Effets du Triclosan sur le comportement des larves de poisson zèbre

Transcription

Universtié Catholique de Louvain (UCL)
Ecole de Biologie
Université de Namur
Département de Biologie
Effects of Early-Life and Continuous Exposure to
17-α-ethinylestradiol on the Life-History and Related Gene
Expression of the Mangrove Rivulus,
Kryptolebias marmoratus
Van Antro Morgane
Mémoire présenté en vue de l’obtention du diplôme
de Master en Biologie des Organismes et Ecologie
Promoteur : Fédéric Silvestre (Université de Namur)
Encadrante : Anne-Sophie Voisin (Université de Namur)
Année Académique 2016-2017
Acknowledgments
I would like to first of all thank my supervisor, Frédéric Silvestre. Thank you for
allowing me to experience this master thesis to the fullest and giving me a new
motivation concerning my future. In the hopes that the potential next 4 years are
as fun and motivating as was this last year
Anne-Sophie, were do I start? Without you this thesis would not have been the
same. I thank you for everything which you have taught me. I have become a
better scientist. But most of all I thanks you for being such a great friend. Great
minds do think alike!
Alessandra, Alexandre, thank you for all of your support this past year. I have
learned a lot let it be scientifically and humanely. In the hopes of working with
you in the coming years!
To the rest of the master students, Toa, Antoine, Elodie, Damien and Anais.
What a year this has been! Let’s stay exactly has we are!
To the rest of the Master Biology students, in particular Agnes, Pierre, Sebastien
and Sophie, there isn’t much that can be said that hasn’t been already said, but
thank you for making these last five years amazing!
Abstract
17-α-ethinylestradiol (EE2) is one of the most studied and widespread
endocrine disrupting compounds known to man and is primarily found in the
aquatic environment. Effects, such as increases in plasma vitellogenin, decrease
in egg and sperm production, feminisation of males reduced fertility and
fecundity, and changes in behaviour, have been observed in most organisms
exposed to EE2. Nevertheless, these effects have been shown to vary depending
on the targeted development stage of an organism. Thus it is essential to study
the effects of EE2 in both early-life and all-life stages of an organism. This
study investigated the phenotypic outcome of both early-life and contiuous
exposure to 17-α-ethinylestradiol in the mangrove rivulus, Kryptolebias
marmoratus. This species is the only known hermaphroditic self-fertilizing
vertebrate, meaning that isogenic lineages can be obtained in laboratory
conditions. K. marmoratus thus makes it possible to studying phenotypic effects
of varying environmental factors without the confounding factor of genetic
variability. Genetically identical K. marmoratus (DC4 lineage) were exposed to
EE2 during both early-life development (28 dph) and continuous exposure (168
dph). Individuals exposed for 28 dph, were exposed to two doses of EE2: one
environmentally relevant dose (4 ng/L) and one high, sub-lethal dose (120
ng/L). Once 28 dph was reached, the individuals were raised in uncontaminated
water until 168 dph. Individuals exposed to 168 dph of EE2 were only exposed
to the environmentally relevant dose of 4 ng/L. Growth, egg lay and related gene
expression (gh, igf1, igf2, era, erb, cyp19a1, cyp19b1, vtg) were measured at
different time-points. Significant accelerated growth was observed in all
exposure groups, with a more pronounced growth effect observed in individuals
exposed to 120 ng/L. While no significant effects on reproduction and gene
expression were observed in individuals exposed to 4 ng/L (early-life and
whole-life stages), individuals exposed to 120 ng/L laid significantly fewer eggs
and reached sexual maturity later. Furthermore, at 28 dph, igf1 was overexpressed followed by an over-expression of igf2 at 168 dph. The results show
that K. marmoratus seem to be resistant to EE2 at low, environmentally doses.
However, at higher doses, both direct and delayed effects (once the EE2
removed) were observed. The fact that effects were observed weeks after
removal of the contaminant shows the importance of studying both constant
exposure as well as early-life exposure.
Résumé
Le 17-α-éthinylestradiol (EE2) est un des perturbateurs endocriniens le plus
étudié et le plus répandu dans les habitats aquatiques. Des effets tels que
l’augmentation de la vitellogenine plasmatique, la diminution de la production d’œufs
et de sperme, la féminisation des mâles, la diminution de fertilité et de fécondité ainsi
que des changements du comportement ont été observés chez la plupart des
organismes exposés à l’EE2. Cependant, il a été démontré que ces effets peuvent
varier en fonction du stade de développement ciblé. Il est donc essentiel d'étudier les
effets d’EE2 durant les premiers stades ainsi que durant l’entièreté du développement
d’un organisme. De ce fait, cette thèse a étudié les effets de l’EE2 sur le phénotype
chez le rivulus des mangroves, Kryptolebias marmoratus. Cette espèce, composée
exclusivement de mâles et d’hermaphrodites, est la seule espèce de vertébrés connue
qui pratique l’autofécondation. Des lignées isogoniques peuvent donc être obtenues
en conditions de laboratoire. K. marmoratus permet ainsi d’étudier les effets d’un
facteur environnemental sur le phénotype tout en éliminant la variabilité génétique.
Dans le cas de cette étude, des individus K. marmoratus génétiquement identiques
(lignée DC4) ont été exposés à de l’EE2 au cours des premiers stades de
développement (28 jours post éclosion (dph)) ainsi que durant l’entièreté de celui-ci
(168 dph). Les individus exposés pour 28 dph, ont été soumis à deux doses d’EE2 :
une dose pertinente pour l’environnement (4 ng/L) et une dose élevée mais sublethale (120 ng/L). Une fois 28 dph atteint, les individus ont été placés dans de l’eau
non contaminée et ont été élevés jusqu’à 168 dph. Les individus exposés pour 168
dph n’ont été soumis qu’à la dose de 4 ng/L. La croissance, la production d’œufs et
l’expression de gnes d’intérêt (gh, igf1, igf2, era, erb, cyp19a1, cyp19b1, vtg) ont été
mesurés à 28 dph et 168 dph. Une augmentation significative de la croissance a été
observée chez tous les groupes exposés à l’EE2. Alors qu’aucun effet sur la
reproduction et l’expression de gêne n’a pu être observé chez les individus exposés à
4 ng/L (pour les premiers stades et l’entièreté du développement), les individus
exposés à 120 ng/L ont pondu significativement moins d’œufs et ont atteint la
maturité sexuelle plus tard. De plus, à 28 dph une surexpression d’igf1 a été mesurée,
suivie d’une surexpression d’igf2 à 168 dph. Ces résultats démontrent que K.
marmoratus serait résistant à de faibles doses d’EE2. Cependant, à des doses plus
élevées, des effets à la fois directs et retardés (après que l’exposition ait cessé) ont été
observés. Le fait que des effets ont été observés des moins après l’arrêt de
l’exposition, démontre l’importance d’étudier les effets induits lors d’une exposition
à différents stades du développement.
Abbreviations
ABO
ActB
AMV
ANOVA
ASR
Aro
BAF
BCF
bp
cDNA
CTLa
CTLb
CWA
Cyp19a1a
Cyp19a1b
DNA
DO
dph
dpf
dw
EDC
E2
EE2
ELISA
EPA
ER
ER α
ER β
ERA
EtOH
EQS
EU
E%
GH
GHR
GH-RH
GLM
GnRH
GtH
HPR
Air-Breathing Organs
β-actin
Avian Myeloblatoma Virus
Analysis Of Variance
Aquatic Surface Respiration
Aromatase
Bioaccumulation Factor
Bioconcentration Factor
Base Pairs
Complementary Deoxyribonucleic Acid
Control individuals of the early-life exposure (28 dph) experiment
Control individuals of the continuous exposure (168 dph) experiment
Clean Water Act
Gonad Aromatase
Brain Aromatase
Deoxyribonucleic Acid
Dissolved Oxygen
Day Post Hatching
Days Post Fecundity
Dry Weight
Endocrine Disrupting Chemicals
17-β-estradiol
17-α-ethinylestradiol
Enzyme-Linked Immunosorbent Assay
Environmental Protection Agency
Estrogen Receptor
Estrogen Receptor Alpha
Estrogen Receptor Beta
Environmental Risk Assessment
Ethanol
Environmental Quality Standards
European Union
Amplification Efficiency
Growth Hormone
Growth Hormone Receptor
Growth Hormone Releasing Hormone
Generalised Linear Model
Gonadotropin Releasing Hormone
Gonadotropin
Horseradish Peroxidase
HVR
IGF
KOC
KOW
LOD
mtDNA
mRNA
miRNA
NEC
NER
PCR
PNEC
PO2
ppt
ppm
SEM
RNA
RPL8
RT
RT-qPCR
R2
TEI
Tm
Ta
USA
VE
VG
Vp
Vtg
ww
4a
4b
120a
Hypoxia Ventilator Responses
Insulin-Like Growth Factor
Carbon-water partition coefficient
Octanol-water partition coefficient
Limit Of Detection
Mitochondrial DNA
Ribonucleic Acid Messenger
microARN
Neuroepithelial Chemoreceptive Cell
Nucleotide Excision Repair
Polymerase Chain Reaction
Predicted No Effect Concentration
Partial pressure of oxygen
Part Per Trillion
Part Per Million
Standard Error of Mean
Ribonucleic Acid
Ribosomal Protein L8
Reverse Transcriptase
Reverse Transcription Real-time Polymerase Chain Reaction
Coefficient of Determination
Transgenerational Epigenetic Inheritance
Melting Temperature
Annealing Temperature
United States of America
Environmental Variance
Genetic Variance
Phenotypic Variance
Vitellogenin
Wet Weight
Individuals exposed to 4 ng EE2/L for 28 dph
Contents
1
Introduction ......................................................................................................................... 9
1.1
Mangrove Rivulus Kryptolebias marmoratus.............................................................. 9
1.1.1
General Characteristics ........................................................................................ 9
1.1.2
Background on Taxonomy and Systematics ........................................................ 9
1.1.3
Ecology and Physiology ..................................................................................... 11
1.1.4
Reproduction ...................................................................................................... 15
1.1.5
Polymorphism and Plasticity .............................................................................. 17
1.2
17-α-ethinylestradiol (EE2) ....................................................................................... 19
1.2.1
Structure and physico-chemical properties ........................................................ 19
1.2.2
Uses and legislation ............................................................................................ 20
1.2.3
Occurrence of EE2 in the Aquatic Environment ................................................ 22
1.2.4
Bioaccumulation................................................................................................. 24
1.2.5
Effect of EE2 on fish biota ................................................................................. 26
2
Objectives ......................................................................................................................... 30
3
Materials and Methods ...................................................................................................... 31
3.1
K. marmoratus Rearing and Experimental Fish ........................................................ 31
3.2
EE2 and Vehicle Control Solutions: .......................................................................... 34
3.3
Measurement of Actual EE2 Concentrations through ELISA: ................................. 34
3.4
Growth Measurement ................................................................................................ 35
3.5
Reproduction Measurements ..................................................................................... 36
3.6
Gene Expression ........................................................................................................ 37
3.6.1
Total RNA Extraction ........................................................................................ 37
3.6.2
DNase Treatment ................................................................................................ 38
3.6.3
Reverse Transcription ........................................................................................ 39
3.6.4
Primer Design and Verification.......................................................................... 39
3.6.5
Optimizing the qPCR Assay .............................................................................. 43
........................................................................................................................................... 46
3.6.6
4
RT-qPCR ............................................................................................................ 46
Results ............................................................................................................................... 48
4.1
Growth ....................................................................................................................... 48
4.1.1
Early-Life Exposure ........................................................................................... 48
4.1.2
Continuous Exposure ......................................................................................... 50
4.2
Reproduction ............................................................................................................. 51
4.2.1
4.2.2
4.3
qPCR .......................................................................................................................... 55
4.3.1
4.3.2
5
Discussion ......................................................................................................................... 60
6
Perspectives ....................................................................................................................... 70
7
Conclusion ........................................................................................................................ 73
1 Introduction
1.1 Mangrove Rivulus Kryptolebias marmoratus
1.1.1 General Characteristics
The mangrove rivulus Kryptolebias marmoratus (formerly known as Rivulus
marmoratus) (Poey, 1880) is a small New World fish belonging to the order
Cyprinodontiformes and the Rivulidae family (Costa, 2006). This ordinary looking
fish of about 60 mm long is dorso-ventrally flat and slender in appearance.
