Biophys Res Commun 295:869-876. 92. Yuasa, S., Nakajima, M., Aizawa, H., Sahara, N., Koizumi, K., Sakai, T., Usami, M., Kobayashi, S., Kuroyanagi, H., Mori, H., et al. 2002. Impaired cell cycle control of neuronal precursor cells in the neocortical primordium of presenilin-1-deficient mice. J Neurosci Res 70:501-513. 93. Izumizaki, M., Tamaki, M., Suzuki, Y., Iwase, M., Shirasawa, T., Kimura, H., and Homma, I. 2003. The affinity of hemoglobin for oxygen affects ventilatory responses in mutant mice with Presbyterian hemoglobinopathy. Am J Physiol Regul Integr Comp Physiol 285:R747753. 94. Morio, H., Honda, Y., Toyoda, H., Nakajima, M., Kurosawa, H., and Shirasawa, T. 2003. EXT gene family member rib-2 is essential for embryonic development and heparan sulfate biosynthesis in Caenorhabditis elegans. Biochem Biophys Res Commun 301:317-323. 95. Murakami, K., Irie, K., Morimoto, A., Ohigashi, H., Shindo, M., Nagao, M., Shimizu, T., and Shirasawa, T. 2003. Neurotoxicity and physicochemical properties of Abeta mutant peptides from cerebral amyloid angiopathy: implication for the pathogenesis of cerebral amyloid angiopathy and Alzheimer's disease. J Biol Chem 278:4617946187. 96. Nakajima, M., Yuasa, S., Ueno, M., Takakura, N., Koseki, H., and Shirasawa, T. 2003. Abnormal blood vessel development in mice lacking presenilin-1. Mech Dev 120:657-667. 97. Shin, R.M., Masuda, M., Miura, M., Sano, H., Shirasawa, T., Song, W.J.,Kobayashi, K., and Aosaki, T. 2003. Dopamine D4 receptor-induced postsynaptic inhibition of GABAergic currents in mouse globus pallidus neurons. J Neurosci 23:11662-11672. 98. Shin, Y., Cho, H.S., Fukumoto, H., Shimizu, T., Shirasawa, T., Greenberg, S.M.,and Rebeck, G.W. 2003. Abeta species, including ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 149 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE IsoAsp23 Abeta, in Iowa-type familial cerebral amyloid angiopathy. Acta Neuropathol 105:252-258. 99. Shirasawa, T. 2003. [Longevity and genes]. Nippon Ronen Igakkai Zasshi 40:596-598. 100. Shirasawa, T., Izumizaki, M., Suzuki, Y., Ishihara, A., Shimizu, T., Tamaki, M.,Huang, F., Koizumi, K., Iwase, M., Sakai, H., et al. 2003. Oxygen affinity of hemoglobin regulates O2 consumption, metabolism, and physical activity. J Biol Chem 278:5035-5043. 101. Takahashi, T., Takahashi, K., St John, P.L., Fleming, P.A., Tomemori, T., Watanabe, T., Abrahamson, D.R., Drake, C.J., Shirasawa, T., and Daniel, T.O. 2003. A mutant receptor tyrosine phosphatase, CD148, causes defects in vascular development. Mol Cell Biol 23:1817-1831. 102. Morimoto, A., Irie, K., Murakami, K., Masuda, Y., Ohigashi, H., Nagao, M.,Fukuda, H., Shimizu, T., and Shirasawa, T. 2004. Analysis of the secondary structure of beta-amyloid (Abeta42) fibrils by systematic proline replacement. J Biol Chem 279:52781-52788. 103. Nakai, D., Shimizu, T., Nojiri, H., Uchiyama, S., Koike, H., Takahashi, M., Hirokawa, K., and Shirasawa, T. 2004. coq7/clk-1 regulates mitochondrial respiration and the generation of reactive oxygen species via coenzyme Q. Aging Cell 3:273-281. 104. Nakajima, M., Moriizumi, E., Koseki, H., and Shirasawa, T. 2004. Presenilin 1 is essential for cardiac morphogenesis. Dev Dyn 230:795799. 105. Nakajima, M., and Shirasawa, T. 2004. Presenilin-1-deficient neurons are nitric oxide-dependently killed by hydrogen peroxide in vitro. Neuroscience 125:563-568. 106. Baba, T., Shimizu, T., Suzuki, Y., Ogawara, M., Isono, K., Koseki, H., Kurosawa, H., and Shirasawa, T. 2005. Estrogen, insulin, and dietary signals cooperatively regulate longevity signals to enhance resistance to oxidative stress in mice. J Biol Chem 280:16417-16426. 107. Huang, F., Nojiri, H., Shimizu, T., and Shirasawa, T. 2005. Beneficial effect of transfusion with low-affinity red blood cells in endotoxemia. Transfusion 45:1785-1790. 108. Huang, F., Shimizu, T., Ishihara, A., Yuasa, S., Nishimura, K., Kugimiya, T., and Shirasawa, T. 2005. Tissue hyperoxygenation promotes oxidative metabolism in motor unit. J Neurosci Res 80:584-591. 109. Irie, K., Murakami, K., Masuda, Y., Morimoto, A., Ohigashi, H., Ohashi, R., Takegoshi, K., Nagao, M., Shimizu, T., and Shirasawa, T. 2005. Structure of beta-amyloid fibrils and its relevance to their neurotoxicity: implications for the pathogenesis of Alzheimer's disease. J Biosci Bioeng 99:437-447. 110. Masuda, Y., Irie, K., Murakami, K., Ohigashi, H., Ohashi, R., Takegoshi, K.,Shimizu, T., and Shirasawa, T. 2005. Verification of the turn at positions 22 and 23 of the beta-amyloid fibrils with Italian mutation using solid-state NMR. Bioorg Med Chem 13:6803-6809. 111. Murakami, K., Irie, K., Ohigashi, H., Hara, H., Nagao, M., Shimizu, T., and Shirasawa, T. 2005. Formation and stabilization model of the 42mer Abeta radical: implications for the long-lasting oxidative stress in Alzheimer's disease. J Am Chem Soc 127:15168-15174. 112. Shimizu, T., Matsuoka, Y., and Shirasawa, T. 2005. Biological significance of isoaspartate and its repair system. Biol Pharm Bull 28:1590-1596. 113. Uchiyama, S., Koike, H., Shimizu, T., and Shirasawa, T. 2005. A superoxide disumutase/catalase mimetic extends the lifespan of shortlived mev-1 mutant but not the wild type strain in Caenorhabditis elegans. Anti-Aging Med Res 2:39-47. 114. Imamura, Y., Noda, S., Hashizume, K., Shinoda, K., Yamaguchi, M., Uchiyama, S., Shimizu, T., Mizushima, Y., Shirasawa, T., and Tsubota, K. 2006. Drusen, choroidal neovascularization, and retinal pigment 150 epithelium dysfunction in SOD1-deficient mice: a model of age-related macular degeneration. Proc Natl Acad Sci U S A 103:11282-11287. 115. Misawa, H., Nakata, K., Matsuura, J., Moriwaki, Y., Kawashima, K., Shimizu, T., Shirasawa, T., and Takahashi, R. 2006. Conditional knockout of Mn superoxide dismutase in postnatal motor neurons reveals resistance to mitochondrial generated superoxide radicals. Neurobiol Dis 23:169-177. 116. Murakami, K., Namikawa, K., Shimizu, T., Shirasawa, T., Yoshida, S., and Kiyama, H. 2006. Nerve injury induces the expression of EXT2, a glycosyltransferase required for heparan sulfate synthesis. Neuroscience 141:1961-1969. 117. Nakajima, M., Ogawa, M., Shimoda, Y., Hiraoka, S., Iida, M., Koseki, H., Shirasawa, T., and Furukawa, K. 2006. Presenilin-1 controls the growth and differentiation of endothelial progenitor cells through its beta-catenin-binding region. Cell Biol Int 30:239-243. 118. Nakajima, M., Ogawa, M., Shimoda, Y., Koseki, H., Shirasawa, T., and Furukawa, K. 2006. Accelerated acquisition of permeability barrier function in the skin of presenilin-1-deficient embryos. Arch Dermatol Res 298:339-345. 119. Nojiri, H., Shimizu, T., Funakoshi, M., Yamaguchi, O., Zhou, H., Kawakami, S., Ohta, Y., Sami, M., Tachibana, T., Ishikawa, H., et al. 2006. Oxidative stress causes heart failure with impaired mitochondrial respiration. J Biol Chem 281:33789-33801. 120. Ogino, J., Sakurai, K., Yoshiwara, K., Suzuki, Y., Ishizuka, N., Seki, N., Koseki, H., Shirasawa, T., Hashimoto, N., Yagui, K., et al. 2006. Insulin resistance and increased pancreatic beta-cell proliferation in mice expressing a mutant insulin receptor (P1195L). J Endocrinol 190:739-747. 121. Sawabe, M., Saito, M., Naka, M., Kasahara, I., Saito, Y., Arai, T., Hamamatsu, A., and Shirasawa, T. 2006. Standard organ weights among elderly Japanese who died in hospital, including 50 centenarians. Pathol Int 56:315-323. 122. Shirasawa, T., and Shimizu, T. 2006. [Insulin-like signal regulating the life span of the animals]. Seikagaku 78:181-188. 123. Shirasawa, T., and Shimizu, T. 2006. Insulin-like signal regulating the lifespan ot the animals. Seikagaku 78:181-188. 124. Uchiyama, S., Shimizu, T., and Shirasawa, T. 2006. CuZn-SOD deficiency causes ApoB degradation and induces hepatic lipid accumulation by impaired lipoprotein secretion in mice. J Biol Chem 281:31713-31719. 125. Irie, K., Murakami, K., Masuda, Y., Morimoto, A., Ohigashi, H., Hara, H., Ohashi, R., Takegoshi, K., Fukuda, H., Nagao, M., et al. 2007. The toxic conformation of the 42-residue amyloid beta peptide and its relevance to oxidative stress in Alzheimer's disease. Mini Rev Med Chem 7:1001-1008. 126. Oda, K., Tanaka, N., Arai, T., Araki, J., Song, Y., Zhang, L., Kuchiba, A., Hosoi, T.,Shirasawa, T., Muramatsu, M., et al. 2007. Polymorphisms in pro- and anti-inflammatory cytokine genes and susceptibility to atherosclerosis: a pathological study of 1503 consecutive autopsy cases. Hum Mol Genet 16:592-599. 127. Hashizume, K., Hirasawa, M., Imamura, Y., Noda, S., Shimizu, T., Shinoda, K., Kurihara, T., Noda, K., Ozawa, Y., Ishida, S., et al. 2008. Retinal dysfunction and progressive retinal cell death in SOD1-deficient mice. Am J Pathol 172:1325-1331. 128. Ikeda, Y., Tsuji, S., Satoh, A., Ishikura, M., Shirasawa, T., and Shimizu, T. 2008. Protective effects of astaxanthin on 6hydroxydopamine-induced apoptosis in human neuroblastoma SH-SY5Y cells. J Neurochem 107:1730-1740. 129. Kim, J., Takahashi, M., Shimizu, T., Shirasawa, T., Kajita, M., Kanayama, A., and Miyamoto, Y. 2008. Effects of a potent antioxidant, ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE platinum nanoparticle, on the lifespan of Caenorhabditis elegans. Mech Ageing Dev 129:322-331. 130. Kosugi, S., Furuchi, T., Katane, M., Sekine, M., Shirasawa, T., and Homma, H. 2008. Suppression of protein l-isoaspartyl (d-aspartyl) methyltransferase results in hyperactivation of EGF-stimulated MEK-ERK signaling in cultured mammalian cells. Biochem Biophys Res Commun 371:22-27. 131. Masuda, Y., Nakanishi, A., Ohashi, R., Takegoshi, K., Shimizu, T., Shirasawa, T., and Irie, K. 2008. Verification of the intermolecular parallel beta-sheet in E22K-Abeta42 aggregates by solid-state NMR using rotational resonance: implications for the supramolecular arrangement of the toxic conformer of Abeta42. Biosci Biotechnol Biochem 72:21702175. 132. Masuda, Y., Uemura, S., Nakanishi, A., Ohashi, R., Takegoshi, K., Shimizu, T., Shirasawa, T., and Irie, K. 2008. Verification of the Cterminal intramolecular beta-sheet in Abeta42 aggregates using solidstate NMR: implications for potent neurotoxicity through the formation of radicals. Bioorg Med Chem Lett 18:3206-3210. 133. Murakami, K., Uno, M., Masuda, Y., Shimizu, T., Shirasawa, T., and Irie, K. 2008. Isomerization and/or racemization at Asp23 of Abeta42 do not increase its aggregative ability, neurotoxicity, and radical productivity in vitro. Biochem Biophys Res Commun 366:745-751. 134. Satoh, T., Izumi, M., Inukai, Y., Tsutsumi, Y., Nakayama, N., Kosaka, K., Shimojo,Y., Kitajima, C., Itoh, K., Yokoi, T., et al. 2008. Carnosic acid protects neuronal HT22 Cells through activation of the antioxidant-responsive element in free carboxylic acid- and catechol hydroxyl moieties-dependent manners. Neurosci Lett 434:260265. 