Brownish/grey in colour, differences can be observed between individuals depending
on the substrate which they grew up on (Taylor, 2000). Solely found in mangrove
habitats, K. marmoratus is unique among vertebrates. Indeed, it is the only known
hermaphroditic vertebrate capable of self-fertilizing. They can thus produce near
genetically identical offspring (Harrington, 1961). This reproductive strategy,
known as selfing, is predominantly observed in plants and invertebrates such as
Caenorhabditis elegans (Anderson et al., 2010). Furthermore, both C. elegans and
K. marmoratus are known as androdioecious species, were only males and
hermaphrodites can be found within a population (Garcia et al., 2016). In the case of
K. marmoratus, a slight sexual dimorphism can be observed between the two. In
brief, hermaphrodites can be distinguished by the presence of a dark spot near the
caudal fin while males tend to display abdominal orange pigmentation (Figure 1).
(A)
Figure 1: General appearance of K. marmoratus. Brownish/grey in colour, dorso-ventrally flat and slender in appearance, it
can measure up to 60 mm. A sexual dimorphism can be observed. A) Hermaphrodites can be recognized by the presence of a
dark spot near their caudal fin. B) Males tend to display abdominal orange pigmentation. www.sms.si.edy
1.1.2 Background on Taxonomy and Systematics
While all scientists agree that the Kryptolebias genus is unique among the
Rivulidae family, its taxonomy has been highly disputed (Figure 2). Numerous
misidentifications as well as constantly changing taxonomies have occurred over
the years. For example, recent genetic analysis based on mtDNA sequences and
microsatellites data show that populations which were at first believed to belong
to the K. marmoratus complex could actually be made up of two different
species, Kryptolebias marmoratus and Kryptolebias ocellatus (Tatarenkov et
al., 2010). While this has yet to be confirmed, it shows how uncertain the
taxonomical identification of K. marmoratus individuals is. This uncertainty is
even greater when taking into account that very few genetic researches has been
conducted on other cryptic species such as K. bonairensis and K.
hermaphroditus, which are considered synonym species of K. marmoratus
(ICZN, Case no. 2722, 1992). Furthermore, frequent revisions of this genus
often lead to radical taxonomical re-arrangements. These uncertainties show that
more extensive analyses are required before these nomenclatural discrepancies
can be resolved. It is for this reason that this thesis will follow the taxonomical
classification published by the Catalogue of Fishes (Eschmeyer, 2015) where
all of these hypothetical species are considered as synonymies of K.
marmoratus.
Figure 2: Macro-phylogeny for Cyprinodontiformes showing the general placement of the
genus Kryptolebias. K. marmoratus belongs to the Rivulidae family also known as New World
Rivulines. (Avise and Tatarenkov, 2015)
1.1.3 Ecology and Physiology
1.1.3.1 Habitat
As the common name “mangrove rivulus” implies, K. marmoratus inhabits and
spends its entire life cycle within the mangrove forests (Figure 3). It has thus so far
only been found in the tropical and subtropical eastern Atlantic basin (Taylor 2000)
which includes Brazil, Venezuela, Central America (Honduras, Caribbean, Bahamas,
Belize) and Florida (Davis et al., 1990; Thomerson and Huber, 1992 ; Taylor,
2000). Furthermore, within the mangrove forest K. marmoratus can only be found
within a suite of micro-habitats such as dry shallows, stagnant pools, crab burrows,
under/inside logs and leaf litters (Taylors, 2000; Taylor et al., 2008). Their preferred
habitat being the crab burrows of Cardisoma guanhumi and Ucides cordatus
(Taylors, 2012). All these habitats have common traits of being fossorial and
intermittently dry, thus limiting competition with other species (Taylor, 2012).
Indeed, K. marmoratus is incredibly tolerant to harsh, variable conditions
characteristic of the upland mangrove habitats. Daily varying environmental factors
such as temperature, salinity, hydrogen sulfide, dissolved oxygen and ammonia has
led some scientist to classify K. marmoratus as an extremophile (Wright, 2012).
Additionally, when conditions become too extreme, emersion behaviour can be
observed (Kristensen, 1970 ; Taylor et al., 2008).
Figure 3: Natural distribution of K. marmoratus.
As shown by the green outline, K. marmoratus has
so far been found in the tropical and subtropical
eastern Atlantic Basin. (Image from Anne-Sophie
Voisin)
1.1.3.2 Physical Environmental Parameters
1.1.3.2.1 Temperature
K. marmoratus can tolerate a great range of temperature, varying between 7-38°C
in water (Taylor et al., 1995) and can survive at temperature as low as 5°C when
emersed (Huehner et al., 1985). However, their preferred temperature range is 25 °C
with emersion behaviour already being observed when water temperature drops to
19°C. (Huenher et al., 1985). Considering that K. marmoratus emerges out of the
water when conditions are no longer optimal, it is believed that low temperature is the
primary factor limiting the northern distribution of K. marmoratus (Taylor, 2012).
1.1.3.2.2 Salinity
K. marmoratus can be classified as an euryhaline, with populations naturally living
in pools with a salinity ranging between 0 and 70 ppt (Taylor et al., 1995; Taylor,
2012) with juveniles being reared at 80 ppt in some laboratory conditions (Taylor,
2000). Interestingly, their reproductive capabilities do not seem to be affected by
such a wide range (Lin and Dunson, 1995). K. marmoratus high tolerance to salinity
has led scientist to question why it is not found in more micro-habitats other crab
holes and logs. Two potential explanations have been proposed. The first reason is
that in fresh water pools, competition increases, thus limiting juvenile K. marmoratus
from establishing themselves. Secondly, in mangrove habitats, where drought and
periods of varying tidal inundations are common, it is much more advantageous to be
adapted to high salinity (King et al, 1989; Liang et al., 2008 ).
1.1.3.2.2.1 Dissolved Oxygen
One of the most limiting environmental factors in a mangrove habitat is the low
dissolved oxygen (DO) (King et al., 1989 ; Regan et al., 2011). DO plays an
essential role in both biological and chemical processes and can affect behaviour,
growth and distribution of different organisms (Dantas et al., 2012; Knight et al.,
2013). Low DO in mangrove forests is often due to interactions between processes
such as photosynthesis and respiration, tidal variations and rapid deoxygenation
following mixing of monosulfidic oozes in the water column (Buffoni and
Cappelletti, 1999; Bush et al., 2004) Thus K. marmoratus thrives in extremely
hypoxic conditions and can tolerate low dissolved oxygen concentration ranging
between 0, 6 to 3, 8 ppm (Nordlie, 2006). Very few aquatic species are known to
tolerate such low levels of DO (Wright, 2012). However, it must be mentioned that
when DO becomes too low, at around 0, 2 ppm, K. marmoratus will emerge (Regan
et al., 2011).
In order to survive in an environment with low DO, hypoxia-tolerant organisms
tend to exhibit behaviours such as aquatic surface respiration (ASR) (Chapman and
McKenzie, 2009) as well as hypoxia ventilator responses (HVR) (Perry et al., 2009).
ASR involves ventilation behaviour at the air-water limit where the partial pressure
of oxygen (PO2) is higher than the rest of the water column (Chapman and
Mckenzie, 2009). HVR occurs when the organisms emerges, the decrease in PO2
induces an increase in pulmonary ventilation (Teppema and Dahan, 2010). K.
marmoratus most likely displays these behaviours, however, no study characterising
these acclimatisation behaviour in K. marmoratus has yet been conducted.
1.1.3.2.3 Hydrogen Sulfide
Hydrogen sulfide (H2S) is an extremely common component in mangrove habitats.
Not only is it toxic to most organisms, it also reduces any available DO (Truong et
al., 2006). Low levels of dissolved oxygen in mangrove habitats mean that
microorganisms living in this habitat are generally anaerobes (Knight et al., 2013).
These species will tend to use sulfate instead of oxygen in order to break up organic
matter (Muyzer and Stams, 2008) with one of the waste products of this process
being hydrogen sulfide (H2S). Numerous measurements have found that H2S can vary
greatly depending on the water depth. In mangroves, at surface level, the average H 2S
concentration is around 1, 64 ppm (Rey et al., 1992) and rises as high as 10, 5 ppm in
U. cordatus crab burrows (Taylor, 2012). This concentration decreases when
incoming tides flood the different crab burrows. K. marmoratus can thus survive at
extremely high levels of H2S.
1.1.3.3 Adaptations to Emersion
As mentioned above, when conditions become too harsh, K. marmoratus emerges
out of the water. This is done through various behavioural and physiological
responses in order to cope or escape the unfavourable conditions. In a laboratory
setting, it has been shown that K. marmoratus can survive up to 66 days out of the
water (Taylor, 1990). In its natural habitat, however, K. marmoratus emerges for
shorter periods of time, with individuals re-entering the water several times per day
(Taylors et al., 2004). It is believed that K. marmoratus emerges when it is subjected
to a combination of high H2S concentrations, low temperature and mild hypoxia
(Regan et al., 2011). However, it has been observed that the emersion threshold
varies between individuals and is dependent on the individual’s recent acclimation
history rather than its developmental history (Gibson et al., 2015).
Numerous studies have been conducted on K. marmoratus when emerged in order
to better understand the mechanisms of cutaneous exchange in air-breathing fishes.
Indeed, K. marmoratus solely depends on cutaneous respiration when emerged as no
accessory air-breathing organs (ABO) have yet been documented. Thus the
mechanisms allowing the continuous transport of O2/CO2, balance of ions and water
and prevent the accumulation ammonia are mostly different in K. marmoratus,
compared to organisms using ABOs.
1.1.3.3.1 Gill Plasticity
For all fish, the gills play a crucial role in the exchange between the external and
internal environment. Gaseous exchange, excretion of nitrogenous wastes, acid–base
regulation, and osmoregulation and ion regulation occur around the gills (Evans et al.
2005; LeBlanc et al., 2010). In non-adapted fishes, when gills are exposed to air, the
secondary lamellae collapses due to high surface tension, thus reducing the surface
area available for the different types of exchange (Lam et al., 2006). In K.
marmoratus, however, their gills are remodelled when emerged. A cell mass, known
as the interlamellar cell mass, appears between the lamellae (Figure 4). While this
reduces the gill’s surface, the fact that it is reversible prevents the lamellae from
collapsing, thus allowing rapid gill re-acclimatisation when returning to the water
(Ong et al., 2007; Turko et al, 2014).
Figure 4 : Representative light micrographs of gills filaments and lamellae of A) control K. marmoratus in
water, B) exposed to air for 1 week and C) recovered in water for 1 week. Scale bar = 50µm. (Ong et al., 2007)
1.1.3.3.2 Gaseous Exchange
It is thanks to chemoreceptive neuroepithelial cells (NECs) in gills and over the
entire cutaneous surface that K. marmoratus can detect oxygen levels in the
environment (Saltys et al.., 2005). Furthermore, it is believed that these NECs also
play a role in regulating the different emersion responses, such as cutaneous
respiration, which are made possible through various acclimatisation processes
(Regan et al., 2011; Robertson et al., 2015).
Additionally, gaseous exchange is facilitated by increasing the cutaneous blood
flow. The dorsal epidermis of K. marmoratus contains numerous capillaries within
1µm of the skin’s surface allowing for a very short diffusion distance between air and
blood (Grizzle and Thiyagarajah, 1987; Nordlie, 2006). Furthermore, long term
emersion was shown to induce cutaneous angiogenesis, as well as an increase in the
number of caudal endothelial cell in K. marmoratus (Cooper et al., 2012). All of
these changes have an accumulative impact on the exchange of gas during emersion
periods.
1.1.3.3.3 Ammonia excretion
It is a well-known fact, that ammonia, while naturally excreted by fish, is a
neurotoxin and can thus become toxic at elevated concentrations (Ip et al., 2001).
In water, most fish species excrete ammonia through their gills by way of ammonia
gas channels, known as the Rhesus glycoproteins (Hung et al., 2007 ; Wright and
Wood, 2009). This prevents ammonia from accumulating in the tissues and allows
efficient elimination of nitrogen waste. However, the diffusion of ammonia down
the gills in not possible when K. marmoratus is out of the water. While ammonia
can be converted into a less toxic compound, such as urea (Frick and Wright,
2002), it has been shown, that K. marmoratus primarily volatilises the ammonia
through its cutaneous surface (Litwiller et al., 2006 ; Cooper et al., 2013). It was
thus shown, that after being emersed for 10 days, no significant whole-body
accumulation of ammonia could be detected in K. marmoratus (Frick and Wright,
2002; Cooper et al., 2012).
1.1.4 Reproduction
As briefly descripted above, K. marmoratus utilises a unique reproduction
strategy compared to other vertebrates. While most vertebrate sole rely on sexual
reproduction (De Beer, 2011), K. marmoratus primarily reproduces through
selfing. It must be mentioned, however, that parthenogenesis has been observed in
some vertebrate species such as amphibians, bony fishes, reptiles and recently in
cartilaginous fishes (Booth et al., 2012; van der Kooi and Schwander, 2015).
This reproductive strategy allows a gamete to develop without fertilization and is
thus similar to selfing. However, most vertebrates who perform parthenogenesis
are known as automixis (automictic parthenogenesis) and thus the off-springs
cannot be considered as true clones (Zakharov, 2005). In the wild, populations are
androdioecious with hermaphrodites being present in greater numbers than males
(Garcia et al., 2016). No females have been naturally observed or collected. One
study mentioned how they tried to induce females in laboratory conditions by
exposing juveniles 7 days post-hatching to 1 ppb ethinylestradiol for 3 weeks
(Orlando et al., 2006). While the authors claimed that females were induced, the
results was never published. The hermaphrodite/male ratio varies depending on the
geographical location. For example, up to 25% of the Belize Keys population is
made up of males (Turner et al., 1992). This is relatively high compared to 13 %
of males making up the Florida Keys population (Turner et al., 2006). Sexual
maturity for hermaphrodite is reached after 3 to 4 months post hatching (Lee et al.,
2008). K. marmoratus hermaphrodites can be classified as simultaneous
hermaphrodites as their gonads simultaneously produces eggs and sperm enabling
internal self-fertilization (Harrington, 1961; Mourabit et al., 2011). Continuous
selfing will result in highly homozygous lineages made up of individuals capable
of producing offspring which are genetically identical to one another
(Machiewicz et al., 2006). However, in the wild the presence of heterozygote
lineages indicate that K. marmoratus also utilises outcrossing as a reproduction
strategy between males and hermaphrodites (Machiewicz et al., 2006).
As mentioned, the ratio male/hermaphrodite varies from one location to the
next. These variations are most probably due to the influence of different
environmental factors during the developmental stage and through the appearance
of secondary males. However, these environmental factors have not all been
determined. Early studies have discovered that when embryos are reared at low
temperatures, between 18 and 20 °C, primary males were more abundant than
hermaphrodites. However, at higher temperatures, 30 °C, very few males
developed (Harrington, 1967). While primary males are easily obtained in
laboratory, the temperatures necessary to obtain these males are much lower than
what is normally measured in mangrove habitats (Turner et al., 2006). It is thus
believed that natural outcrossing is made possible by the presence of secondary
males. Secondary males are hermaphrodites which have invested more energy in
the development of the testicular tissue rather than the ovarian tissues leading to a
‘sex change’ (Harrington, 1971; Tuner at al., 2006). Approximately 60 % of
hermaphroditic individuals transform into secondary males (Lee et al., 2008). The
abundance of secondary males surprised some scientist. Indeed, the fitness payoff
of a sex change is extremely high (Garcia et al., 2016). One study showed
differences in energy allocation in physiology and reproductive processes between
secondary males and hermaphrodites, thus explaining how such a sex change is
made possible (Garcia et al., 2016). Furthermore, it is believed that maintaining
adult hermaphrodites at temperature higher than 26°C favours the occurrence of
secondary males (Tuner et al., 2006). However, the natural environmental factors
and mechanisms allowing for the development of secondary males have also not
all been determined.
1.1.5 Polymorphism and Plasticity
Nevertheless, it is K. marmoratus’s ability to self –fertilize that interest most
scientist. The possibility of obtaining isogenic laboratory strains makes K.
marmoratus an ideal model organism. Indeed, among other things, K. marmoratus
allow scientists to study the effects of an environmental factor on the phenotype
without the confusing factor of genotype. Differences in responses to an
environmental factor between lineages may not only allow scientists to identify
genes and proteins implicated in physiological pathways, it will also allow them to
understand the importance of phenotypic plasticity (Tatarenkov et al., 2012).
Numerous laboratory studies conducted on K. marmoratus which included the
genotype as an independent variable discovered significant differences of
behaviour, morphology and physiology not only between but also within
homozygous lineages (Carnacho et al., 2005 ; Earley and Hsu, 2008 ; Wells et
al, 2015). This can seem surprising considering that the isogenic laboratory strains
used are near genetically identical. Phenotypic plasticity has been proposed in
order to explain these differences (Tatarenkov et al., 2012).
Phenotypic diversity can be observed in every species and populations. It is thus
important to understand the mechanisms that allow for these differences to appear
between individuals. Phenotypic plasticity can be represented through measurable
variations and can thus be analysed through statistical measurements. The variance
of a phenotypic trait can be represented as follows: VP = VG + VE + VGxE, where
the population’s phenotypic variance (VP) is partitioned into genetic variance (VG)
(proportion of phenotype variance attributable to genes), environmental variance
(VE) (proportion of phenotype variance caused by the environment) and the
interaction between genotype and the environment (Oomen and Hutching, 2015).