135. Satoh, T., Kosaka, K., Itoh, K., Kobayashi, A., Yamamoto, M., Shimojo, Y.,Kitajima, C., Cui, J., Kamins, J., Okamoto, S., et al. 2008. Carnosic acid, a catechol-type electrophilic compound, protects neurons both in vitro and in vivo through activation of the Keap1/Nrf2 pathway via S-alkylation of targeted cysteines on Keap1. J Neurochem 104:11161131. 136. Shimizu, T., and Shirasawa, T. 2008. [The present and future of antiaging]. Gan To Kagaku Ryoho 35:1-5. 137. Takahashi, M., Shimizu, T., Moriizumi, E., and Shirasawa, T. 2008. Clk-1 deficiency induces apoptosis associated with mitochondrial dysfunction in mouse embryos. Mech Ageing Dev 129:291-298. 138. Watanabe, T., Takeda, T., Omiya, S., Hikoso, S., Yamaguchi, O., Nakano, Y.,Higuchi, Y., Nakai, A., Abe, Y., Aki-Jin, Y., et al. 2008. Reduction in hemoglobin-oxygen affinity results in the improvement of exercise capacity in mice with chronic heart failure. J Am Coll Cardiol 52:779-786. 139. Chiba, T., Kamei, Y., Shimizu, T., Shirasawa, T., Katsumata, A., Shiraishi, L.,Sugita, S., Ogawa, Y., Miura, S., and Ezaki, O. 2009. Overexpression of FOXO1 in skeletal muscle does not alter longevity in mice. Mech Ageing Dev 130:420-428. 140. Kawakami, S., Matsuda, A., Sunagawa, T., Noda, Y., Kaneko, T., Tahara, S., Hiraumi, Y., Adachi, S., Matsui, H., Ando, K., et al. 2009. Antioxidant, EUK-8, prevents murine dilated cardiomyopathy. Circ J 73:2125-2134. 141. Kosaka, K., Mimura, J., Itoh, K., Satoh, T., Shimojo, Y., Kitajima, C., Maruyama, A., Yamamoto, M., and Shirasawa, T. 2009. Role of Nrf2 and p62/ZIP in the Neurite Outgrowth by Carnosic Acid in PC12h Cells. J Biochem. 142. Kosaka, K., Mimura, J., Itoh, K., Satoh, T., Shimojo, Y., Kitajima, C., Maruyama, A., Yamamoto, M., and Shirasawa, T. 2009. Role of Nrf2 and p62/ZIP in the neurite outgrowth by carnosic acid in PC12h cells. J Biochem 147:73-81. 143. Lustgarten, M.S., Jang, Y.C., Liu, Y., Muller, F.L., Qi, W., Steinhelper, M., Brooks, S.V., Larkin, L., Shimizu, T., Shirasawa, T., et al. 2009. Conditional knockout of Mn-SOD targeted to type IIB skeletal muscle fibers increases oxidative stress and is sufficient to alter aerobic exercise capacity. Am J Physiol Cell Physiol 297:C1520-1532. 144. Masuda, Y., Uemura, S., Ohashi, R., Nakanishi, A., Takegoshi, K., Shimizu, T., Shirasawa, T., and Irie, K. 2009. Identification of physiological and toxic conformations in Abeta42 aggregates. Chembiochem 10:287-295. 145. Murakami, K., Inagaki, J., Saito, M., Ikeda, Y., Tsuda, C., Noda, Y., Kawakami, S., Shirasawa, T., and Shimizu, T. 2009. Skin atrophy in cytoplasmic SOD-deficient mice and its complete recovery using a vitamin C derivative. Biochem Biophys Res Commun 382:457-461. 146. Satoh, A., Tsuji, S., Okada, Y., Murakami, N., Urami, M., Nakagawa, K., Ishikura, M., Katagiri, M., Koga, Y., and Shirasawa, T. 2009. Preliminary Clinical Evaluation of Toxicity and Efficacy of A New Astaxanthin-rich Haematococcus pluvialis Extract. J Clin Biochem Nutr 44:280-284. 147. Shimizu, T., and Shirasawa, T. 2009. [Anti-aging effects by caloric restriction]. Nippon Rinsho 67:1366-1371. 148. Shimojo, Y., Kosaka, K., Noda, Y., Shimizu, T., and Shirasawa, T. 2009. Effect of rosmarinic acid in motor dysfunction and life span in a mouse model of familial amyotrophic lateral sclerosis. J Neurosci Res. 149. Shirasawa, T. 2009. [Caloric restriction and anti-aging]. Nippon Ronen Igakkai Zasshi 46:222-224. 150. Kinouchi, T., Matsuda, A., Kawakami, S., Shimizu, T., Shirasawa, T., and Fujii, N. 2010. Influence of oxidative stress on D-aspartyl endopeptidase activity. Chem Biodivers 7:1398-1402. 151. Kuwahara, H., Horie, T., Ishikawa, S., Tsuda, C., Kawakami, S., Noda, Y., Kaneko, T., Tahara, S., Tachibana, T., Okabe, M., et al. 2010. Oxidative stress in skeletal muscle causes severe disturbance of exercise activity without muscle atrophy. Free Radic Biol Med 48:1252-1262. 152. Murakami, K., Masuda, Y., Shirasawa, T., Shimizu, T., and Irie, K. 2010. The turn formation at positions 22 and 23 in the 42-mer amyloid beta peptide: the emerging role in the pathogenesis of Alzheimer's disease. Geriatr Gerontol Int 10 Suppl 1:S169-179. 153. Shimizu, T., Nojiri, H., Kawakami, S., Uchiyama, S., and Shirasawa, T. 2010. Model mice for tissue-specific deletion of the manganese superoxide dismutase gene. Geriatr Gerontol Int 10 Suppl 1:S70-79. 154. Shimizu, T., and Shirasawa, T. 2010. [Anti-aging research using MnSOD conditional knockout mice]. Yakugaku Zasshi 130:19-24. 155. Shimojo, Y., Kosaka, K., and Shirasawa, T. 2010. Effect of Ganoderma lucidum extract on adipocyte differentiation and adiponectin gene expression in the murine pre-adipocyte cell line, 3T3-L1. Phytother Res. 156. Shirasawa, T. 2010. [Aging theory and aging control]. Nippon Ronen Igakkai Zasshi 47:24-27. 157. Sunagawa, T., Shimizu, T., Kanda, T., Tagashira, M., Sami, M., and Shirasawa, T. 2010. Procyanidins from Apples (Malus pumila Mill.) Extend the Lifespan of Caenorhabditis elegans. Planta Med. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 151 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE LES NOMS DES VARIÉTÉS DE LA FLORE NORD-AFRICAINE EN TAMAZIGHT,ARABE, FRANÇAIS ET LATIN Par Ourida AIT ALI, Journaliste au mensuel Santé Maget au quotidien Midi Libre Ceci se veut un petit lexique ou une mini base de données des principales espèces végétales présentes en Kabylie, à travers le territoire national voire au-delà. Les noms de ces plantes sont donnés en kabyle, en arabe, en français et le nom scientifique. Les vertus médicinales y afférentes sont tirées du dictionnaire Larousse des plantes médicinales et puisées également par moment dans la pratique autochtone. Nom Kabyle: Avucic Nom arabe: سِ نديان َبلّوط Nom Français: chêne liège Nom latin: Quercus suber Arbre très présent en Kabylie dont sont principalement formées les forêts en basse et moyenne altitude. Arbre très vivace repousse sans difficulté après la coupe résiste aux incendies grâce à sa couche de liège. il est d'ailleurs exploité pour son liège que l'office des forêt vient prélever tous les 9 ans (temps nécessaire pour la constitution de la couche de liège). Feuillage : persistant, feuilles, dessus luisant, dessous blanchâtre à bord lisse ou denté Floraison : printemps puis fruits oblongs (gland). Hauteur : 8 à 15 m étalements identiques Plantation : automne, hiver ou printemps. Origine : pourtour méditerranéen (Espagne, France, Algérie Tunisie ...) Le liège est l‟écorce du chêne-liège, il n‟y a donc aucun abattage d‟arbre, ce qui fait du liège le matériau écologique par nature. Selon une étude menée par le WWF en 2006 "à chaque récolte de liège, l‟écorce se régénère. Un chêne-liège stocke du CO2 pour se régénérer, par conséquent, un chêne liège levé en absorbe 3 à 5 fois plus que celui qui n‟est pas levé, ce qui profite à l‟atmosphère." 152 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Nom kabyle : tazemurt Nom olivier : Olivier َّ ش َج َ Nom arabe رالز ْيتونن Nom latin : Oleaeuropaea L. variété Acemlal en kabylie Arbre symbolique en Kabylie qui jouit de toutes les attentions et l'estime. Il est centenaire à l'enracinement très ramifié, au tronc tortueux, à l'écorce grise et lisse se fissurant avec l'âge, il émet des souchets (rejets basaux). Port : érigé, cime arrondie qui en vieillissant prend une forme étalée. Feuillage : persistant, coriace, glauque, vert grisâtre sur le dessus au revers pubescent d'un gris-argenté. Petites feuilles simples, opposées, ovales-lancéolées à nervure saillante et courtement pétiolées. Plantation : à l'automne ou au printemps en prenant soin de bien choisir son emplacement, patienter environ 7 ans pour qu'il devienne productif et ce durant 150ans.L'olivier est utilisé en phytothérapie pour ses propriétés diurétiques (augmente l'excrétion urinaire), son action (légère) d'antihypertenseur (il permet de baisser la tension artérielle), son action légèrement antidiabétique et ses propriétés anti-oxydantes.Selon l'Agence européenne des médicaments (EMA), l'olivier est reconnu pour son usage traditionnel dans l'élimination rénale de l'eau en cas de rétention d'eau légère, après élimination d'une cause médicale sous-jacente. L'olivier est inscrit à la Pharmacopée française. Nom kabyle : Azebuj Nom français : Olivier sauvage Nom arabe الزيتونالبري Nom latin :Oleaeuropaea var. sylvestris Taille : 2 à 10 mètres, à rameaux d'un blanc grisâtre. Arbuste très rustique et adapté il est fréquent dans les forêts claires et les maquis en Kabylie et au nord de l'Algérie en général, avec le chêne liège (Avucic) il constitue l'essentiel du couvert végétal en Kabylie. Il se distingue de l'olivier par ces feuilles persistantes toute l'année, plus petites moins longues et de couleur plus foncée et de part ces olives plus petites. On se sert de son tronc plus rustique, pour y greffer des boutures d'olivier afin d'obtenir des oliviers plus résistants. Nom kabyle : Aslen Nom français : Frêne commun ou Grand frêne. Nom arabe : رّ ماد Nom latin : Fraxinusexcelsior Encore un arbre très utile et connu en Kabylie le frêne (Aslen) quand il n'y avait plus rien c'est ce qu'on donnait a mangéaux bétails ... on le trouve en ornement le long des routes en Kabylie ... et dans les villages kabyles. Le Frêne est un bel arbre qui peut vivre 200 ans et qui est bien connu des ébénistes pour la qualité de son bois . Nom kabyle : taneqlets(fruit Lexrif ou tivexcicin) Nom français : Figuier (fruits : figue) Nom arabe َش َش ررُةتي ٍني Nom latin : Ficus carica Type de feuillage: caducMéthode de multiplication: semis au printemps, bouturage facile en septembre de rameaux de 30 cm, marcottage Taille: en plein cœur de l'hiver janvier- février Espèces, variétés intéressantes: Le genre comprend plus de 800 espèces. La figue est nutritive et laxative, pour cela, elle est recommandée aux personnes qui souffrent de constipation. Ce sont les graines de la figue qui déclenchent l'action laxative. La figue a une action importante au niveau du tube digestif, en le débarrassant des mucosités encombrantes et en permettant de lutter contre les fermentations intestinales. Nom kabyle : Akermous Nom commun : Le Figuier de Barbarie Nom arabe ّار َش ْتت ُةلال َّص لب ِر Nom latin : Opuntia ficus-indica ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 153 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Le Figuier de Barbarie (Opuntia ficus-indica), est une espèce de plante de la famille des cactacées, originaire du Mexique, qui s'est naturalisée dans d'autres continents, notamment le pourtour méditerranéen et en Afrique du Sud. Il produit un fruit comestible appelé figue de Barbarie. La figue de Barbarie, récoltée au Maroc, est un fruit précieux : il faut près d'une tonne de figues pour obtenir 1 litre d'huile de ce cactus. Obtenue par pression à froid des graines, elle est 100 % biologique. Elle regorge de vitamine E antioxydante et d'acides gras essentiels qui nourrissent en profondeur et tonifient la peau. Elle atténue les cicatrices, les boutons d'acné et diminue les vergetures. Surtout, elle convient