It is the interaction between the environment and the genotype that allows for a
single genotype to produce different phenotypes. The full range of phenotypes that
a genotype can produce across a range of environments (environmental gradient) is
known as a ‘reaction norm’. These reaction norms can either be continuous or
discontinuous (Figure 5). A continuous reaction norm occurs when the phenotype
varies continuously with changes in the environment while a discontinuous
reaction norm represents the different phenotypes which are adopted only when
certain environmental thresholds are attained (Oomen and Hutching, 2015).
Figure 5: Types of reaction norms. A) Continuous reaction norm for different phenotypes. B)
Discontinuous reaction norms according to certain environmental threshold attained.
Phenotypic plasticity can be classified in different ways. One could classify the
types of phenotypic plasticity based on the nature of the interested trait
(morphological, physiological and behavioural) or the nature of the changing
environmental factor (such as diet, population density or temperature) (Nijhout,
2003; Fusco and Minelli, 2010). Most scientists first determine whether the
phenotype change is reversible or not and whether the change is anticipatory or
responsive (West-Eberhard 2003). Indeed, some plastic responses are
anticipatory, in that individuals initiate phenotypic change before the appearance of
the new environmental conditions. Other plastic responses, on the other hand, are
responsive and are only triggered after the appearance of the new environment. By
identifying these characteristics, phenotypic plasticity can thus be classified into
four categories: developmental plasticity, polyphenism, phenotypic flexibility, and
life-cycle staging. Developmental plasticity is the phenotypic changes that occur
during the prezygotic and early postzygotic developmental phases due to the
external environment conditions. These changes during the developmental stages
tent to have irreversible effect on the phenotype of the mature organism. (Beaman
et al., 2016). Polyphenism occurs when the genotype produces two or more
discreet phenotypes due to changing environmental factors. A common example is
the sex-determining polyphenism found in some reptiles (Ragsdale et al., 2013).
The discrete nature of polyphonic traits are known as ‘all or nothing’ traits and are
different from traits such as weight and height, which are also dependent on
environmental conditions but vary continuously across an environmental gradient.
Phenotypic flexibility is a type of phenotypic plasticity that is reversible once the
environmental factor which caused the change in phenotype has disappears
(Piersma and Drent, 2003). Life-cycle staging is a cycling, reversible type of
phenotypic plasticity in response to predictable seasonal changes, such as winter
colour change in fur of sub-Artic birds and mammals (Beaman et al., 2016).
It is generally accepted that phenotypic plasticity is more frequent in immobile
organisms, such as plants, compared to mobile organisms. This is due to the simple
fact that mobile organisms can easily move away from unfavourable environments
(Moczek et al., 2011). The ecological and evolutionary role of phenotypic
plasticity, however, is still a highly debated issue. Nevertheless, it is accepted that
phenotypic plasticity is an important process that allows organisms to cope with
environmental unpredictability and heterogeneity. While the effect of natural
environmental factors such as salinity, temperature and photoperiod on phenotypic
plasticity has been widely studied on numerous clonal organisms, including K.
marmoratus (Harrinton 1967, 1968, 1971; Lin and Dunson, 1995; Taylor 2000;
Turner et al., 2006; Richards and al., 2011) few studies have been conducted to
understand the effects of xenobiotic chemicals, such as endocrine disruptors
(EDC), on phenotypic plasticity. K. marmoratus has already been used in
ecotoxicity studies where the effect of EDCs, such as 17-α-ethinylestradiol, on
gene expression patterns where observed (Seo et al., 2006; Johnson et al., 2015).
1.2 17-α-ethinylestradiol (EE2)
1.2.1 Structure and physico-chemical properties
17-α-ethinylestradiol (EE2) is a synthetic estrogen derived from the natural
steroidal estrogen 17-β-estradiol (E2). It is an odourless, fine white powder often
used together with other steroid hormones, mainly progestogen, as an oral
contraceptive (Pubchem, 2016). The only other known estrogen used in
contraceptive pills is mestranol, which is converted to EE2 before being biologically
active (Elks, 2014). EE2 is composed of an estrane nucleus with an acetylene
function inserted on the α C17 (Figure 6). This acetylene function makes the EE2
molecules more resistant to bacterial and liver degradation compared to other
natural estrogens (Picazo et al., 2010 ; Zhang et al., 2011). Furthermore, it also
provides a high resistance to wastewater treatment processes, thus giving EE2 a
longer half-life compared to other estrogenic counterparts (Atkinson et al., 2011).
Figure 6 : Chemical Structure of 17-α-ethinylestradiol. EE2 is derived from an
estran nucleus with an acetylene function inserted on the α C17 (Maes, 2011).
As shown in Table 1, EE2 has a low water solubility of 11, 3 mg/L, which
controls its distribution in aquatic habitats and influences its biodegradation and
bioaccumulation potential. (Versonnen, 2004). It is, however, relatively soluble in
heavy alcohols such as ethanol with a 1 part EE2 to 6 parts ethanol (Versonnen,
2004). It also possesses a relatively high octanol-water partition coefficient (Kow)
meaning it is lipophilic and thus has a high theoretical bioaccumulation potential.
Furthermore, EE2 is not considered a volatile substance, with a vapour pressure of
1,95 10-9 mm Hg (Pojana et al., 2007).
Table 1 : Main physico-chemical properties of 17-α-ethinylestradiol (Pubchem, 2016)
Molecular Formula
Molecular Weight
Melting Point
Water Solubility
Vapour Pressure
Log Kow
C20H2402
296, 41 g/mol
181 °C
11.3 mg/L at 27°C
1,95 10-9 mm Hg at 25°C
3,67
1.2.2 Uses and legislation
As mentioned, EE2 is used, in combination with other steroid hormones, in
order to make oral contraceptive pills, contraceptive patches and vaginal rings. It is
also administered alone as an estrogen treatment and can be found in different
types of medicines used against diseases such as amenorrhea, breast cancer,
hypogonadism, menopausal disorders and prostatic cancer (Ying et al., 2002).
Furthermore, it is widely used in estrogenic hormone therapies in the veterinary
and agricultural field in order to promote growth and prevent reproductive
disorders (Ying et al., 2002 ; Bartelt-Hunt et al., 2012). It is also used in
aquaculture in order to develop single-sex populations of fish which, once again,
optimises growth (Kötter et al., 2008). It is believed that nearly 200 million
women have taken the contraceptive pill to date making it one of the most
commonly used medications in the world (Gogos, 2014). Depending on the type of
contraceptive pill, concentrations of EE2 can vary between 15 – 50 µg per pill
(Leon and Philip, 2005). The main function of EE2 is to mimic natural estradiol.
It thus binds to estrogen receptor complexes and enters the nucleus, activating
DNA transcription of genes involved in estrogenic cellular responses (Zhu and
Conney, 1998 ; Vader, 2000). Its binding affinity to the estrogen receptors is two
to five times higher than E2 making it a more potent estrogen compound (Saaristo
et al., 2010 ; Tomsiková et al., 2012). In some fishes, EE2 was found to being 11
– 30 times more potent than E2 and 2.3 – 3.2 time more potent than Estrone (E1)
(de Mes et al., 2005 ; Colman et al., 2009).
Most legislations concerning EE2 have been implemented in order to regulate its
concentration in the different water compartments. EE2 is introduced into the
water through two main routes (Figure 7); either from wastewater effluents, which
is due to the fact that EE2 and its conjugates compounds are incompletely removed
from effluents when treated by conventional sewage treatment stations (Larcher et
al., 2012), or through runoff into surface water near agricultural sites (Xu et al.,
2009). The effectiveness of wastewater treatment plants in removing EE2 varies
between 35 to 90% (Langston et al., 2005 ; Clouzot et al., 2008). This results in
concentrations of EE2 ranging between 0.1 and 34 ng/L measured in most
European effluents (Cluzot et al., 2008 ; Patridge et al., 2010). This concentration
varies depending on the season and effectiveness of the water treatment, with the
highest concentration of EE2 being measured in urbanized regions (Patridge et al.,
2010). This inability to sufficiently remove EE2 from wastewater has led to EE2
being detected in treated drinking water. Furthermore, numerous ecotoxicological
studies have warned of EE2’s toxicity potential. Thus, in the European Union, the
2013 Directive 2013/39/EU65 decided to include EE2 in the list of priority
substances. An Environmental Quality Standards (EQS) of 0,035 ng/L was decided
(Loos, 2012). In the United States, however, no natural or synthetic estrogen was
placed in the Clean Water Act (CWA) which is revised yearly by the
Environmental Protection Agency (EPA) (EPA, 2015). Interestingly in both the
EU and USA, no maximum tolerable concentration for any estrogen molecule has
been implemented concerning water used for human consumption (Laurenson et
al., 2014). The small amount of regulations concerning EE2 and other estrogenic
compounds is due to a lack of feasible and effective research. Moreover,
implementing lower EQS would lead to high inherent cost in order for sewage
treatment stations and pharmaceutical companies to meet such standards (Owen
and Jobling, 2012).
Figure 7: Main sources of hormones in the different water bodies. EE2 is
primarily released into the different water bodies due to incomplete removal by
conventional sewage treatment stations and due to runoff near agricultural sites.
(Maes, 2012)
1.2.3 Occurrence of EE2 in the Aquatic Environment
1.2.3.1 Occurrence of EE2 in water bodies
Measured environmental concentration of EE2 in Europe ranges between 0, 1
and 34, 0 ng/L as shown in Table 2.
Table 2 : Measured environmental concentrations (MEC) of 17-α-ethinylestradiol in water bodies of
different countries
Country
The Netherlands
Germany
France
Italy
China
South Florida USA
Mangrove habitat Brazil
MEC (ng/L)
0,1 – 4,3
0,05 – 5,1
1,1 – 2,9
0,8 – 34,0
0,1 – 35,6
0,05 – 831,0
0,05 – 25,0
References
Belfroid et al., 1999
Kuch and Ballschmiter, 2001
Cargouet et al., 2004
Pojana et al., 2007
Lei et al., 2009
Kolpin et al., 2005
Froehner et al., 2012
It should be mentioned that some concentrations are below most detection
methods. Methods such as liquid-liquid extractions and derivatization are capable
of detecting a minimum concentration level 1, 5 ng/L EE2 (Martinez et al., 2012 ;
Patel et al., 2013). This implies that most determinations of environmental EE2
concentrations are not reliable. These concentrations often represent estimations as
the methods used aren’t adapted to detect such low concentrations. These
concentrations thus cannot be used in the environmental risk assessments (ERA)
making it very hard to determine a predicted no effect concentration (PNEC).
Therefore studies have determined, using different models, which European
countries are below or above the 0,035 ng/L EQS set by the EU (Johnson et al.,
2013) (Figure 8). As of 2013, most countries seem to be below such standards.
Figure 8 : European Surface Waters where EE2 concentrations
are predicted to exceed the EQS of 0,035 ng/L based on chemical
discharges. (Johnson et al., 2013)
1.2.3.2 Occurrence of EE2 in the sediments
As mentioned, the Kow of EE2 is relatively high. The Kow is the ratio of the
solubility of a compound in octanol to its solubility in water (Pontolillo and
Eganhouse, 2001). Log Kow is a relative indicator of the hydrophobicity of a
compound (Lai et al., 2002) and thus indicates a compounds tendency to sorb to
organic matrices. The fact that EE2 has a strong hydrophobic characteristic
combined with its low water solubility and low vapour pressure indicates that it
likely has a high affinity for solids, and thus limiting its aqueous phase
concentration (Langston et al., 2005). This is confirmed by its soil organic carbonwater partition coefficient Koc. The Koc is the ratio of the mass of a compound
adsorbed in the soil to the mass of the compound in water (Pontillo and
Eganhouse, 2001). The Log Koc of EE2 for sorption to river colloids is 4,7 which
is relatively high. This confirms that, when present in rivers, EE2 is most likely
associated to colloidal material. The sediment thus acts as a sink for EE2
compounds in rivers, estuaries and marine environments, with EE2 sediment
concentrations ranging between 0,12 – 22,8 ng/g in rivers, 0,05 – 2,52 ng/h in
estuaries and 0,05 – 3,6 ng/g in coastal marine areas (Labadie and Hill, 2007). It
was estimated that up to 30 % of EE2 present in the water phase will adsorb to
suspended solids (Zhou et al.; 2007). Furthermore, EE2 tend to show more affinity
to sediments compared to other natural estrogens. It was shown that EE2 has an
affinity factor 3, 1 higher than E2 (Robinson et al., 2009). Furthermore, EE2
concentrations in sediments, as shown in Table 3, are in the µg/kg, benthic
organisms are thus more likely exposed to higher concentrations of EE2 than freeswimming species. It is believed that EE2 concentrations are 1000 times higher in
bed sediments than in the upper levels of the water column (Robinson et al.,
2009).
Table 3 : Measured environmental concentrations (MEC) of 17-α-ethinylestradiol in sediments
of different countries
Country
Germany
UK
Spain
Italy
China
Mangrove habitat, Brazil
MEC (µg/kg)
0,4 – 0,9
0,4 – 12,0
0,5 – 22,8
2 – 41,0
0,1 – 9,3
1,33
References
Ternes et al., 2002
Lui et al., 2004
Barcelo, 2001
Pojana et al., 2007
Lei et al., 2009
Froehner et al., 2012
1.2.4 Bioaccumulation
Bioaccumulation occurs when a substance, which has accumulated in an
organism, is accumulated at a faster rate than it is metabolised or excreted
(Mackay and Fraser, 2000). This entails that the concentration of the substance is
at a higher concentration within the organism than it is in its surrounding
environment. Furthermore, we refer to bioaccumulation as bioconcentration when
the uptake of a substance is restricted to respiration or absorption through the skin
without taking into account the uptake through dietary absorption (Mackay and
Fraser, 2000). Often, the log Kow is used as a primary indicator of the
accumulation potential of a substance. Thus, considering the relatively high Kow of
EE2, it should easily accumulate in the lipolytic tissues of organisms. However, it
is more common to refer to the bioaccumulation/bioconcentration factor
(BAF/BCF) in order to determine the accumulation potential of a substance. In the
case of EE2, the BAF is more appropriate. Indeed, as discussed, EE2 does not as
easily dissolve in water as it easily adsorbs to particles in the water. These particles
often serve as food sources to organisms; taking into account the dietary intake is
thus important. However, very little research has been conducted on the
bioaccumulation/bioconcentration potential of EE2. One study calculated a BCF of
610 L/kg wet weight (ww) for fathead minnows Pimephales promelas exposed to
16 ng/L EE2 for 158 days (Lange et al., 2001). Nonetheless, considering that the
concentration induced toxic effects, the BCF must be taken with caution. The same
study, using the limit of detection (LOD), estimated that the BCF in healthy fish
should be below 500 L/kg ww.
Even less research has been conducted on the bioaccumulation/bioconcentration
potential of EE2 in phytoplankton. This is surprising considering that they are the
most abundant source of food in water column and play an important role in the
biomagnification of hydrophobic compounds in the food chain (Aris et al., 2014).
However, several studies have been conducted on invertebrates. Concentrations of
38 µg EE2/kg dry weight (dw) were detected in Mediterranean mussels, Mytilus
galloprovinciallis (Pojana et al., 2007). A BAF of 1400 L/KG dw could thus be
calculated. The potential of EE2 to bioaccumulate in benthic invertebrates was also
determined. One study exposed the midge Chironomus tentans and the freshwater
amphipod Hyalella azteca to EE2 concentrations of 0,2 and 3,1 mg/L (Dussault et
al., 2009). After 21 days a BAF of 18 to 215 L/kg dw for C. tentans and 34 to 142
L/kg dw for H. Azteca was calculated for each respective EE2 concentrations
Due to the lack of data on the bioaccumulation and biomagnification potential of
EE2 and other steroid estrogens, scientist have attempted to predict the BAFs for a
range of different organisms using a food-web model (Lai et al., 2002) (Figure 9).
Figure 9: Predicted bioaccumulation factors (BAF) of 17-α-ethinylestradiol for different
organisms, calculated with a food-web model (Lai et al., 2002)
While the model seems to conclude that EE2 only slightly biomagnifies within
the food chain, numerous missing data and inaccurate data input means that the
model can only be viewed as an approximation. Additional information, such as
realistic measurements of sediment concentrations of EE2 as well as species
specific metabolic and elimination rates, are still required in order to further
develop the model. Thus more research is required to better understand the
environmental significance of EE2.
1.2.5 Effect of EE2 on fish biota
The toxic potential of EE2 has been extensively studied, with numerous studies
concluding that EE2 is toxic to a large number of different organisms. It has been
found to interfere with the normal functioning of the endocrine systems and can
thus be classified as an endocrine disrupting chemical (EDC). These compounds
include both natural and industrially made compounds such as estrogens,
androgens, phytoestrogens, polycyclic aromatic hydrocarbons, polychlorobuphenyl and nonyphenols, to name but a few (Aris et al., 2014). In general, EDCs
have been shown to mimic or antagonise endogenous hormones as well as disrupt
the synthesis and metabolism of endogenous hormones and hormone receptors.
This leads to the disruption of the endocrine system at multiple levels of an
organism (Zhang et al., 2009 ; Silva et al., 2012 ; Yan et al., 2012). EE2 has been
shown to being a potent EDC. Effects such as increases in plasma vitellogenin,
decrease in egg and sperm production, feminisation, reduced fertility and fecundity
and changes in behaviour have been observed in most organisms exposed to EE2
concentrations as low as ng/L (Robinson et Hellous, 2009). These effects are
particularly dangerous to juveniles who are more prone to EE2 exposure. This can
thus, indirectly or directly, reduce the survival and growth potential of numerous
organisms which in turn reduces their reproductive success and population levels.
1.2.5.1 Effects on reproduction
The biggest effect of EE2 is its interaction with estrogen receptors found in
ovaries, the pituitary and hypothalamus (Vos et al., 2000). When the hypothalamus
is stimulated by external stimuli, gonadotropin releasing hormone (GnRH) is
released. GnRH then binds to the anterior pituitary which in turn releases
gonadotropin (GtH). This stimulates gonadal development and production of
steroid hormones. A feedback mechanism exists, where the gonads can signal back
their status to the pituitary and hypothalamus. Depending on which estrogen
receptor EE2 binds to, GtH released is either increased or decreased. Changes in
natural GtH concentration can thus lead to the production of smaller eggs and/or
inhibit the ovulation of females, whilst in males it can disrupt the testicular
function and reduce sperm quality and quantity of males (Kime, 1999). For
example when juvenile male medaka Oryzia latipes were exposed to 100 ng/L of
EE2 for 2 months, sex reversals were observed with males developing ovaries and
aromatase being detected in the testis (Scholz and Gutzeit, 2000). They also
showed feminised sexual characteristics with the development of urogenital
papillae and change in body colour. In the same experiment, females were exposed
to 10 and 100 ng/L EE2 and showed a reduction in the gonadal weight which
resulted in a decrease in egg production.
The elevation of plasma vitellogenin can also be observed in males and juveniles
exposed to EE2 concentrations. Vitellogenin is normally only produced by mature
oviparous females and is an estrogen-inducible yolk precursor protein normally
found in blood or hemolymph (Humble et al., 2013). It is synthesised by the liver
and the synthesis is activated by the binding of E2 to estrogen receptors in
hepatocytes. The cells thus release the vitellogenin into the plasma before it
reaches the ovaries where it is incorporated into the yolk of growing egg cells.
While males and juvenile possess the vitellogenin genes, under normal conditions,
the expression of these genes are never activated, for no E2 (or EE2) should be
circulating in their bloodstream. One study showed that 1.3 mg/ml of vitellogenin
was produced by juvenile rainbow trout Oncorhynchus mykiss when exposed to
wastewater effluent which contained 4.5 ng/L of EE2 (Larsson et al., 1999).
Furthermore, it was found that the expression of vitellogenin is dose-dependent of
the concentration of EE2 (Örn et al., 2003). The presence of vitellogenin in
juveniles and males has become a reliable biomarker for estrogen exposure.