à tous types de peaux, grasse, sèche ou mixte. L'huile de cactus offre une extraordinaire cure de jouvence à votre peau. Elle fait barrage au vieillissement cutané et booste le renouvellement cellulaire. Résultat, elle diminue les rides, s'attaque aux cernes disgracieuses et offre une protection contre les agressions quotidiennes de la peau. Super adaptable, l'huile est également recommandée pour revitaliser les cheveux. Elle les nourrit et les rend plus brillants. Nom kabyle : Ouzzu Nom commun : Genêt ّ Nom arabe وزال Nom latin: Cytisus scoparius Arbuste ou arbrisseau assez ramifié, à l'écorce gris jaunâtre fissurée aux rameaux verts et aux racines pourvues de nodosités.Floraison : abondante fin du printemps à début de l'été printemps. En partie terminale, grandes fleurs papilionacées axillaires hermaphrodites solitairesCouleur : jaune d'or brillant, il existe des variétés ou cv. Rouges ou roses.Fruits : siliques aplaties, noires s'ouvrant à la fin de l'été au moins choc en claquant, projetant les graines au loin. Plantation : automne ou printemps.Origine : Afrique du Nord, Europe centrale (jusqu'en Ukraine) et occidentale en plaine ou en basse montagne jusqu'à 800m d'altitude, dans les stations sèches, 154 Nom kabyle : Tidekt Nom français : Lentisque, Pistachier lentisque, Arbre à mastic, ُّ Nom Arabe بيتالز اج )مع وي; َشمعْت ونللِر َشت ْتث Nom latin : Pistacialentiscus Tidektest un arbuste tellement abondant qu'il a donné son nom à tout un écosystème végétal qu'est le maquis qui se dit en kabyle ; Amadagh en effet les maquis et les forêts en Kabylie et méditerranéenne en général abondent de cet arbuste. Feuillage : aromatique, persistant, vert franc Floraison : fin du printemps, peu intéressant. Fruits : petites drupes contenant une graine qui est comestible. Son bois est utilisé en ébénisterie. De ses branches et de son tronc exsudent naturellement ou par incision une résine jaune claire fortement aromatique. Cet arbuste est intéressant pour son feuillage, la sève est utilisée en cosmétique. Il purifie l'haleine, blanchie les dents et traite les problèmes de gencives. De ses feuilles et de ses rameaux est extraite une huile essentielle qui est utilisée en aromathérapie et phytothérapie pour ses propriétés décongestionnantes, prescrite aussi pour traiter les problèmes veineux dont les hémorroïdes.De son amande petite mais comestible est extraite une huile qui autrefois était couramment utilisée pour l'alimentation et elle entrait aussi dans la confection du savon. Nom Kabyle : Chilmun Nom français : Myrte َشن َشب ُة Nom arabe :ورائ َشِرحلعِر ْتط ِرريَّصل اتذ َش Nom latin : Myrtuscommunis Feuillage : persistant, coriace, aromatique vert clair à vert sombre, brillant. Floraison : en été (juin à août), fleurs blanches parfumées, mellifères. Fruit : petites baies comestibles ovoïdes, d'un noir bleuté à maturité, elles sont recherchées par les oiseaux (grives, merles). Consacré à Aphrodite en Grèce ancienne, la ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Myrte fut utilisée très tôt par les médecins et guérisseurs de l'antiquité, qu'ils soient Egyptiens, Grecs ou Romains. Les baies, séchées puis concassées, étaient également employées comme substitut au poivre, onéreux à l'époque. C'est aussi un très bon désinfectant atmosphérique qui peut être associé à l'H.E de Pin et de Géranium en diffusion pour purifier l'air. Nom Latin : Hedysarum coronarium . Non arabe : اسپرس Noms communs : Sainfoin Nom : kabyle : tasulla Tasulla est tout comme taghediwt (guernina) l'une des nombreuses plantes sauvages vers lesquelles les milieux paysans kabyles se sont rabattus durant les périodes de grandes misère au XIX et XX ème siècle. C‟est une plante très connue en Kabylie qui se consomme aussi bien crue que cuite comme un légume. Même si maintenant les conditions de vie se sont améliorées certains ne manquent pas l'occasion d'en éplucher et grignoter une tige de temps à autre quand il la trouve sur leur passage en période de printemps. Nom kabyle : Asisnu Nom français :Arbousier Nom arabe : نبك لموسحل Nom latin : Arbutusunedo L‟arbousier donne des fruits comestibles, de couleurs jaune ou orange ; qui s‟installent en masse compactes sur les branches. Ses fruits comptent parmi les plus nutritifs et vitaminés de tout le règne végétal.Ils sont consommés depuis des siècles en Europe et en Asie. Les feuilles sont utilisées en décoction.Nos grands-mères cependant recommandent de ne pas abuser de ce fruit car l'excès cause des troubles nerveux et des vertiges. Le potentiel médicinal de l‟argousier serait plus large : « Sa concentration en vitamine C est 30 fois supérieure à celle de l‟orange. Sa teneur en vitamine E est plus élevée que celle du blé ou du soja, en outre c‟est une importante source antioxydants 93.6%. Actuellement, l‟argousier attire l‟attention de nombreux chercheurs à travers le monde ; principalement pour ses valeurs nutritives et médicinales. Nom kabyle : Ililli Nom français : Laurier rose Nom arabe arabe 'Ed dafla. Nom latin : Nerosoleander Arbuste ou arbrisseau à l'écorce lisse et grisâtre, Feuillage : persistant, coriace. Floraison : abondante du printemps à automne (mai à octobre selon le climat), parfumée pour certaines variétés son parfum est plus prononcé la nuit. Origine : Afrique du nord au bord des oueds (cours d'eau), Asie (Inde, sud-est de la Chine dans la province du Yunnan), Moyen-Orient (Palestine, Syrie). Le laurier-rose, très répandu dans les régions méditerranéennes, doit son nom latin à un mot d'origine grecque, neros, qui signifie « humide»; en effet, cet arbuste aux feuilles persistantes, se développe volontiers sur les rives des fleuves ou des torrents. Cette plante possède de trèsbellespétales mais prudence car elle est toxique Nom kabyle : Averwaq Nom français : Asphodèle à petits fruits Nom arabe "El-Berouag" d'où le nom de la région Berrouaghia due à l'abondance de cette plante; Nom latin : Asphodelusramosus Plantation: à l'automne et au printemps. Emplacement: ensoleillée, chaud et sec. Fruits: capsules globuleuses ocre-orangé à maturité contenant des graines oléagineuses comestibles. L'Asphodèle a la propriété de résister au feu. Sa racine tubéreuse contient de l'amidon. Autrefois c'était un aliment recherché qu'on mélangeait à des figues ou qu'on utilisait dans la panification. Les tiges séchées servaient de fourrage et s'utilisaient pour la confection d'objets. Les Grecs et les Romains le considéraient comme une plante magique. Ils croyaient qu'il guérissait les morsures de serpent et les maladies de la femme. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 155 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Mahmoud AROUA Dr. Brahim BABA In Memorium of Dr Brahim BABA 11/03/2008 11/03/2014 Dr. Ilyès BAGHLI [email protected] Dr. Tahar NAILI [email protected] C1 / C2 C1 / C2 Bulletin ORTHO 2 pages Bulletin ORTHO 2 page 6. Discours d'Ouverture du Cycle4. Impact sociologique de la de Formation en Nutrition et ennutrition et de la médecine Médecine Orthomoléculaire orthomoléculaire sur la 32.: Diététique et Groupage société future. Sanguin 61. Le Stress Oxydatif Bulletin ORTHO 3 Pages Bulletin ORTHO 3 Pages 4-6 DISCOURS DřOUVERTURE 26DES 2EME ET 3EME SEMINAIRE 31 Présentation INDICATI DE FORMATION CONTINUE ONS ORTHO 14- 22 Présentation MOLECULAIRES EN COMPLEMENTS DERMATO LOGIE Dr. NUTRITIONNELS Monika FUCHS Ŕ Dr. Sabine WIED-BAUMGARTNER 32 -34 COMPTES-RENDUS 23Ŕ25 Présentation ET ACTES DU 41ème CONG LES OLIGO-ELEMENTS Dr. RES INTERNATIO-NAL DE Monika FUCHS - Ttraduit par Mme MEDECINE ORTHO-MOLE Salma AZZI-DOUDOU – CULAIRE VANCOUVER 2752- DISCOURS DřOUVERTURE 29 AVRIL 2012 DU 4EME SEMINAIRE DE 35-38 Présentation Dr. FORMATION CONTINUE Atsuo YANAGISAWA, Dr. 70-79 Présentation Jognatan WRIGHT et Dr. LES ACIDES AMINES Alan GABY, Dr. Gert Dr. Heidi THOMASBERGER SCHUITEMAKER, Dr. Erik T. Bulletin ORTHO 4 PATERSON page 9 DISCOURS 90- CANADA PAYS DES DřOUVERTURE DU DEFIS POUR LES MEDE CI 5EME SEMINAIRE DE NES COMPLE MENTAIRES FORMATION CONTINUE Bulletin ORTHO 5 page Bulletin ORTHO 5 page 16-17 CANCER, MIEUX 9 L'approche préventive du Dr COM PRENDRE POUR AtusoYANAGISAWA MIEUX AFFRONTER Linus PAULING, lauréat Prix 67-68 De Vancouver à Alger Nobel de Chimie 1954 et Prix et Discours de Présentation Nobel de la Paix 1962 du Pr. Atsuo YANAGISAWA 14-15 « 2 g jour de vitamine C Bulletin ORTHO 6 pages : pour éviter les effets d'une 59-60 REGGANE: grippe sévère » Une cicatrice indélébile Bulletin ORTHO 6 pages : Bulletin ORTHO 11 pages : LE PROTOCOLE DE 24 Dr Mathias RATH RIORDAN APPLIQUE A Bulletin ORTHO 11 pages : L'ALGERIE. The Riordan 171-172 L'expérience de la Algieria's Protocol1 SANMO dans l'édition Bulletin ORTHO12 p, scientifique 175 INTERVENTION Dr Bulletin ORTHO12 p, Tahar NAILI AU CONGRES 136 DE HIROSHIMA À ISOM VANCOUVER 2014 HAMOUDIA ! DU JAPON À L'ALGÉRIE POUR DES RECOMMANDATIONS VIS À VIS DES RADIATIONS NUCLÉAIRES ! Dr Toufik SAADOUN [email protected] C1 / C2 Bulletin ORTHO 2 page 24. Une algérienne nommée TBIKHA Bulletin ORTHO 3 Pages 80-81 Présentation LA DYSBIOSE INTESTINALE Dr Heidi THOMASBERGER 83Présentation CYTOC HROME P450 Dr Heidi THOMASBERGER Bulletin ORTHO 5 Pages 127-130 ALIMENTATION DURANT LA PERIODE PREHISTORIQUE Dr Toufik HENTABLI [email protected] C1 / C2 Bulletin ORTHO 2 page 60. Rééducation fonctionnelle et bonne hydratation Dr Abdelkrim TAFAT-BOUZID [email protected] Dr. Chérif HAMADOUCHE C1-S1,S4,S5,S6 / C2-S3, Bulletin ORTHO 2 p. 56. Entérocolite allergique, un diagnostic difficile. BULLETIN ORTHO 4 P.154-155 THYM C1 – C2 Bulletin ORTHO 2 page 59. Vitamine C Bulletin ORTHO 3 pages 82Présentation LřHOMOCYST EINE Dr. Monika FUCHS 156 122 Rue Belouizdad ALGER 16000 C1-S1,S2+3,S4,S5,S6 C2-S2,S3,S5, ORTHO 2 p. 21-22 Remèdes et Mesures Hygiénodiététiques pour le cœur à travers les œuvres dřIBNSINA ORTHO 3 p. 115-120 Les Régimes Alimentaires dans la Médecine Arabe dřaprès le Poème de la Médecine dřIbn Sina ORTHO 7 p.114-117 De la médecine en géneral, et de la diététique en particulier, chez Abu Bakr AL-RAZI ORTHO 9 p.128-131 Le Cancer dans la Médecine Arabe ORTHO 10 pages 132-146 IBN HAMADUSH AL-JAZAIRI et son Traité Médical KASHF AL-RUMUZ [email protected] C1 / C2 Bulletin ORTHO 2 page 25 Centre MédicoPédagogique de Djelfa Dr Abdelhamid BENCHARIF [email protected] Dr Sofiane TAKHRIST. [email protected] Dr Larbi DJAKRIR [email protected] C1 / C2 Bulletin ORTHO 2 page 28. Environnement et Santé Bulletin ORTHO 3 pages 8490 Présentation MAGNESIUM Dr Heidi THOMASBERGER Dr Abdellah KESSI [email protected] C1 / C2 Bulletin ORTHO 2 page 58. Lřinsulinoresistance. ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ C1 Bulletin ORTHO 6 p. 61-72 LES PROBIOTIQUES C1 / C2-S3,S4,S5 Bulletin ORTHO 2 page 70. Alimentation postopératoire précoce en chirurgie abdominale.. Mohamed MAROUF ARIBI [email protected] DR SMAIL BOUKERRAS Dr. Ali ASBAI [email protected] [email protected] C1 / C2 Bulletin ORTHO 2 page 51. L'obésité chez l'enfant et l'adolescent C2S1-C2S2-C2S3-C2S4C2S5 Bulletin ORTHO 10 pages : 103-120 Intolérance au Gluten Maladie Cœliaque Bulletin ORTHO 8 pages : 154-170 Aspect toxicologique des additifs alimentaires, cas de Lřaspartame (E951) Bulletin ORTHO 7 pages : 118 LA SPIRULINE ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Dr. Sidi Mohammed MOSTEFA [email protected] C1S1-C1S2+3-C1S4-C1S5Amin GASMI C1S6 [email protected] Bulletin ORTHO 2 page 23. C1S2+3, C1S4, C1S5, C1S6 Nutrition et maladie ; C2S1 ?C2S2 Nutrithérapie en Médecine Bulletin ORTHO 4 pages : Générale ; Des bilans de Traduction et présentation santé innovants en des articles du Dr. Heidi Médecine Orthomoléculaire THOMASBERGER Bulletin ORTHO 3 pages : 45-63 DIABETE ET 123-30 PRISE EN CHARGE SYNDROME METABOLIQUE DU DIABETE EN MEDECINE 64-68 BURN OUT ORTHO MOLECULAIRE 68-71 MALADIES DES YEUX 138-140 UN LEGUME DANS 72-73 LES INFECTIONS LE TRAITEMENT DU RECIDIVANTES DIABETE ET DE 74-78 POLYARTHRITE LřHYPERTENSION RUMATHOIDE ARTERIELLE 79-84 OSTEOPOROSE « LřAUBERGINE » 131-140 IMPACT DE LA Bulletin ORTHO 4 SUPPLEMENTAION EN pages : 141-145 DATTES CREATINE MONOHYDRATE ET MEDECINE SUR LřAMELIORATION DE 156-158 LES BIENFAITS DU LA QUALITE DE FORCE MIEL MAXIMALE CHEZ LES Bulletin ORTHO 5 pages PRATIQUANTS DES 122-124 Le COENZYME Q10 SPORTS DE (CoQ10) MUSCULATION. 124-126 IMPACT DE LA Bulletin ORTHO 5 pages VITAMINE C SUR LA Traduction et présentation PROTEINE C réactive des articles Bulletin ORTHO 7 pages : 22-29 ENZYMES - Dr Heïdi 158 LE JEÛNE THOMASBERGER THERAPEUTIQUE 30-34 THERAPIE INTRAVEINEUSE - Dr Heïdi THOMASBERGER 35-42 DIAGNOSTICS DES MICRONUTRIMENTS - Dr Monika FUCHS 43-53 HORMONES - Dr Dr Abdelkrim DJERRAD Heïdi THOMASBERGER 54-56 TABLEAU DES [email protected] INTERACTIONS - Dr Sabine Bulletin ORTHO 11 pages WIED-BAUMGARTNER 167-170 Le Navet 57-59 PARODONTITE - Dr Heïdi THOMASBERGER Bulletin ORTHO 10 pages 87-97 Effet de Vingt Jours de Supplémentation en Vit.C sur le Rendement Physique des Taekwondistes Masculins de Haut Niveau Dr Hocine AROUA [email protected] C1S2+3,C1S4,C1S5,C1S6 C2S5 Bulletin ORTHO 3 pages : 131-133THÉ VERT Bulletin ORTHO 4 pages 147-149 HUILE DřOLIVE 150-153 CURCUMA Bulletin ORTHO 6 pages : 120-123 ANTIOXYDANTS Dr Missoum FERHAT Dr Slimane ADDAR [email protected] C1S2+3, C1S4, C1S6 C2S1, C2S2, C2S3, C2S4, C2S5, Bulletin ORTHO 6 pages : 112-114 LA LUTTE ANTIDOPAGE [email protected] C1S4, C1S5, C2S3, C2S4, Bulletin ORTHO 8 pages : 146-149 La Truffe* Dr. Lotfi RAHAL [email protected] Nor-Eddine BENYOUB [email protected] C1S2+3, C1S5, C1S6, C2S1, Bulletin ORTHO 6 pages : 86-92 NUTRITION: LřOBESITE, PATHOLOGIE DU SIECLE DR TEWFIK BENHADJI-SERRADJ [email protected] C1 Bulletin ORTHO 6 pages : 93 Besoin théorique en calories chez un adulte jeune C2S1,C2S5 Bulletin ORTHO 9 p : 114-120 ACTIVITE PHYSIQUE ET DIABETE Bulletin ORTHO 11 p Bulletin ORTHO 12 p 117 La prise en charge nutritionnelle des Stéatopathies hépatiques non alcoolique (métaboliques) Med Rachad BOUMOKOHLA [email protected] +213550 11 60 38 C2S2,C2S3,C2S4,C2S5,C3S1 Bulletin ORTHO 10 p : 126-129 Comportement Alimentaire et Hopital Bulletin ORTHO12 p, 124 Hygiène de vie dřune gastrectomie Dr Zineb Nesrine BEKKARA [email protected] C1S1-1S2-C1S3-C2S5 Bulletin ORTHO 2 page 69. Le Romarin. Mlle Haféda GHORZI : [email protected] C1S2+3, C1S5, C2S1, C2S4, Bulletin ORTHO 3 pages 9298 LA SUPPLEMENTATION DU REGIME HYPERLIDIQUE (CAFETERIA) EN LřHUILE DE LIN REDUIT LA PRISE DE POIDS ET AMELIORE LA GLYCEMIE ET LE PROFIL LIPIDIQUE CHEZ LES RATS FEMELLES WISTAR Mlle Leila HOCINE [email protected] C1S2+3, C1S5, C2S1, Bulletin ORTHO 3 pages 99103 ALTERATIONS METABOLIQUES CHEZ LA PROGENITURE DE RATES OBESES NOURRIES AU REGIME CAFETERIA [email protected] DR M OHAM ED BILLAMI [email protected] C1S2+3, C1S4,C1S5, C1S6 C2S1 C2S3 C2S4 C2S5 Bulletin ORTHO 6 pages : 124-132 Le POLLEN C1S2+3, C1S4, C1S5, C1S6, C2S1, Bulletin ORTHO 6 pages : 115-119 Le SON de blé : Apport en fibres et Bienfaits Dr Aicha TAYAR [email protected] C1 Bulletin ORTHO 2 page 41. Les déséquilibres nutritionnels - maladies auto-immunes et apport de la micro-nutrition Ŕ Bulletin ORTHO 6 pages : 94-103 LES VITAMINES EN PREVENTION DR.MALIKA BENHAFSI-ENBOUZID BEN H AF S I.M AL IK A@H OT M AIL .F R C1 - C2S5 Bulletin ORTHO 2 page 65. La Grenade DR. DAHBIA SOUCI M AHIDDINE Dr. Abdallah DIB C1S6, C2S1, C2S2, C2S3, C2S4, C2S5, Bulletin ORTHO 7 pages : 145 LA FIGUE ET LřOLIVIER 146 LA CHICOREE SAUVAGE 147 LřEAU CřEST LA VIE Dr Nacima CHILA [email protected] Dr. Halima GASMI [email protected] C1S2+3, C1S4, C1S5, C1S6, C2S1, BULLETIN ORTHO 4 PAGES: 128-131 HYPOGLYCEMIE ET DESEQUILIBRE MICRONUTRITION NEL A PROPOS D‟UN CAS ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ Dr Sabah SALHI GUENANE [email protected] C1S1, C1S2+3, C1S5, C1S6, C1S6, C2S2 Bulletin ORTHO 2 page 33. Alimentation et groupes sanguins [email protected] C1S1, C1S2+3,C1S4,C1S5, C1S6, C2S1 Bulletin ORTHO 2 page 54. Obésité Bulletin ORTHO 3 pages : 91- VITAMINE C ET TRAITEMENT DU CANCER 134-136 HUILE DE GRAINES DE LIN 137- LE KEFIR, LA BOISSON AUX MILLES VERTUS… Bulletin ORTHO 5 pages : 117 Polyphenols et Sante 157 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Mlle Sakina Cylia LATEB [email protected] C1S1,C1S6,C2S3 Dr Samia BOUSBIA-MESSIKH [email protected] Dr. Latifa KHEMAR [email protected] C1S2+3, C1S4, C1S5, C1S6, C2S1 Bulletin ORTHO 5 pages : 111-116 Effet anti-Obésite de lřHuile « Citrullus Colocynthis» chez la progéniture de rats obeses Dr Souad HAMADI [email protected] C1S2+3, C1S4, C1S6, C2S1, C2S4, Bulletin ORTHO 5 pages : 118-121 LřARTICHAUT ET Dr Lynda KACI-MEZIANI [email protected] C1S2+3, C1S4, C1S5,C1S6 C2S1, C2S2, C2S3, C2S5 Bulletin ORTHO 6 pages : 133-135 Lř HIBISCUS Dr Naima MOULAY-BEY [email protected] C1S6, C2S2, C2S3, C2S4, Bulletin ORTHO 6 pages : 104-111 La VITAMINE A Bulletin ORTHO 7 pages : 141 LES ALLERGIES C2S4,C2S5 BULLETIN ORTHO 9 PAGES : 103-107 PREVENTION DES MALFORMATION S DU TUBE NEURAL PAR LA PRISE D'ACIDE FOLIQUE HAYET ZITOUN [email protected] C1S6, C2S1, C2S2, C2S4, Bulletin ORTHO 9 pages : 95-102 LES FRUITS OUBLIES DU CAROUBIER Dr Hafida ZOUBIR [email protected] Cité 50logts lot n23 OULED FAYET ALGER16102 C1S6,C2S1,C2S2,C2S3, C2S4, Bulletin ORTHO 10 p. 121-125 Le SON dřAvoine Dr Nabila OUMEDJKANE [email protected] Bulletin ORTHO11 p, La baie de Goji :Un trésor de la nature Bulletin ORTHO 2 page 13. Nutrition et orthomolécu laire, nouvelle approche médicale en débat à Alger 37. Approches nutrition nelles des troubles pédopsychiatriques chez l'enfant autiste: intérêts d'évaluer l'impact de la nutrition sur les troubles envahissants du développement. Bulletin ORTHO 3 pages : 121-122 ENQUETES SUR LES BOISSONS SUCREES ET LEURS EFFETS NEFASTES SUR LřORGANISME- DANGERS LIES A LA SURCONSOM MATION DE SODAS Bulletin ORTHO 5 pages : 11 Cancer : des spécialistes préconisent lřutilisation de la vitamine C par intraveineuse in APS SES BIENFAITS DEPURATIFS Bulletin ORTHO 6 pages : 73-85 LE MAGNESIUM : SOURCES, ROLES ET METABOLISMES Dr Assia GHEMATTI [email protected] C1 Ŕ C2S4 Dr Amina LAGGOUN-BOURADA. Bulletin ORTHO 9 pages [email protected]. 108-113 LřALOE VERA OU C1S2+3, C1S4, C1S5, C1S6 LA PLANTE MEDECIN C2S2, C2S3, C2S4 Dr Djamila Leila BENAZZA [email protected] C1- C2S5 Bulletin ORTHO 2 page 63. Stevia Bulletin ORTHO 7 pages : 156 LřEUCALYPTUS 158 [email protected] C2S4, C2S5, C1S6, C2S1, C2S2, C2S3, C2S4, C2S5, Bulletin ORTHO 9 pages 121 LE POLICOSANOL Bulletin ORTHO 7 pages : 153 LE FIGUIER DE BARBARIE Bulletin ORTHO 2 page 53. Les Protéines animales Dr Fadila Djazia AIT OUAZOU [email protected] C1 – C2S1 Bulletin ORTHO 6 pages : 136-140 La FIGUE Fruit Béni et Millénaire Dr. Zohra SIDENNAS [email protected] Bulletin ORTHO12 p, 129 RHODIOLA ROSEA OU LA RACINE DřOR Bulletin ORTHO 4 pages : 4. De nouvelles approches thérapeutiques 6. Les vérités du Pr. George BIRKMAYER à propos du NADH Bulletin ORTHO 5 pages : 7- 8 DR . ATS U O Y A NA GI SA WA - L A V IT A MI NE C, N O UVE LLE A PP R OC HE T HE RA PE UTI Q UE P OU R L E CA NC ER 10 CO R RE CTI ON D U D EF IC IT DE L 'E NZY ME L GU LONO -L AC TONE OX YD ASE . 12-13 LE P R ATS U O Y A NA GI SA WA P RE SI DE NT DE L 'I SOM E T DE LA JCIT Bulletin ORTHO 6 pages : 5-6 Interview Pr. George BIRKMAYER 25-27 Interview Pr. Hafida MERZOUK Bulletin ORTHO 9 pages 123 Anamnèse du patient en Tamazight 124 Les Plantes en Fr et Tamazight 127 EPICES Fr Ar Tmz Bulletin ORTHO12 p, 152 LES NOMS DES VARIÉTÉS DE LA FLORE NORD-AFRICAINE EN TAMAZIGHT,ARABE, FRANÇAIS ET LATIN Dr Khadidja AISSANIIOUALALEN Dr Salima TOUATI [email protected] Dr. Zahoua BRAI [email protected] C1 – C2S1 Souad MAACHOU [email protected] C1S2+3,C1S4,C1S5,C1S6 Ŕ C2S5 Bulletin ORTHO 10 p. 98-102 Les bienfaits de la Chicorée Ourida AIT ALI [email protected] Dr. Samira OUMEDJKANE [email protected] C1S5, C1S6, C2S1, C2S2, C2S3, C2S4, Bulletin ORTHO 8 pages : 150-153 LA PROPOLIS Karima MALLOU [email protected] C1S6, C2S1, C2S2, C2S3, C2S5, Bulletin ORTHO 10 p. 130-131 Le lait de Chamelle Peintre Mahmoud TALEB [email protected] Nesrine SEDJELMACI Bulletin ORTHO12 p, 132 LřAluminium dans les emballages alimentaires et les ustensiles de cuisine, quel risque pour la santé ? Dr Fatima LATRECHE [email protected] CHLEF C2S1, C2S2, C2S3, C2S4, C2S5, Bulletin ORTHO 10 p. 80-86 La LEPTINE Bulletin ORTHO 4 pages 131 6 Œuvres offertes aux Conférenciers du C1S5 SANMO Fatéma Zohra AMIA [email protected] Bulletin ORTHO12 p, 112 Hypercalcimie Medicamenteuse ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Pr. Mustapha DAIDJ Conférencier et Praticien Spécialiste Médiation des Cultures et des Civilisations [email protected] C1S6 Bulletin ORTHO 5 pages 19-21 PENSER LES CRISES DU MONDE Dr. Smail MEZIANI Président de lřInstitut Européen des Antioxydants (IEA) 2 Av. de la Forêt de Haye, TSA 40602 54 518 Vandoeuvre les Nancy Cedex [email protected] www.ie-antioxydants.com C2S5Bulletin ORTHO 9 pages : 57-64 CV et Publications Bulletin ORTHO 10 pages 15-48 LES ANTIOXYDANTSUTOPIE OU REALITE Ŕ Bulletin ORTHO11 page : 53 Pr. Smail MEZIANI : LES APPLICATIONS MEDICALES DE LA VOLTAMPEROMETRIE : UNE METHODE EXCLUSIVE POUR LA MESURE RAPIDE DU STATUT OXYDANT/ANTIOXYDANT DANS LES PRODUITS ALIMENTAIRES, COSMETIQUES, PHARMACEUTIQUES ET LES LIQUIDES BIOLOGIQUES Bulletin ORTHO12 p, 102 LřOBJECTIF DE LřINSTITUT EUROPEEN DES ANTIOXYDANTS EST DřIMPLANTER UNE ANTENNE EN ALGERIE Pr Patrick A. CURMI INSREM-Université dřEvry C2S1 Bulletin ORTHO 6 pages : 21-22 NANODIAMANTS FLUORESCENTS POUR LA BIOLOGIE ET LA MEDECIN E Pr. George BIRKMAYER Dr. Med. Sabine WIEDMD PhD Doctorat en BAUMGARTNER biochimie, Université de Landstrasse 15a 4020 Linz Vienne, Autriche Autriche +43 732 771579 Chef de file de la therapie www.mesotherapie.at par NADH [email protected] [email protected] C1S1-C1S2+3-C1S5-C2S1Bulletin ORTHO 3 pages Bulletin ORTHO 4 pages 14- 22. COMPLEMENTS 5. Le NADH augmente NUTRITIONNELS lřénergie dans chaque Bulletin ORTHO 5 pages cellule 54-56 TABLEAU DES 10-24. COENZYME 1 INTERACTIONS (NADH) ET SES APPLICATIONS THERAPEUTIQUES 26-37 NADH All you should know about NADH (Coenzyme 1) Bulletin ORTHO 6 pages : 7-19 LES MALADIES MITOCHONDRIALES Dr. med. Monika Fuchs Ganzheitliche & Ästhetische Bulletin ORTHO12 p, Medizin 19 NADH ET SES APPLICATIONS THERAPEUTIQUES 1010 Wien, -Autriche26 COENZYMZ1 NADH EST UNE Elisabethstraße 22/18 T+43 1 585 8383 F +43 1 THERAPIE EFFICACE CONTRE 58588384 LE CANCER [email protected] C1S1-C1S2+3Bulletin ORTHO 3 pages 23Ŕ25. LES OLIGOELEMENTS 26-31. INDICATIONS ORTHOMOLECULAIRES EN DERMATOLOGIE Dr Heïdi THOMASBERGER. 