1.2.5.2 Changes in behaviour
While EE2 is known to feminise the reproduction organs of numerous fish
species, it has also an additional effect on male behaviour. Changes in social
dominance and courtship behaviour have been observed in numerous studies, all
concluding that these changes in behaviour have a negative effect on the
reproduction success of the exposed organisms. For example, zebrafish males
exposed to 0.05 ng/L for 6 days showed a decrease in the frequency of courtship
behaviour, and this in particular in dominant males (Colman et al., 2009).
Some studies found that EE2 can have a significant effect on migration and
shoaling behaviours. Indeed, vertical migration pattern of the black-striped pipefish
were altered when exposed to concentrations ranging between 8 and 36 ng/L EE2
for 40 days (Sárria et al., 2011). Pipefish new-borns normally show specific
benthic behaviours; however, when exposed to EE2, they tended to shift their
vertical distribution towards the surface, thus lowering the survival rate of the
population. A change in the shoaling behaviour of the zebrafish was also observed
when individuals were exposed to 5 and 25 ng/L of EE2 for 14 days (Rayhanian
et al., 2011). The latency and swimming activity was significantly reduces with
some individuals spending most of their time at the surface.
1.2.5.3 Carcinogenic Effects
It is believed that EE2 is a strong promotor of hepatic tumours formations which
in turn reduces the organism’s ability to repair DNA adducts by nucleotide
excision repair (NER) (Notch et al., 2007). NER are the primary DNA repair
pathway and are responsible for removing DNA damage induced by ultraviolet
light through the formation of bulky DNA adducts (Fuss and Cooper, 2006).
When male, adult zebrafish were exposed to 100 ng/L EE2 for 168 h, a significant
decrease in the transcript of hepatic NER was observed (Hoffman et al., 2006).
The same study showed the EE2 significantly affected gene expression of E2,
testosterone and vitellogenin with a gene ontology analysis revealing that, in
general, EE2 affected genes involved in hormone metabolism, vitamin A
metabolism, steroid binding, sterol metabolism and cell growth.
1.2.5.4 Delayed effect
When determining the effects of a potentially toxic compound, it is important to
determine whether or not organisms can recovers from the effects once the
exposure has ceased. Concerning EE2, this issue has not been resolved. One study
showed that after life-long exposure to 9 ng/L EE2, the reproduction of male
zebrafish was permanently inhibited. A three months purification period did not
restore their fertilization success, with vitellogenin concentration remaining high
and no change in gonad morphology being observed (Schafers et al., 2007).
However, a similar study showed that male fish were able to recover when exposed
to a lower concentration of 1 ng/L EE2 (Schafers et al., 2007). Therefore, some
studies have shown that recovering from the effects of EE2 is possible. One study
observed a higher reproductive success in the F1 generation compared to the F0
generation which was exposed to 5 ng/L EE2 (Nash et al., 2004). It would thus
seem that few to no trans-generational effects can be determined after exposure to
EE2. Another experiment showed that when zebrafish are exposed to 5 ng/L EE2,
up to 95 % of males developed into phenotypic females (Larsen et al., 2009).
However, when these males were transferred into clean water, one third of these
males reverted back into phenotypic males.
One study, yet to be published, exposed K. marmoratus hatchlings to either 0, 4
or 120 ng/L EE2 for 28 days (Voisin et al., 2016). The juveniles were then
transferred into clean water for 168 days before their liver, gonads and brains were
collected. Growth, egg production and steroid hormone levels (estradiol, cortisol,
11-ketotestosterone and testosterone) were measured throughout the 168 days. It
was discovered that individuals exposed to both EE2 concentrations were
significantly smaller compared to the control groups. However, compensatory
growth was observed when the exposed individuals were transferred into
uncontaminated water. Furthermore, while no effect on reproduction was observed,
individuals exposed to 120 ng/L EE2 showed higher levels of testosterones and 11ketotestosterone. Both of these androgen hormones are essential in the
development of the reproductive tissues as well as play a key role in secondary
sexual characteristics in males. An increase in androgen hormones is surprising,
considering the fact the K. marmoratus individuals were exposed to a feminizing
hormone.
2 Objectives
This thesis aims to better understand the impacts of early-life and continuous exposure
to different EE2 doses. The starting hypothesis is that a disturbance due to a pollutant
during the developmental stages can have both direct and delayed effect on an adult’s
phenotype. By using an organism such as K. marmoratus, the effects of EE2 without the
confounding factors of genotype can be investigated. For this purpose, we exposed K.
marmoratus individuals, belonging to the same isogenic lineage (DC4), to EE2 for 28 dph
and 168 dph. Individuals exposed during their early life stages (28 dph) were exposed to
two doses of EE2: one environmentally relevant dose (4 ng/L) and a high, sub-lethal dose
(120 ng/L). Once 28 dph was reached, the individuals were raised in uncontaminated
water until 168 dph. Individuals who were constantly exposed, were exposed for 168 dph
and only to the environmentally relevant dose of 4 ng/L. Different phenotypic endpoints
(growth and reproduction) as well as expression of genes known to being involved in
growth, reproduction and steroidogenesis (Growth Hormone gh, Insulin-like Growth
Factor 1 and 2 igf1/igf2, Estrogen receptors α and β era/erb, aromatase α and β
cyp19a1a/cyp19a1b and Vitellogenin vtg) were measured at different time points.
Based on results obtained in Voisin et al., 2016, it can be hypothesised that individuals
exposed to 4 ng/L and 120 ng/L for 28 dph will at first show retarded growth before a
compensatory growth mechanism kicks in once the EDC is removed. The intensity of the
effect should be dose dependent. Thus, it can be expected that gene expression of all or
some genes involved in the growth process (gh, igf1 and igf2) will at first be downregulated before being highly up-regulated once the fish is placed in untreated water.
Concerning individuals exposed for 168 dph, it can be hypothesised that growth
retardation will be observed throughout leading to a constant down regulation of gh and/or
igf1/2.
Furthermore, taking into account that K. marmoratus individuals, when exposed to 4
ng/L and 120 ng/L for 28 dph showed a delayed increase in testosterone and 11ketotestosterone, it could be assumed that key enzymes involved in the steroidogenesis
will be affected by the EE2 exposure. Furthermore, an impact on known sex hormones
will most likely induce changes in reproduction and sexual differentiation. Thus alteration
in both estrogen receptors and aromatase gene expression could be expected to occur, in a
dose and time dependent manner. Thus could lead to impaired reproduction capabilities
and perhaps even disrupted hermaphrodite/male proportions. These measurements will
give a better insight into the mechanisms involved during EE2 contamination at different
targeted development time-points.
3 Materials and Methods
3.1 K. marmoratus Rearing and Experimental Fish
The individuals used in this experiment were exclusively obtained from F3
and older isogenic generations of K. marmoratus. Individuals were reared at the
University of Namur, in the Laboratory of Evolutionary and Adaptive
Physiology. In brief, F0 individuals, from the DC4 lineage, were collected, by
our collaborative partner Prof. R. Early (University of Alabama), in 2010 in the
Florida Keys (Dove Creek, Tavernier, Florida, N25°01’45.64”,
W080°29.49.24”). These individuals were mainly found in blue land crab
(Cardisoma guanhumi) burrows. The F0 individuals were brought back to the
University of Alabama, Tuscaloosa, and F1 and F2 isogenic generations were
obtained by allowing isolated F0 individuals to self-fertilize. Several of these F2
adults and eggs were then transported back to the University of Namur. Eggs
from self-fertilizing F2 individuals were collected, thus constituting the F3
generation. Upon hatching, the F3 larvae were individually transferred into 1.2 L
plastic containers with 400 mL of 25 ppt reconstituted water (Instant Ocean TM
sea salt). The fish were raised in controlled conditions with a constant
temperature of 26 ± 2 °C and 12/12H photoperiod. Thus individuals from F3 and
more recent generations make up the stock population, allowing for a large
number of eggs to be collected in a small amount of time, when needed.
Larvae were fed daily with 1 mL of newly hatched brine shrimp (Artemia)
naupii for 28 days. The individuals that were not sacrificed after 28 dph were
fed 2 mL of Artemia until 84 dph (time at which sexual maturity is expected to
be reached), at which point they were fed with 4 mL of Artemia until sacrificed.
In the case of this experiment, 180 eggs were collected, over a period of one
month, from the stock population (now composed of F3 to F6 sexually matured
individuals). Each egg was individually placed in a single well within a 6multiwell plate, each well containing 25 ppt reconstituted water. The water was
changed once a week until hatching. Once hatched, the larvae were placed in
glass jars containing 100 mL of 25 ppt reconstituted water and corresponding
treatment was added. 3 treatments were used: a vehicle control (0.000012 %
EtOH), 4 ng EE2/L and 120 ng EE2/L (See section 2.2). In order to insure that
the EE2 concentrations were maintained, the water was changed 3 times a week
with the corresponding concentrations added after each change. The 4 ng EE2/L
concentration was chosen as a representative of an environmental relevant (Aris
et al., 2014) concentration while the 120 ng EE2/L concentration represents a
high sub-lethal exposure to organisms which are considered resistant (Blewett et
al., 2014).
As shown in Table 4, 60 individuals were exposed to either 4 ng EE2/L or to
a CTL solution while 40 individuals were exposed to 120 ng EE2/L. At 28 dph,
20 individuals from the CTL, 4 ng/L and 120 ng/L groups were sacrificed by
placing the individuals in 4 °C water inducing a strong thermal shock, leading to
a rapid death. Their brain and liver were obtained after dissection, immediately
snap-frozen in liquid nitrogen and stored at -80 °C until further analysis. Gonads
were not collected as these were not yet developed. At 28 dph, a further 20
individuals from the CTL, 4 ng/L and 120 ng/L groups (now referred to as
CTLa; 4a and 120a, respectively) were individually transferred into 1.2 L plastic
containers filled with 400 mL of reconstituted 25 ppt water (Figure 10). The
individuals were no longer exposed to the different treatments and were reared
until 168 dph. Once transferred into the plastic containers, water was never
changed in order to mimic K. marmoratus natural water conditions and limit
handling stress. The remaining 20 individuals from the CTL and 4 ng/L groups
(now referred as CTLb and 4b, respectively) were individually placed in glass
jars filled with 400 mL of reconstituted 25 ppt water (Figure 11). Individuals
from the 4b group continued to be exposed to 4 ng EE2/L, while individuals
from the CTLb group were exposed to 0.000012 % EtOH (vehicle control).