82- LřHOMOCYSTEINE Praxiszentrum Bulletin ORTHO 5 pages Seidengasse Seidengasse 35-42 DIAGNOSTICS DES 28-1070 W i e n MICRONUTRIMENTS Ŕ AUSTRIA 0043676840200840 http://www.pzseidengasse.at/ [email protected] C1S1-C1S4-C1S5-C1S6 Bulletin ORTHO 3 pages 80-81. LA DYSBIOSE INTESTINALE 70-79. LES ACIDES AMINES 83CYTOCHROME P450 8490. MAGNESIUM . Bulletin ORTHO 4 pages 38-48. DIABETE ET SYNDROME METABOLIQUE 49-51. BURN OUT 52-53. MALADIES DES YEUX 54. LES INFECTIONS RECIDIVANTES 55-56. POLYARTHRITE RHUMATOIDE 57-58. OSTEOPOROSE Bulletin ORTHO 5 pages 22-29 ENZYMES 30-34 THERAPIE INTRAVEINEUSE 43-53 HORMONES 57-59 PARODONTITE Pr. Michel NARCE, [email protected] UMR INSERM/UB U866, Lipides Nutrition Cancer UFR Siences de la Vie, de la Terre et de l'Environnement 6 Bd Gabriel 21000 DIJON France C2S2 Bulletin ORTHO 7 pages : 26 Causes et conséquences des déséquilibres alimen taires sur la santé publique. Impact des Acides Gras Polyinsaturés. Quelles recommandations de la part des nutritionnistes ? 40 BIOSYNTHESE DES ACIDES GRAS INSATURES ET MALADIES CARDIOMETABOLIQUES : NOUVELLES APPROCHES Pr. Hafida MERZOUK Directrice du Laboratoire PHYSIO, PHYSIO PATHOLOGIE ET BIOCHIMIE DE LA NUTRITION TLEMCEN – [email protected] C1S2+3-C1S4-C1S5-C2S1C2S2-C2S3-C2S4 Bulletin ORTHO 3 pages 7-13. LES ACIDES GRAS POLYINSATURE. PRIVILEG E DES AGPI OMEGA 54-57. LE MILIEU INTERIEUR 58-61. LřEQUILIBRE ACIDE BASE 62-69. LE GLUTATHION 104-108. LES ACIDES GRAS INSATURES COMME ALLIES SANTE Bulletin ORTHO 4 pages 75-80 MICRONUTRITION ET DIABETE SUCRE 80-81 ALTERATIONS METABOLIQUES AU COURS DU DIABETE SUCRE 81-89 LE DIABETE SUCRE ET SES COMPLICATIONS 90-98 INDEX GLYCEMIQUE DES ALIMENTS PAR ORDRE ALPHABETIQUE 99-101 CV et Travaux du Pr Hafida MERZOUK Bulletin ORTHO 6 pages : 28-30 NUTRITION ET EQUILIBRE NUTRITIONNEL 31-39 LES COMPLEMENTS NUTRITIONNELS ET PRINCIPES DE LA MEDECINE CELLULAIRE 40-45 STRESS OXYDATIF Bulletin ORTHO 7 pages : 8 LES VITAMINES B 21 LES OLIGOELEMENTS : FER-SELENIUM-ZINC 24 ACIDE ALPHA-LIPOÏQUE 89 EFFECTS OF PESTICIDES (MANCOZEB AND METRIBUZIN) ON IN VITRO PROLIFERATIVE FUNCTION OF HUMAN LYMPHOCYTES IN THE PRESENCE OF VITAMIN C 103 EFFECTS OF MANCOZEB AND METRIBUZIN ON IN VITRO PROLIFERATIVE RESPONSES AND OXIDATIVE STRESS OF HUMAN AND RAT SPLEEN LYMPHOCYTES STIMULATED BY MITOGENS Bulletin ORTHO 8 pages : 9 LE GLUTATHION. 17- LES BIENFAITS DU CHOCOLAT. 21- L'HOMOCYSTÉINE ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ET LA PRÉVENTION CARDIO-VASCULAIRE. 24- ANALYSE EN LABORATOIRE DES OLIGO-ÉLÉMENTS ET DES VITAMINES. TRACES ÉLÉMENTS: CHROME, MANGANÈSE, CUIVRE ET MOLYBDÈNE. 31- COMMENT PRESCRIRE UN RÉGIME NUTRITIONNEL. 139- Protective effects of vitamin C and NADH on in vitro lymphocyte function in the presence of prooxidants 140- Vitamine C et NADH: Protection de la fonction des lymphocytes en présence des pesticides Bulletin ORTHO11 page : 92 Pr Hafida MERZOUK : LES APPLICATIONS THERAPEUTIQUES DE LA MEDECINE ORTHO MOLECULAIRE DANS L’HORMONOTHERAPIE ET L’ENZYMOTHERAPIE Bulletin ORTHO12 p, 33 MEDECINE ORTHOMOLECULAIRE POUR UN EQUILIBRE ALIMENTAIRE Pr.Mustapha OUMOUNA, M.Sc. Ph.D. Université Saad Dahlab-Blida Faculté des Sciences AgroVétérinaires Département des Sciences Véterinaries B.P: 270 Route des Soumaa-Blida [email protected] C1S5-C1S6-C2S2-C2S3C2S4-C2S5 Bulletin ORTHO 4 pages 59-71.IMMUNOLOGIE 72-74 CV et Travaux du Pr Mustapha OUMOUNA Bulletin ORTHO 6 pages : 46-58 Le Complexe Majeur dřHistocompatibilite (CMH) et les MALADIES AUTOIMMUNES Bulletin ORTHO 7 pages : 56 LřHYPERSENSIBILITE Bulletin ORTHO 8 pages : 57 LES IMMUNODEFICIENCES- sommaire58 IMMUNOLOGIE - Le Système immunitaire Ŕ 69 LES ELEMENTS DE LřIMMUNITE NONSPECIFIQUE 85 CAPTURE DřANTIGENE ET PRESENTATION AUX LYMPHOCYTES 100 LES MOLECULES MHC Pr Chafika MEHDID108 LřIMMUNITE Maitre de Conférence A en SPECIFIQUE Odontologie Conservatrice- Bulletin ORTHO11 page : Endodontie Département de 127 ORTHO-DZ RESEARCH Chirurgie Dentaire d'Alger Poly(ADP-ribose) [email protected] Polymerase-1 Inhibition -C1S6-C2S1-C2S3-C2S4-C2S5 Prevents Eosinophil Bulletin ORTHO 5 pages Recruitment by Modulating 60-66 LA NUTRITION Th2 Cytokines in a Murine DANS LA PREVENTION Model of Allergic Airway DES PATHOLOGIES Inflammation: A Potential BUCCO-DENTAIRES Ŕ Specific Effect on IL-51 Bulletin ORTHO 6 pages : Mustapha Oumouna,* and 23 LE pH SALIVAIRE Allied ET LES CARIES Bulletin ORTHO12 p, DENTAIRES 89 FORMULATION WITH CPG Bulletin ORTHO 8 pages : OLIGODEOXYNUCLEOTIDES 44-56 :LA CARIOPREVENTS INDUCTION OF PROPHYLAXIE PULMONARY PREVENTIVE ET LA IMMUNOPATHOLOGY FLUOROSE EN ALGERIE FOLLOWING PRIMING WITH Bulletin ORTHO11 page : FORMALIN-INACTIVATED OR 142 Pr Chafika MEHDID : COMMERCIAL KILLED BOVINE LES ALLIAGES DENTAIRES RESPIRATORY SYNCYTIAL AU MERCURE : ENTRE VIRUS VACCINE POLEMIQUES ET M. OUMOUNA and Allied CONTROVERSES Bulletin ORTHO12 p, 76 LES PATHOLOGIES DENTAIRES : PEUT-ON CONTROLER LES FACTEURS DE RISQUE ? 159 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ORTHO DZ PRESS BOOK Bulletin ORTHO 9 pages : 4 LřExpression du 25-07-2013 LřENVERS DU DECOR par Zoubir MEBARKI : Lřautre traitement du Cancer 5 Le Quotidien dřOran du 07-08-2013 Le Pr. Mohamed Brahim FAROUK à l'IDRH: «L'Urgence d'un large débat national sur notre système de santé» par ZIAD Salah 7 Le Temps dřAlgérie du 04-09-2013 SANTE : Vitamines et minéraux, traitements de plusieurs pathologies dont, le cancer 8 APS du 21-09-2013 PLAN NATIONAL DE LUTTE CONTRE LE CANCER 8 APS du 22-09-2013 Le Pr Thomas E LEVY défend à Alger la thérapie du Cancer à base de Vitamine C 9 Le Midi Libre du 22-0920013 Plan national de lutte contre le cancer : Le rapport final soumis au Chef de lřEtat à fin Octobre Ŕ Sadek BELHOCINE 10 Dknews du 22-09-2013 Le Professeur américain Thomas E LEVY défend la thérapie du cancer à base de vitamine C. Un médicament miracle anti-cancer ? Saïd ABDJAOUI 12 Dknews du 22-09-2013 Lřhomme a perdu les capacités génétiques de produire de la vitamine C - P. LARBI 13 Dknews du 22-09-2013 La SANMO pour lřintroduction de la Vitamine C Ŕ R. RACHEDI الفٍتبهٍي "سً" عالج ًبجخ14 ضذ السزطبى وتقٌٍة إلصالح الخالٌب -الخجٍثة – ثالل لزلزي هٌبك أسجبة جٌٍٍة إلى جبًت15 واألشعة والوىاد الكٍوٍبئٍة،التذخٍي -ً– إلٍبس ثبغل الجبًت الفٍزٌىلىجً لجسن16 اإلًسبى "القلق" ٌسبعذ فً ظهىر -ًأورام – الذكتىر دبج هبد 17 El-Watan du 22-092013 La Prévention très peu développée : Le cancer touchera plus dřAlgériens Ŕ Djamila KOURTA 18 InfoSoir du 22-09-2013 LUTTE CONTRE LE CANCER : La Vitamine C, remède miracle ? 160 19 El-Moujahid du 22-091 07 A TIM ELIN E OF 2013 LUTTER CONTRE LE VI TAM IN M EDI C IN E B Y CANCER : Le Professeur A N D R E W W. S A U L, Américain Thomas E. LEVY E D I T OR ( OM N S F E B 1 5 , défend la thérapie à base de 2 01 4 vitamine C 19 Le Soir dřAlgérie du 22- 1 0 9 A C A S E R E P O R T A N D BIOCH EMICA L 09-2013 ACTUALITES : R A TI O N A L E B Y W . Traitement du Cancer et de T O D D P E N B ER T H Y, pathologies lourdes. Le Pr P H D A N D A N D R E W W. Thomas LEVY prône de méga-doses de vitamines C SA U L (OMN S M AR CH 20 HORIZONS du 26-091 8, 2 01 4 ) 2013 LA VITAMINE C CONTRE Bulletin ORTHO 10 pages : LE CANCER Ŕ Rabéa F. 7 1 - 7 3 A C A S E F OR Bulletin ORTHO12 p, N A TU R A L H E A LT H 5 APS Mer. 26 Fév. 2014 UNE T R E A TM E N T C O M M E N CONSOMMATION QUOTIDIENNET A R Y B Y TR A VI S V . MEYER DE VITAMINE C PRÉVIENT L'APPARITION DES CANCERS 7 3 - 7 4 S T E P S T O B ETTER H EALTH. 8 Santé MAG N°27 Fev.2014 A R E Y OU S I C K O F p.2 : UN APPAREIL DE MESURES I C K N E S S ? B Y DU TAUX DE TOXINES DANS LE H E L E N SA U L C A S E CORPS PRESENTE EN 74 -75 AD HD FOR PREMIERE MONDIALE A ALGERE V E R Y O N E A N D 8 DK-NEWS 1er Avril 2014 : D R U G S , TO O . TRAITEMENT DU CANCER : C O M M E N TA R Y B Y UNE NOUVELLE APPROCHE R A L PH MEDICALE CONÇUE PAR DES C A M P B E L L, M . D . MEDECINS ALGERIENS par 76-77 Treating ADHD with Sonia BELAIDI Vitamin B-3 (Niacinamide) 11 APS 30 Mars 2014 : by Andrew W. Saul, Editor VITAMINE C ASSOCIEE A LA 77 Linus PAULING et le NADH, TRAITEMENT EFFICACE XXème Siècle CONTRE LES MALADIES B U L L E TI N O R T H O9 P . DEGENERATIVES 78 Vitamin C and Cancer: The 12 Santé MAG N°28-Mars 2014 Naked Mole-Rat Connection INTERVIEW DU Dr. Ilyès BAGHLI by Steve Hickey, PhD 15 Pr.Hafida MERZOUK à Santé 80 VITAM IN MAG : ETRE MEMBRE DE F O R G O T T EN LřACADEMIE AFRICAINE DES R ESEA RC H OF C LAU S SCIENCES EST UN HONNEUR W . J U N G E B LU T , M . D . POUR MOI ; POUR LA FEMME B Y AN DR EW W. SAU L ALGERIENNE ET POUR NOTRE 85 V I TA M I N C , PAYS S H I N GL E S , A N D V A C C I N A T I ON ISOM-PRESS O P I N I ON B Y T H OM A S E. LEVY, M D, J D C A N D P OL I O T H E 87 Vitamin C and Polio The Forgotten Research of Claus W. Jungeblut, M.D. by Bulletin ORTHO 12 pages : Andrew W. Saul 104 NOT TAKING Bulletin ORTHO 8 pages : SUPPLEMENTS CAUSES Orthomolecular Medicine MISCARRIAGE, BIRTHING News Service, PROBLEMS, INFANT June 27, 2013 MORTALITY by Andrew W. 1 2 6 - T R U TH I N Saul, Editor (OMNS Jan 27, PH A RMA C EUTIC A L 2014) A D V E R TI S I N G N O W TH E R E I S A N O X Y M O R ON F OR Y OU BY RALPH K. CAMPBELL, M.D. June 11, 2013 128- Pharmaceutical Drug Marketing to Our Children: Bordering on Criminal B Y HE LEN SAU L C ASE Bulletin ORTHO 7 pages : 96 High-Dose Vitamin C Reduces Inflammation in Cancer Patients Study Shows WICHITA, Kan., Sept. 25, 2012 Bulletin ORTHO 6 pages : 47-51 SUPPLEMENTAL ASCORBATE IN THE SUPPORTIVE TREATMENT OF CANCER: REEVALUATION OF PROLONGATION OF SURVIVAL TIMES IN TERMINAL HUMAN CANCER (VITAMIN C) Ewan CAMERON and Linus PAULING Orthomolecular Medicine News Service, March 21, 2013 Niacin is the Safest and Most Effective Way to Control Cholesterol Bulletin ORTHO 5 pages : Orthomolecular Medicine News Service, Jan 24, 2013 A N TI O X I D A N T S PR EVEN T CA NC ER AND SOME MAY EVEN CURE IT C OMMEN TAR Y B Y S T E V E H I C K E Y , PH D Bulletin ORTHO 4 pages : Bulletin ORTHO 3 pages : 39-42 THE RIORDAN IVC PROTOCOL 2009 INTRAVENOUS ASCORBATE (IVC) AS A CHEMO-THERAPEUTIC AND BIOLOGIC RESPONSE MODIFIER Jackson JA, Ron HUNNINGHAKE. 43-44 EFFECTS OF HIGH DOSE INTRAVENOUS VITAMIN C THERAPY ON HEALTH-RELATED QUALITY OF LIFE IN CANCER PATIENTS. Hidenori TA KAHASHI, M.D., Haruyoshi MIZUNO, M.D. Kazuoki NONAKA, M.D., Kunihiro KITAMURA, M.D. Seiji KATAYAMA, M.D. & Atsuo YANAGISAWA, M.D. 44-46 DOCTORSř CHOICES ON THEIR OWN CANCER TREATMENT FROM THE SURVEY OF 222 DOCTORS IN JAPAN Kunihiro KITAMURA, M.D., Seiji KATAYAMA, M.D., Kazuoki NONAKA, M.D., Hidenori TAKAHASHI, M.D.Atsuo YANAGISAWA, M.D. ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ Atsuo YANAGISAWA Biologic Response Modifier Jackson JA, Hunninghake RE, et al. 97-102 Pretreatment with Ascorbic Acid Prevents Lethal Gastrointestinal Syndrome in Mice Receiving a Massive Amount of Radiation. From National Defense Medical College & Ground Self- Defense Force in Japan Yamamoto et al. 108-110 ANTIOXIDANTS PREVENT CANCER AND SOME MAY EVEN CURE IT COMMENTARY by Steve Hickey, PhD - Orthomolecular Medicine News Service, Jan 24, 2013 Bulletin ORTHO 7 page : 5 Interview of Dr YANAGISAWA for Canal Algerie TV Chef de file de la thérapie intraveineuse par la vitamine C au JAPON [email protected] C1S6 Bulletin ORTHO 3 pages 43-44. EFFECTS OF HIGH DOSE INTRAVENOUS VITAMIN C THERAPY ON HEALTH-RELATED QUALITY OF LIFE IN CANCER PATIENTS. 44-46. DOCTORSř CHOICES ON THEIR OWN CANCER TREATMENT FROM THE SURVEY OF 222 DOCTORS IN JAPAN Bulletin ORTHO 5 pages 69-82 High Dose Intravenous Vitamin C Therapy For Cancer Patients: Riordan Ivc Protoco Ŕ 95-97 Vitamin C Can Prevent Radiation Damage: Results From Fukushima Nuclear Power Plant Workers 102-106 EFFECTS OF VITAMIN C AND ANTIOXIDATIVE NUTRITION ON RADIATION-INDUCED GENE EXPRESSION IN FUKUSHIMA NUCLEAR PLANT WORKERS - A PILOT STUDY °°°°°°°°°°°°°° 83-94 The Riordan IVC Protocol Intravenous Ascorbate (IVC) as a Chemotherapeutic and Pr Thomas Edward LEVY C2S4 Bulletin ORTHO 9 pages : 24 Thomas Ed LEVY - C.V. 38-53 Vitamin C Past, Present, and Future Applications Thomas Ed LEVY 55-68 Death by Calcium Ŕ The Toxic Supplement Thomas Edward LEVY Pr Gilbert H. CRUSSOL [email protected] C2S5Bulletin ORTHO 10 pages 49 CV 50-55 Mieux vaut Prévenir que Guérir 56-67 Maladie nosocomiale ou Scorbut hospitalier ? ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ًالجوعٍة الجزائزٌة للتغذي والطت الجزٌئ ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE SOCIETE ALGERIENNE DE NUTRITION ET DE MEDECINE ORTHOMOLECULAIRE PROGRAMME SANMO C3S2 Séminaire 2 Cycle III 30-31 Mai 2014 Institut de Formation Ben-Aknoun ALGER Vend. 30 Mai de 8h30 à 11h30 Samedi 31 Mai de 9h à 12h CYCLE III C3S2 30-31 Mai 2014 Pr MUSTAPHA OUMOUNA Capture et présentation d'antigène, et la sélection thymique Vend. 30 Mai de 11h30 à 12h30 - Les vitamines hydrosolubles : - Vitamines du groupe B : * B1 thiamine * B2 riboflavine * B3 Niacine * B5 acide pantothénique * B6 pyridoxine * B9 acide folique - Acide alpha-lipoïque. - Trace éléments : sélénium, le fer, le zinc. - Cryptopyrrolurie - Nutriments accessoires : biotines dřinositol, acide para-amino-benzoïque. Pr. Hafidha MERZOUK - Les vitamines hydrosolulbes. L'acide alpha-lipoique. La co-enzyme Q10 . Les traces éléments: Sélénium, Fer, Zinc. Samedi 31 Mai de 15h à 16h C3S3 10-11 Oct. 2014 - Les acides gras insaturés. - Maladie cardio-vasculaire. - Lřhomocystéine. - Le diagnostic en micronutriments : * Analyse des oligo-éléments * Les minéraux et vitamines - Trace éléments : chrome, le manganèse, le cuivre, le molybdène: - Les possibilités orthomoléculaires en dermatologie. C3S4 28-29 Nov. 2014 Dr Tahar NAILI Le Stress Oxydant Vend. 30 mai de 14h30 à 17h30 Dr Ilyès BAGHLI Les Protocoles de la SANMO Samedi 31 Mai de 16h à17h Création par le Groupe et Cérémonie de clôture CONDITION D'INSCRIPTION POUR UNE FORMATION ET PERFECTIONNEMENT SANMO EN NUTRITION ET EN MEDECINE ORTHOMOLECULAIRE ETRE MEDECIN / BIOLOGISTE / PHARMACIEN / AGRONOME / BIOCHIMISTE / CHIMISTE /DENTISTE / DIETETICIEN DOSSIER D'INSCRIPTION: COPIE DU DIPLOME Ŕ COPIE DřUNE PIECE D'IDENTITE - PHOTO A ADRESSER PAR MAIL [email protected] www.orthomoleculaire.org Pr Smail MEZIANI – Institut Européen des IL EST POSSIBLE DE S'INSCRIRE DIRECTEMENT AU PROCHAIN SEMINAIRE, CAR IL S'AGIT D'UN CYCLE DE FORMATION MEDICALE CONTINUE ORTHOAntioxydants 12 ِ(ئIEA) ْالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَي /PAOT®////Skin Technologie //, Une nouvelle méthodologie exclusive pour la détermination du Statut Stress Oxydatif dans les liquides et les tissus Le milieu interieur. - L'équilibre acido-basique. - Le glutathion. - Les acides aminés. - Le magnésium et le calcium. - Le système cytochrome P450 . - Les métaux lourds et le mécanisme de détoxification. - Les interactions dans la micronutrition. C3S5 26-27 Dec. 2014 - Les Possibilités orthomoléculaires dans: * Le diabète sucré. * Le syndrome métabolique. * Lřostéoporose. * Lřarthrite rhumatoide. * Les infections récurrentes. * La dégénérescence maculaire * Les autres maladies des yeux. * Le syndrome du Burn-out. - La sérotonine et la mélatonine. C3S6 23-24 Janv. 2015 - Potentiel dans le traitement du cancer. - Micro-nutriments dans l'hormonothérapie. - Enzymes. - Médecine dentaire et oligo-éléments. - Intra-veinotherapie. 161 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE EVALUATION DU BULLETIN ORTHO Le Bulletin ORTHO de la Société Algérienne de Nutrition et de Médecine Orthomoléculaire est le Bulletin de liaison de la SANMO avec ses adhérents et ses partenaires. Il n’est pas exclusif, il s’ouvre à toutes celles et tous ceux qui lui manifestent de l’intérêt, à travers toutes les spécialités. Après presque 03 ans d’existence et des efforts considérables, ce Bulletin veut se parfaire toujours plus ; il ne le pourrait qu’avec votre aide, votre soutien et vos contributions. En voulant bien répondre à ce questionnaire vous nous aiderez à l’améliorer. Nous vous en remercions. Identification : Catégorie socio professionnelle : Homme Femme Poste de responsabilité : OUI Non Age :................ Région ..................... 1-Comment trouvez–vous le Bulletin ORTHO de la SANMO ? 1) intéressant, vous avez plaisir à le lire. 2) pas intéressant, vous regardez les photos 3) vous ne le lisez pas. 2-Quelles sont les rubriques que vous appréciez le plus ? 1) ORTHO-COURSES 2) ORTHO-PRESS BOOK 3) ORTHO-GUEST 4) ORTHO-DZ 5) ORTHO-ISOM 6) ORTHO-CULTURE 7) Autres .................... 3- Qu’aimerez-vous voir changer dans le Bulletin ORTHO ? 4- Quel rôle pourrait (ou devrait) avoir le Bulletin ORTHO ? 5- Est-ce que le Bulletin ORTHO, selon vous, est parvenu à réaliser ou à aider à réaliser ‘’quelque chose’’ (à vous de définir) pour notre Société Scientifique ? A-t-elle été utile ? 6- Voudrez-vous contribuer en envoyant des articles à ce Bulletin ? Pour quelle rubrique ? 7- Si on vous demandait de lui changer de nom, que proposerezvous ? 8- Avez-vous des suggestions ou des propositions pour le Bulletin ORTHO ? Réponse sur [email protected] 162 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ LISTE DES LAUREATS ORTHO-DZ SANMO AU SEMINAIRE C3S1 DU 24 AU 25 MARS 2014 LAUREATS Drs ORTHO-DZ SANMO-ISOM DE FORMATION CONTINUE EN NUTRITION ET EN MEDECINE ORTHOMOLECULAIRE 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. Abdelhamid BENCHARIF Abdelkrim TAFAT-BOUZID Abdellah DIB Abdellah KESSI Aicha TAYAR Ali ASBAÏ Amin GASMI Amina LAGGOUNŔBOURADA Assia GHEMATTI Cherif HAMADOUCHE Dahbia MAHIDDINE Djamila-Leïla BENAZZA Fadila-Djazia AIT-OUAZZOU Fatima LATRECHE Fatima-Zohra AMIA Ferhat MISSOUM Hafeda GHORZI Hafida ZOUBIR Halima GASMI-BENNOUR Hayat ZITOUN Hocine AROUA Ilyes BAGHLI Karima MALLOU Khadidja AISSANI-IOUALEN Larbi DJAKRIR Latifa KHEMMAR Leila HOCINE Lynda KACI-MEZIANI Mahmoud AROUA Malika BENHAFSI Mohamed BILLAMI Mohamed MAROUF-ARIBI Mohamed-Rachad BOUMOKOHLA Nacima CHILA Naima-BEY MOULAI Noureddine BENYOUB Sabah GUENANE Salima TOUATI Samira OUMEDJKANE Sidi-Mohamed MOSTEFA Slimane ADDAR Smail BOUKKERAS Sofiane TAKHRIST Souad HAMADI Souad MAACHOU Tahar NAILI Tewfik BENHADJI-SERRADJ Toufik HENTABLI Toufik SAADOUN Zahoua BRAÏ Zineb-Nesrine BEKKAR Zohra SIDENNAS ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE [email protected] Mohammed BILLAMI [email protected] Noureddine BENYOUB [email protected] Slimane ADDAR [email protected] Tahar NAILI [email protected] Zineb-Nesrine BEKKARA [email protected] Smail BOUKKERAS Mohamed MAROUF-ARIBI [email protected] Sabah SALHI-GUENANE [email protected] Tewfik BENHADJI-SERRADJ [email protected] . Zohra SIDENNAS [email protected] LISTE DES LAUREATS SANMO-ISOM LORS DU SEMINAIRE DE LA SANMO C3S1 DU 28 AU 29 MARS 2014 Sofiane TAKHRIST [email protected] Salima TOUATI Mohamed-Rachad BOUMOKOHLA [email protected] Nacima CHILA [email protected] Naima BEY-MOULAI [email protected] [email protected] Toufik HENTABLI [email protected] Samira OUMEDJKANE [email protected] Sidi-Mohamed MOSTEFA [email protected] Fatima-Zohra AMIA : Hypercalcémie médicamenteuse. Zohra SIDENNAS : Rhodiola. Mohamed-Rachad BOUMOKOHLA : Comportement alimentaire et Hopital sur Ortho10 de la page 126 à 129. Mohamed MAROUF-ARIBI : - Spiruline sur Ortho7 - Aspect toxicologique des additifs sur Ortho8 - Intolérance au gluten sur Ortho10 Souad HAMADI [email protected] Toufik SAADOUN [email protected] Souad MAACHOU [email protected] ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ Zahoua BRAÏ 163 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE LAUREATS Drs ORTHO-DZ SANMO-ISOM DE FORMATION CONTINUE EN NUTRITION ET EN MEDECINE ORTHOMOLECULAIRE Abdelhamid BENCHARIF [email protected] Abdelkrim TAFAT-BOUZID [email protected] Abdellah DIB [email protected] Amin GASMI [email protected] Amina LAGGOUNŔBOURADA [email protected] Assia GHEMATTI [email protected] Abdellah KESSI [email protected] Cherif HAMADOUCHE [email protected] Aicha TAYAR [email protected] Dahbia MAHIDDINE [email protected] m Ali ASBAÏ [email protected] 164 Djamila-Leïla BENAZZA [email protected] Fadila-Djazia AIT-OUAZZOU [email protected] Hayat ZITOUN [email protected] Latifa KHEMMAR [email protected] Fatima LATRECHE [email protected] Hocine AROUA [email protected] Leila HOCINE [email protected] Fatima-Zohra AMIA [email protected] Ilyes BAGHLI [email protected] Lynda KACI-MEZIANI [email protected] Hafeda GHORZI [email protected] Karima MALLOU [email protected] Hafida ZOUBIR [email protected] Halima GASMI-BENNOUR [email protected] ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ Khadidja AISSANI-IOUALEN [email protected] Larbi DJAKRIR [email protected] Mahmoud AROUA [email protected] Malika BENHAFSI-BENBOUZID [email protected] Missoum FERHAT [email protected] ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE ALGERIA Algerian Society for Nutrition and Orthomolecular Medicine. Webside: www.orthomoleculaire.org Mail: [email protected] Address: 07, rue des freres Khennouche Kouba – Alger - Algiers - Algeria. President: Dr Ilyes BAGHLI Phone: 00213550588607 E-mail: [email protected] AUSTRALIA Australasian College of Nutritional and Environmental Medicine Mail: PO Box 298, Sandringham, VIC, 3191, Australia Phone: +61 (3) 9597 0363 Fax: +61 (3) 9597 0383 Email: [email protected] Website: www.acnem.org SOMA Health Association of Australia Secretary: J.M. Sulima P.O. Box 7180, Bondi Beach NSW 2026 Tel: 61 