Water was changed once a week with the corresponding treatment added after
each change. Individuals were placed in glass jars and not plastic containers like
the other groups as it has been shown that EE2 can adsorb to plastics. This is not
the case of materials such as glass (Walker and Watson, 2010). Once 168 dph
was reached, the individuals from all groups were sacrificed and the liver, brain
and gonads were collected after dissection, immediately snap-frozen in liquid
nitrogen and stored at -80 °C until further analysis. 28 dph organ samples were
kept in -80°C conditions for over 140 days before further analysis while 168 dph
samples were kept in -80°C conditions for 7 to 14 days.
Table 4: The different treatment groups in which K. marmoratus individuals were distributed into.
Treatment (4 ng/L, 120 ng/L or vehicle control 0.000012 % EtOH) , duration of treatment (28 dph or 168 dph)
and time elapsed after hatching before sacrificed (28 dph or 168 dph) are given.
Group Name
Treatment
Duration of
Exposure
28 dph
Day of
sacrifice
28 dph
168 dph
28 dph
168 dph
Number of
individuals
20
20
20
20
4a
4 ng EE2/L
CTLa
28 dph
120a
Vehicle control
(0.000012 %
EtOH)
120 ng EE2/L
168 dph
28 dph
168 dph
168 dph
20
20
20
4b
4 ng EE2/L
CTLb
Vehicle control
(0.000012% EtOH)
168 dph
168 dph
20
28 dph
Figure 10: Housing for K. marmoratus individuals belonging to
the 4a; 120 and CTLa groups once 28 dph was reached.
Figure 11: Housing of K. marmoratus
individuals belonging to the 4b and
CTLb groups once 28 dph was reached
3.2 EE2 and Vehicle Control Solutions:
A 1 mg EE2/mL solution (Sigma-Aldrich E4876-1G) was prepared in 100 %
EtOH and diluted in ultrapure water in order to obtain a stock solution of 1 mg
EE2/L (0.1 % EtOH). This solution was stored at -20 °C and later used to renew
the EE2 working solutions used in the experiment. Indeed, a 0.01 mg EE2/L
(0.001 % EtOH) and a 0.4 mg/L (0.04 % EtOH) working solution were obtained
through diluting the stock solution in ultrapure water. 40 µL of the 0.01 mg/L
working solution were added to the 100 mL 25 ppt salt water in which the group
4a and 4b K. marmoratus individuals were housed, allowing for a 4 ng EE2/L
concentration (0.0000004 % EtOH) to be reached. For the 120 ng/L
concentration (0.000012 % EtOH), 30 µL of the 400 µg/L working solution was
added to the 100 mL salt water in which the 120a group K. marmoratus was
housed. A control working solution was also prepared, made up of 0.04 %
EtOH. 30 µL of this solution was added to the CTLa and CTLb groups 100 mL
of 25 ppt water, exposing the individuals to 0.000012 % EtOH. This EtOH
concentration corresponds to the highest concentration of ethanol EE2 exposed
K. marmoratus individuals were put into contact with during the experiment.
The different aliquots of the working solutions were stored in glass tubes at 20 °C in the dark and thawed before each exposure renewal. As mentioned, the
water was changed three times a week for all groups for the first 28 days. This
insured that the individuals were constantly exposed to the wanted EE2
concentrations. After 28 dph, the water of the 4b and CTLb group was changed
once a week, allowing for a punctual but life-long exposure.
3.3 Measurement of Actual EE2 Concentrations through ELISA:
Insuring that wanted EE2 concentrations correspond to actual concentrations
is important as it has been shown that EE2 concentrations can vary between 50
and 90% (Bjorkhlom et al., 2009). Thus, actual EE2 concentrations were
measured through an EE2 ELISA kit (5081 ETR, Europroxima, The
Netherlands). Like all ELISA techniques, the EE2 concentration was measured
through a competitive enzyme immunoassay. In the case of the EE2 ELISA kit,
the antibody is an EE2 labelled Horseradish peroxidase (HRP). Thus in a sample
well, free EE2 and EE2-HRP conjugate compete for the specific antibody
binding sites. After an incubation period, the non-bound reagents are removed
through a washing step. The amount of bound EE2-HRP is then visualised by
the addition of a colourless chromogen solution. The EE2-HRP transforms the
chromogen solution into a coloured product, allowing for colour intensity to be
measured photometrically at 450 nm. The optical density, which is inversely
proportional to the EE2 concentration in the sample, is then calculated.
In the case of this experiment, only samples from the 120 ng/L and working
solution were measured as the detection limit of the kit is 20 ng/L. The 4 ng/L
solution is thus below this detection limit. Random samples from freshly made
120 ng/L solutions, from 120 ng/L water samples right after exposure and from
120 ng/L water samples just before water change, collected at different time
points throughout the experiment, were used for EE2 concentration
measurement. Furthermore, since the EE2 standard curve ranges from 0.02 to 2
ng/ml, the 10 µg/L working solution was diluted 10x and the 400 µg/L working
solution was diluted 400x before assay.
3.4 Growth Measurement
Starting at 7 dph, standard length (length from the tip of the snout to the
posterior end of the last vertebra) was measured weekly, for the first 28 dph, for
all individuals using a SM21270 Nikon brand stereomicroscope and its
corresponding program (Figure 12). Three measurements were taken for each
individuals, the mean of all 3 measurements was used. After 28 dph, the
individuals became too big for growth measurement under the stereomicroscope.
Their standard lengths were thus measured every 2 weeks using a simple
photographic camera (Figure 13). Three pictures per fish were taken and
standard length was later measured using the software ImageJ™. The mean of
all three measurements was used. Differences in standard length between
treatments groups were tested using the software JMP® 13. When all statistical
conditions were respected (independent and identically distributed normal
variables and equal variances), a One-way analysis of variance (ANOVA I) was
used as a parametric test to determine differences in growth mean between the
4a; 120a and CTLa groups. If significant differences were observed, Tukey’s
multiple comparison test was then used to determine which mean differed. Van
der Waerden test was used as a non-parametric test when necessary, followed by
the Stell-Dwass test if significant differences were observed. A Student t-test
was used to compare growth mean between the 4b and CTLb groups. Statistical
significance was set at p<0.05. It must be noted that certain individuals were
removed from the statistical tests as these were, from the beginning, smaller than
the rest of the individuals. These so-called ‘Dwarf’ individuals were found in all
treatment groups including controls (1 in the 4a group, 2 in the 120a, 1 in the
CTLa and 1 in the 4b group).
Figure 12: Example of a picture taken of K. marmoratus
individual younger than 28 dph. The standard length of the
individuals was measured using a SM21270 Nikon brand
stereomicroscope .
Figure 13: Example of picture taken of K. marmoratus
individual older than 28 dph. The standard length of the
individuals was measured using the software ImageJ.
3.5 Reproduction Measurements
Individuals which were kept until 168 dph were monitored for egg production
starting at 84 dph. It has been reported that sexual maturity is reached between
3 – 4 months but can start as early as 84 days (Sakakura and Noakes, 2006;
Voisin et al, 2016). At 84 dph, synthetic cushion padding (100 % polyester)
was placed in the individuals’ containers. It has been observed that K.
marmoratus reared in laboratory conditions prefer to lay their eggs in cotton
rather than in the water. Furthermore, this allows for easy egg collection. Once
an individual reached 84 dph, egg production was monitored twice per week
until the first egg lay (date of when sexual maturity is reached). Once the first
egg lay occurred, egg production for the individual was monitored once a week.
Furthermore, the weekly number of eggs laid by each individual and for each
treatment group was noted. Depending on the treatment group of the parents (4a;
120a; CTLa; 4b or CTLb) the eggs were collected and placed collectively in a
corresponding treatment well in 6-multiwell plates 25 ppt water. Differences in
the time of when sexual maturity was reached between treatment groups were
determined using a Kaplan-Meier survival curve and a Logrank test using the
program JMP® 13. Differences in total egg production for the different
treatment 4a; 120a and CTLa groups were tested with a generalised linear model
GLM (counts of events: normal distribution with identity link function). Finally,
a Chi Square test was used to compare if the proportion of males and sexually
matured hermaphrodites differed between treatments. Statistical significance
was set at p<0.05. It must be noted that for all reproduction statistical tests,
except for the Chi Square test, males were not taken into account. Males were
determined by external characteristics (orange ventral pigmentation and faded
ocellus) and confirmed by gonad dissection at 168 dph.
3.6 Gene Expression
In order to better understand the effects of EE2 observed not only in this
experiment but also in Voisin et al.¸ 2016, RNA quantification of specific target
genes, through RT-qPCR, was conducted. The effects observed include direct
and delayed effects on growth and delayed effects on androgen hormones. The
expression of 8 target genes was thus attempted through RT-qPCR. 3 target
genes were chosen for their implications in growth: Growth Hormone gene
(GH) as well as Insulin-Like Growth Factor I and II (igf1 and igh2). 4 genes
involved in the steroidogenesis pathways were chosen: Estrogen Receptor α and
β (ERa and ERb) and brain and gonad Aromatase (cyp19a and cyp19b).
Considering that the individuals were exposed to EE2 the gene expression of
Vitellogenin was also done. Indeed, vitellogenin is often used as a biomarker for
estrogenic contamination (Jones et al., 2000).