2 9789 4805 Fax: 61 2 9922 574 [email protected] www.soma-health.com.au BELGIUM Vlaams Instituut voor Orthomoleculaire Wetenschappen Contact: Werner A. Fache, MD Kerkstraat 101, 9270 Laarne Tel: 32 9 222 2400 Fax: 32 9 366 1838 [email protected] [email protected] www.viow.be BRAZIL Sociedade Brasileira de Medicina Ortomolecular (SBMO) President: Oslim Malina, MD Rua 7 Abril, 813, Curitiba 80040 PR Tel/Fax: 55 41 264 8034 CANADA ITALY THE NETHERLANDS Canadian Society for Orthomolecular Medicine Secretary: Steven Carter 16 Florence Avenue, Toronto, ON M2N 1E9 Tel: 416 733 2117 Fax: 416 733 2352 [email protected] www.orthomed.org Associazione Internationale di Medicina Ortomolecolare President: Adolfo Panfili, MD Via Valdieri 23, 00135 Rome Tel: 39 06 3315943 Fax: +39 06 23328934 [email protected] www.aimo.it Maatschappij ter Bevordering van de Orthomolecaire Geneeskunde Contact: F.J.A. Eissens-van Goor Zuiderstraat 4, 9479 PP Noordlaren Tel: 31 50 409 2717 Fax: 31 50 409 2738 [email protected] www.mbog.nl DENMARK Dansk Selskab for Orthomolekylaer Medicin President: Claus Hancke, MD Lyngby Hovedgade 37, DK 2800 Kgs. Lyngby Tel: 45 45 88 0900 Fax: 45 45 88 0947 [email protected] FRANCE Association pour la Developpement de la Medecine Orthomoleculaire President: Dominique Rueff, MD 85 Avenue de Marechal Juin, Cannes 06400 - France GERMANY Deutsche Gesellschaft fur Orthomolekulare Medizin SittardstraBe 21, 41061 Monchengladbach Tel: 49 21 6120 9729 Fax: 49 21 6118 2290 Munchner Gesellschaft zur Forderung der Orthomolekulare Medizin e. V. Zur Bergwiese 7, 82152 Planegg Tel: 49 89 8959 0105 Fax: 49 89 8982 6598 INDIA Dr. Jagan Nathan Vaman MD PGCA (Harvard) MSFN INSOM Indian Society for Orthomolecular Medicine (CEO) No 8 Ramaniyam Govindh Medavakkam Main Road Madipakkam Chennai 600091 INDIA Tel: +91 44 43559905 / 4355 9939/ 65271655 Mobile: +91 81220 62636 Email: [email protected] INSOM website: www.eduquant.org JAPAN Japanese Society for Orthomolecular Medicine General Manager Kitahara Tsuyoshi 2-6-6 Numabukuro Nakano-ku Tokyo 165-0025 Japan Tel: 81-(0)3-3388-7776 Fax: 81-(0)3-5318-1422 E-mail: [email protected] www.orthomedjapan.org Orthomecular.jp RepresentativeToru Mizoguchi,MD 2-3-11-4F Shinjuku, Shinjuku-ku Tokyo 160-0022 Tel : 81 3 33508988 Fax: 81 3 3350 6998 www.orthomolecular.jp Japanese College of Intravenous Therapy President: Atsuo Yanagisawa, MD 3-17-19-701 Shirokane, Minato-ku Tokyo 108-0072 Tel: 81 3 6277 3318 Fax: 81 3 6277 4004 [email protected] www.iv-therapy.jp KOREA Korean Society for Orthomolecular Medicine President: Sung Ho Park, PhD Bupyong-Dong 199-20 Bupyong-Gu 403-821 Incheon [email protected] www.ksom.or.kr MEXICO Sociedad de Medicina Ortomolecular President: Hector E. Solorzano, MD Los Aipes No. 1024, Col. Independencia 44340 Guadalajara, Jal. Tel: 52 3 651 5476 Fax: 52 3 637 0030 [email protected] ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ SPAIN Sociedad Espanola de Medicina Ortomolecular Pres: Luis Arnaiz Duro de Paradis Balmes 412 08022 Barcelona Tel: 34 93 254 6000 Fax: 34 93 254 4774 SWITZERLAND Fachgesellschaft fur Emahrungsheikunde und Orthomolekularmedizin Schweiz President: John van Limburg Stirum, MD Spruengli-Weg 9, CH-8802 Kilchberg Tel: 41 1 715 6401 Fax: 41 1 715 6403 [email protected] www.feos.ch UNITED KINGDOM Institute for Optimum Nutrition Contact: David Nicolson Avalon House, 72 Lower Mortlake Road Richmond, Surrey TW9 2YJ Tel: 44 020 8614 7800 Fax: 44 087 0979 1133 www.ion.ac.uk [email protected] www.ion.ac.uk UNITED STATES OF AMERICA Society for Orthomolecular Health Medicine President: Richard Kunin, MD 2698 Pacific Avenue San Francisco, CA 94115 Tel: 415 922 6462 Fax: 415 346 2519 [email protected] orthomed.org/isom/isomsocieties.html 165 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 166 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 43ème Orthomolecular Medicine Conference Fairmont Hotel VANCOUVER April 25-27, 2014 ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 167 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE 2014 RIORDAN IVC AND CANCER SYMPOSIUM THIS YEARřS SYMPOSIU M Ŕ OCTOBER 2-4 Three days of lectures, conversations, and camaraderie with other medical professionals who use high-dose vitamin C in their practices. On Thursday, there will be a one day pre-symposium certification course in the safe administration of IVC according to the Riordan IVC Protocol. You and your staff can take advantage of the first ever ŖIVC Academyŗfeaturing Riordan Clinic staff, doctors and our guest, Dr. Virginia Osborne, right on Riordan Clinic’s beautiful campus. The symposium lectures will start on Friday at the Hyatt Regency Wichita and will serve as an excellent opportunity for IVC practitioners to become more involved with IVC Therapy, adjunct therapies and expound new approaches to treating cancer. We will conclude the event with the banquet on Saturday evening. Accommodations are available at the Hyatt Regency Wichita. 2014 RIORDAN IVC & CANCER SYMPOSIUM OCTOBER 2-4 ADDRESSING THE METAB OLIC ROOTS OF CANCER Thirty years ago, Dr. Hugh Riordan treated his first cancer patient with high doses of intravenous vitamin C. A 70 year-old gentleman with renal adenocarcinoma came to him, post nephrectomy, with mets to his liver and lungs. A long time admirer of the work of Pauling and Cameron, Dr. Riordan offered to treat this cancer patient “palliatively” with 30 grams of ascorbic acid intravenously twice a week. Surprisingly, after 15 months of therapy, the cancer was gone. The patient died 12 years later…of congestive heart failure at age 84. Some 70,000 IVC infusions later, Dr. Riordan and his RECNAC research team demonstrated that there is plausible scientific evidence to support the use of high dose ascorbate in the adjunctive care of cancer patients. Studies at the National Institutes of Health have since replicated and advanced these findings. Many practitioners around the country and world have adopted the Riordan IVC Protocol for Cancer Patients as a useful adjunct for their own cancer patients. Many questions regarding dosage, infusion rates, frequency of administration, addition of other IV and oral nutrients, mechanism of action, effects on conventional treatments, and others, now cloud the wider acceptance of IVC as a reasonable and effective adjunct to conventional cancer therapy. In an effort to draw upon the wide experience of IVC pioneers, Riordan Clinic will host its 4th IVC and Cancer Symposium featuring top clinicians and IVC researchers who will address many of these pressing questions in an environment of co-learnership. This year‟s theme will be “Addressing the Metabolic Roots of Cancer.” 168 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Dr. Riordan was an ardent champion of co-learnership. His favorite quote came from Epictetus: “You can‟t begin to learn what you think you already know.” It is this spirit that guides the Riordan IVC and Cancer Symposium. SNEAK PEAK: 2014 TOP ICS AND SPEAKERS More detailed scheduling information and speaker bios available soon. IVC Academy Ŕ Doing IVC Right (5.5 CME Credits) Thursday, October 2, 2014, at Riordan Clinic: THE FOLLOWING TOPICS WILL BE PRESENTED BY RIORDAN CLINIC DOCTORS RON HUNNINGHAKE, MD; MIKE BAUERSCHMIDT, MD; JENNIFER KAUMEYER, ND; RIORDAN CLINIC NURSING AND MEDICAL STAFF, AND SPECIAL GUEST VIRGINIA OSBORNE, ND. The Riordan Protocol: Just the Basics Doing IVC Right: Patient Selection, Mixing, Infusion How to Successfully Start IVs in Your Office Hands On Experience and Starting IVs Safely Intercaths, Ports, and “Hard Sticks” Potential Legal Issues Surrounding IVC Prescriptions Course includes final certification test. **Limited to 26 attendees Ŕ SIGN UP NOW** Symposium Lectures (11 CME Credits) Friday October 3 and Saturday 4, 2014, at the Hyatt Regency Wichita: Addressing the Metabolic Roots of Cancer – Ron Hunninghake, MD Oxygen, Mitochondria, ATP and the Origins of Cancer – Frank Shallenberger, MD Cancer Case Studies Using Ozone and IVC Protocol – Frank Shallenberger, MD The Role of Glutathione in the Initiation of Cancer – Tim Guilford, MD Death by Calcium: The Oxidative Roots of Cancer – Tom Levy, MD IVC and Cancer: A Systematic Review AND Early Findings from a Prospective Cohort Study – Dugald Seely, ND Heavy Metal Detox and IVC Cancer Care – Mike Bauerschmidt, MD Environmental Toxins and Complete Cancer Care – Walter Crinnion, ND Practical Tips for Optimizing IVC Safety and Effectiveness – Jennifer Kaumeyer, ND and Virginia Osborne, ND Alpha Lipoic Acid in the Care of Certain Cancers – Burt Berksons, MD The Forsythe Cancer Care Protocol – Sam Winters, DO ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 169 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Michael Bauerschmidt, MD, CCT Dr. Bauerschmidt is the Director of Environmental Medicine for Riordan Clinic. He graduated from the Ohio State University College of Medicine and later earned his MBA from the University of South Florida. He has spent more than a decade of his career in emergency medicine and later operated a successful functional, environmental, and integrative medical practice in Ft Lauderdale, FL. Dr. Bauerschmidt is a Certified Physician Development Coach with more than 100 hours of coaches training. He completed a Fellowship in Environmental Medicine and is a Certified Chelation Therapist, both from the American College for the Advancement of Medicine. Burton M. Berkson, MD, MS, PhD, MDh Dr. Burt Berkson practices integrative medicine in Las Cruces, New Mexico, and is an adjunct professor at New Mexico State University (Mycology). He is the expert consultant on alphalipoic acid (thioctic acid) and acute hepatic necrosis and mushroom poisoning at the Centers for Disease Control, Atlanta and is the medical mycology consultant at the Poison Control Center, University of New Mexico, Albuquerque. In 2011, Dr. Berkson was presented with the Life Achievement Award in Integrative Medicine from Arizona Governor Jan Brewer and the Arizona Homeopathic and Integrative Medical Society. He has worked as a researcher and professor at several institutions, including: the Max Planck Institute (Heidelberg), the University of Illinois (Urbana), Chicago State University, Autonomous Universities of Mexico, Cleveland Clinic Hospitals, Rutgers University, and as a member of the National Institutes of Health Internal Medicine and endocrinology research group. In addition to his medical training (PhD to MD Program, Autonomous University System, Mexico and the Cleveland Clinic Hospitals) and post graduate training (Internal Medicine and Pathology at Case Western Reserve Affiliated Hospitals), Dr. Berkson earned a Master‟s Degree in Biology and a PhD in cellular biological sciences from the University of Illinois, Urbana. Dr. Berkson is an active writer, researcher, and speaker with numerous published works in several scientific, medical, and popular journals. His three books are The Alpha-Lipoic Acid Breakthrough, All About the B Vitamins (with Arthur Berkson MD), and Syndrome X (with co-authors Jack Challem and Melissa Diane Smith). He also wrote chapters in the new book Honest Medicine. 170 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Walter J. Crinnion, ND Dr. Crinnion was a professor and the chair of the Environmental Medicine Department at Southwest College of Naturopathic Medicine from 2003 to 2013. After receiving his Naturopathic Doctorate from Bastyr University in 1982, he went into private practice for several years while simultaneously holding several associate professorships at various universities. He has served as an editor of the environmental medicine section of ALTERNATIVE MEDICINE REVIEW and of NATUROPATHIC MEDICINE, and has been a reviewer for THE NEW ENGLAND JOURNAL OF MEDICINE and many other scientific journals. He is a member of the American Association of Naturopathic Physicians and was awarded Physician of the Year in 2004 and Best In-Office Research in 1998 and 2002. Dr. Crinnion is a staunch advocate of environmental medicine and is the author of the book “Clean, Green & Lean: Get Rid of the Toxins That Make You Fat.” He has written numerous articles that have been published in peer reviewed journals and spoken for dozens of conventions, conferences and seminars across North America. He is currently the Chief Science Officer for Enzymedica, a digestive supplement company in Venice, Florida. Ron Hunninghake, MD Dr Hunninghake is the Chief Medical Officer of Riordan Clinic. A 1976 graduate of the University of Kansas School of Medicine, he has devoted his career to the emerging paradigm of self care: the patient as an informed medical partner. From the first days of medical school, he has sought to find new ways of encouraging his patients to take better care of themselves, form new and sustainable habits of health, and to assume greater responsibility for their own health. He was named the 2011 Orthomolecular Doctor of the Year by the International Society for Orthomolecular Medicine and is a 2013 inductee into the Orthomolecular Hall of Fame. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 171 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Jennifer Kaumeyer, ND Dr. Kaumeyer, a Riordan Clinic staff doctor, has a background in biology and nutrition. She received her Doctorate of Naturopathic Medicine from the Southwest College of Naturopathic Medicine in Arizona. Beginning in 2008, Dr. Kaumeyer operated a highly successful naturopathic clinic in Raleigh, NC, and later joined the Riordan Clinic staff in early 2011. Although Dr. Kaumeyer treats all conditions, she is especially interested in the treatment of hormone imbalances and gastrointestinal issues. She lectures locally on a variety of topics. Thomas Levy, MD, JD Thomas E. Levy, MD, JD is a board-certified cardiologist and the author of the books PRIMAL PANACEA, CURING THE INCURABLE AND STOP AMERICA‟S #1 KILLER!, as well as three other groundbreaking medical books. He is one of the leading world experts on the curative powers of vitamin C. Dr. Levy frequently lectures about the proper role of this nutrient and antioxidants in the treatment of a host of health conditions and diseases to medical professionals all over the globe. His work currently focuses on the importance of liposomal technology as a delivery system that appears to surpass the bioavailability seen with the intravenous administration of vitamin C, glutathione, and other nutrients into the body. Virginia Osborne, ND Dr. Osborne has more than 30 years of IV therapy and naturopathic medical experience. She practiced for 17 years as a nurse with specialties in critical, emergency and cardiac care. She received her Doctorate of Naturopathic Medicine in 1995 from the National College of Naturopathic Medicine in Portland, OR. She has participated in the expansion of IV nutritional therapy at the National College of Natural Medicine, NCNM, nationally and internationally for the past 10 years. She is a published author and a researcher of IV nutrients and their related benefits in health care. Currently she is in private clinical practice in Grass Valley, CA. 172 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Dugald Seely, ND, MSc, FABNO Dugald Seely leads the clinical practice and cancer research program for the Ottawa Integrative Cancer Center. In addition to his clinical role as a naturopathic doctor he also serves as the director of research & clinical epidemiology at the Canadian College of Naturopathic Medicine, affiliate investigator for the Ottawa Hospital Research Institute, and board member for the Society for Integrative Oncology. As founder of the OICC, Dr. Seely is pioneering a contemporary cancer treatment model based on scientifically grounded, evidence-informed complementary medicine. With the establishment of the first integrative cancer care and research center in Eastern Canada, he and his team are providing whole-person integrative care to people living with cancer and addressing research gaps in wholesystems of cancer care. Dr. Seely strongly believes in the ability of evidence-based medicine to effect positive change in the health-care system. As an educator, researcher, clinician, and frequent speaker at conferences around the world, he is seeking to shift the debate toward a more wholeperson cancer care model that is espoused by integrative oncology. Frank Shallenberger, MD, HMD, ABAAM Dr. Shallenberger is presently the President of the American Academy of Ozonotherapy, the first medical ozone society incorporated in the United States. He is also Vice President of the Society of Orthomolecular Health Medicine. He has just finished publication of his new book on ozone therapy entitled, “The Principles and Application of Ozone Therapy – A Practical Guideline for Physicians.” Dr. Shallenberger has been elected to serve as a charter member of the International Scientific Committee on Ozone Therapy. He is the developer of Prolozone®, an injection technique that has been shown to regenerate damaged joints, herniated discs, and degenerated joints, tendons, and soft tissues. Dr. Shallenberger has authored numerous papers in the international peer reviewed literature on ozone therapy and oxygen utilization. He is the Editor of Real Cures alternative medicine newsletter, and has written “The Type 2 Diabetes Breakthrough” and “Bursting with Energy,” both of which are in their fourth printing. Dr. Shallenberger holds the only patent on the use of respiratory gas analysis to determine mitochondrial function. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 173 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE PROGRAMME 43' CONGRÈS DE L'ISOM EDITORIAL OFFICIEL DE LA 43EME CONFERENCE DE L'ISOM 174 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Speech Dr. Tahar NAILI MD from ALGERIA in Vancouver April 2014 Mister President Dear Colleagues Thank you for giving me the opportunity to speak to this distinguished audience. I am Dr. Tahar NAILI MD from ALGERIA and it is a great Honor for me and at the same time a great privilege to be among the best practitioners in orthomolecular medicine in the world. So during the last 2 days, I appreciated the very high level of the presentations made by leading physicians. I was here in 2012 for my first participation as Vice President of the Algerian Society of Nutrition and Orthomolecular Medicine SANMO. Il decided to return again this year because in addition to the exceptional character of this Conference, the city of Vancouver is really beautiful and very attractive ; and I was very lucky this morning because I saw the departure of the VANCOUVER Marathon which is among the most popular in the world. Our presence demonstrates the willingness to cooperate and establish contacts with yhe staff of the ISOM and particularly with Mr. Steven CARTER and his international team, and also with the actual president Dr. Atsuo YANAGISAWA. Within SANMO we regularly organize training courses in Algiers to develop the practice of orthomolecular medicine. We have already successfully trained 80 practitioners, and we look to more recruitment in the future. For this reason we started to establish contacts to develop cooperation in the educational field. In practice, we use our national expertise composed bu nutritionists, immunologist, odonto-stomatologist and biologist high level training. For this purpose and concretely we accomodated, 2 times in Algiers, Dr YANAGISAWA and Dr Thomas Edward LEVY in 2013 and 2014 and we hope to expand our contacts with other personalities. So, I started to make contacts with speakers known internationaly and I can tell you that I have not been disappointed and thank you for all those who gave me their agreement. We have recently benefit from japanese experience, and this after the participation last March of our president Dr BAGHLI to the training session organized by the JCIT in Tokyo. It was a unique experience, very rewarding, so let me thanks the JCIT team for this project. In the SANMO, we are currently working on a therapeutic protocol and we are at experimental stage with some case-control, to treat and prevent chronic degenerative diseases, including cancer by using the combination of high dose of vitamine C, selenium and NADH. Cases we handeled currently seem to give satisfactory results. We expect to submit the results of our experience in the next Congress. We also edit 4 revues annualy on the field of orthomolecular medicine. The N°1 (ORTHO1) was given to Mr. CARTER since 2 years, and here we bring the N°11 (ORTHO11) All our revues are free download on our website : www.orthomoleculaire.org Dear president Thank you once again for all everything you do to promote this beautiful medicine that, in my opinion, is the real medicine. We are all orthomolecular family. Thank you very much. ORTHO 12 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ 175 ALGERIAN SOCIETY FOR NUTRITION AND ORTHOMOLECULAR MEDICINE Dr Tahar NAILI - Dr Ron HUNNINGHAKE Dr Roberto ORTIZ - Dr Tahar NAILI Dr Tahar NAILI - Aileen Burford-Mason, PhD Une partie de la délégation japonaise au dîner offert par Pr. Yanagisawa. Mr Steven Carter - Pr Atsuo Yanagisawa 176 Dr. Roberto ORTIZ (Mexico) , Dr. Tahar NAILI (Algeria) and Atsuo YANAGISAWA family at ISOM conference 2014 ِالجمعيّة الجزائريّة للتّغذّي والطّبّ الجُزَيْئ ORTHO 12
Documents pareils
ortho 11 - Société Algérienne de Nutrition et de Médécine
7 Rue des Frères Khanouche Ŕ Kouba- ALGER ALGERIE
ortho 20 - Société Algérienne de Nutrition et de Médécine
َ إِ َّن
َ اع َةِأ
ِ.ن
َِ ِماِأ َْم َك
َ ِالج ْزئيَّة
ُ ف َيهاِإلَىِاأل ُُمور
ortho 4 - Société Algérienne de Nutrition et de Médécine
Création d’une Association
Nationale dénommée:
ب اندشيئي
ّ ّاندمعيت اندشائزيت نهتّغذّي وانط
' Société Algérienne de Nutrition et de
Médecine Orthomoléculaire'