3.6.1 Total RNA Extraction
Total RNA extraction was based on the Ambion Inc TRI reagent® solution
protocol (Annexe 1). RNA extraction was done on the different organs collected
(liver, brain and gonads) after 28 dph and 168 dph. Considering that the size of
the organs collected at 28 dph were extremely small (<1 mg), the organs were
pooled in threes. Given the small size of the organs at both 28 dph and 168 dph,
the samples were homogenised in 500 µL of TRI Reagent® Solution (AM9738,
ThermoFisher Scientific) rather than 1 mL. Organs are homogenised in TRI
reagent® solution in order to combine the phenol present in the TRI reagent®
with guanidine thiocyanate present in the samples. This facilitates the inhibition
of RNase activity; maintains RNA integrity as well as breaks down the cells and
their components. Once homogenisation of samples is complete, 50 µL (instead
of 100 µL) of Bromochloropropane (BCP) (B9673, Sigma Aldrich, UK) was
added in order to separate the homogenate solution into an organic and aqueous
phase. It is important to know that the RNA, which is of interest to us, is solely
present in the aqueous phase. The DNA is present directly below the aqueous
phase, with proteins found in the organic phase. The aqueous phase collected
and the RNA is then precipitated by adding isopropanol. 75 % EtOH is then
used in order to wash and solubilize the RNA pellet obtained. RNase-free water
(AM9932, ThermoFisher Scientific, USA) was used to re-suspend the RNA
pellet. 30µL of RNase-free water was used for liver and gonad samples and 10
µL of RNase-free water was used for brain samples.
Concentration and purity of extracted RNA was assessed by
spectrophotometry (NanoDrop 2000c Spectrophotometer, ThermoFisher
Sceintific, USA). RNA has a maximum absorbance at 260 nm. It is accepted that
samples with a 260/230 ratio of 1.8 or higher and 260/230 ratio of ~2.0 are
considered “pure” RNA samples containing little phenol or protein
contamination, respectively. However, DNA contamination cannot be excluded
as DNA absorbance is also measured at 260 nm. A DNase treatment must thus
be conducted to ensure that no genomic DNA will be amplified during qPCR,
leading to an overestimation of DNA quantity.
Nevertheless, before any DNase treatment, RNA integrity must be verified.
This was done using a 1 % denaturing agarose gel dyed with SYBR Safe
(S33102, ThermoFisher Scientific, USA). Migration was done at 100 V for 30
min. In brief, two bands must be clearly visible (28S and 18S rRNA) with the
28S being twice as intense as the 18S. Degraded RNA will appear as a low
molecular weight smear.
3.6.2 DNase Treatment
A DNase treatment in the RNA samples was done prior to the reverse
transcription process. It must be noted that the treatment does not completely
degrade the DNA. The DNA is, however, degraded to such a point that it cannot
be detected during the subsequent PCR and qPCR processes. The Promega RQ1
RNase-Free DNase kit and protocol was used for this step (M6101, Promega,
USA) (Annexe 2). Depending on the RNA concentration determined through
spectrophotometry, different amount of RNA (ranging between 0.5 and 3 µg
RNA) was collected from individual samples. The amount of RQ1 RNase-Free
DNase added was thus calculated individually for each sample. Once the DNase
treatment was completed, spectrophotometry analysis was done to determine the
new RNA concentration of the samples. Once the DNase treatment was
completed, spectrophotometry analysis was done to determine the new RNA
concentration of the samples. 1 µg of RNA from each sample was collected and
used for the reverse transcription step.
3.6.3 Reverse Transcription
Considering that our starting material is RNA, it is necessary to first
transcribe the RNA into cDNA through the use of a reverse transcriptase. The
cDNA can then be used as the template for the qPCR reaction. Once the DNase
treatment is completed, the ThermoFisher Scientific RevertAid RT kit and
protocol (K1691, ThermoFisher Scientific, USA) (Annexe 3) was used in order
to synthesis first strand cDNA from the DNase treated and pooled RNA. The kit
uses a RevertAid Reverse Transcriptase, which is a genetically modified MuLV
Reverse Transcriptase, a RT isolated from the Moloney Murine Leukemia Virus.
This RT possesses RNA and DNA dependent polymerase activity. Furthermore,
compared to the more common AMV (Avian myeloblastoma virus) Reverse
Transcriptase, the RNase H activity is much lower, reducing the amount of
primers degraded.
Considering that it was not known if the RNA extracted from our samples
possessed a poly(A) tail and whether or not numerous secondary structures were
present, random hexamer primers were used. These primers anneal at multiple
points along the RNA transcript. Compared to poly(A) primers, they have the
advantage of annealing to all types of RNA and are often used for transcripts
containing numerous secondary structures.
3.6.4 Primer Design and Verification
The K. marmoratus genome having been recently sequenced, gene
annotation of the genome is very limited. However, all of our target genes
(cyp19a1a1, cyp19a1b1, igf1, igf2, gh1, esr1, esr2 and vtg) have been sequenced
in previous papers (Lee et al., 2006 ; Seo et al., 2006; Rhee et al., 2012 ;
Farmer et al., 2012) and are thus available in the NCBI GenBank. Three
housekeeping genes, already sequenced, were picked: β-actin (actb); 18s rDNA
(18S rDNA) and Ribosomal Protein L8 (rpl8). In order to increase our chances
of obtaining primers which will amplify our target genes, primers used by the
different papers cited as well as newly designed primers were used. Newly
designed primers were done by using the Primer Design Tool ‘Primer3’. When
designing primers several important criteria were specified (Rychlik, 1995):
- Melting Temperature (Tm) must be between 58 – 62°C with optimal Tm
being at 60°C. The Tm for both primers should ideally be identical. In
brief, the Tm is the temperature at which 50 % of the primers are in a
double-stranded state. It is thus an estimate of the DNA-DNA stability.
The Tm is thus critical to determine the annealing temperature (Ta),
-
-
-
-
which is defined as the temperature at which the primers anneal to the
template cDNA. If Ta is too low, nonspecific annealing can occur while if
Ta is too high, primer annealing efficiency will reduce.
The target products should be between 75 and 200 bp, with optimal length
being 150 bp. The primer length should be between 18-22 bp (optimal
being 20 bp). Shorter primers are known to bind to the template with
higher efficiency but tend to form primer-dimers. These primer-dimer
structures can later interfere with accurate gene quantification.
Primers and thus target products should have a GC content between 5060%. Taking into account that G and C nucleotides form triple bonds with
their complementary nucleotide, a high GC content increases the
hybridization sensibility and accuracy during the annealing step.
Di-nucleotide repeats (ex ATATATAT) should be avoided as mispriming
could occur. A maximum of 4 di-nucleotide repeats are generally
accepted. Furthermore, primers with long runs of single identical
nucleotides (ex GGGG) should also be avoided for the same reasons.
Designing primers above potential secondary structures should be
avoided. Our ADNc is a single strand nucleic acid sequence and is thus
unstable and will easily fold into secondary structures. The Tm will
generally deconstruct such structures however designing a primer above a
potential secondary structure will decrease their chances of binding to the
region. This will affect the yield of the qPCR.
Table 5 shows the different primers obtained through literature and independent
primer design:
Table 5: List of the specific primers used for the RT-qPCR. For each gene, its GenBank accession number,
length of the amplicon (pb), length of the primer (pb) and melting temperature is indicated.
Gene
Cytochrome
P450
aromatase A
(cyp19a1a1)
Cytochrome
P450
aromatase B
(cyp19a1b1)
Insulin-Like
Growth
Factor 1
(igf1)
Insulin-Like
Growth
Factor 2
(igf2)
Accession
Template
Length
(bp)
Tm
GC
%
Primer Sequence
Reference
F
59.82
60
CTGAGGTTCATCTGGACCGG
Newly
Designed
R
60.04
55
ATTTGCCACTCCTGAGGACG
F
-
-
TCATGCTGCTGCTCCTCAAAC
R
-
-
GGAAGCGGAGGCATTCGTTG
F
60.04
55
CCTCATGCACAAGACCGAGT
R
60.03
55
GGTGGCCTTCATCATCACCA
F
-
-
AGCGTTTCATCAGCGAGTGTC
R
-
-
AGGCCAAGGTTGAGAATGATG
F
59.49
55
GACGAGTGCTGCTTCCAAAG
R
59.89
55
TTGTCCACTTTCTGTCCCGG
F
59.96
55
AAACCCGCCAAGTCTGAGAG
R
60.03
55
GATTGACTGCTCCTGGGCTT
F
59.19
50
AGCTGTGACCTCAACCTGTT
R
60.04
55
CTTCCTCTGCCACACATCGT
F
60.04
55
CTTCACAGAGGCCAGCATGA
R
59.89
60
GATCCACCGACCTCCACATC
F
60.04
55
ACGTCTGTCTGAAGGCCATG
R
59.90
55
TTTGTTACTGACGTGGCGGA
F
59.97
55
GTTGCAGTTCAGGACCTCGA
R
59.97
60
GTCTATCTGCTCCACGTCGG
F
59.96
60
GAGTCCAACACCTCCACCTG
R
60.18
55
ACTCCCAGGATTCCACCAGT
F
60.32
55
TCAGCCAATCACAGACAGCC
R
59.89
55
TGTCGATGGGGCTGATGATG
F
-
-
GCGGCAGAGAGCTTTACAGACAC
R
-
-
CAAGCCAGCATTTCGTAGGTTCTC
F
60.04
55
TCGGTTTACCCATGGAGTGC
R
59.96
50
AGCAGTGTTCACGCCCATAA
F
60.04
55
AACGGCTACCACATCCAAGG
R
59.97
60
CCCGAGATCCAACTACGAGC
151
DQ339107
150
154
DQ339106
151
JQ771067
155
234
JD771068
173
196
Estrogen
Receptor β
(esr2)
Estrogen
Receptor α
(esr1)
AB251457
290
AB251458
216
269
Growth
Hormone
(gh1)
JN383973
222
117
Vitellogenin
(vtg)
AY279214
197
245
Lee et al.,
2006
Newly
Designed
Lee et al.,
2006
Newly
Designed
Newly
Designed
Rhee et
al., 2012
Seo et al.,
2006
Newly
Designed
Newly
Designed
Newly
Designed
Newly
Designed
Rhee et
al., 2012
Newly
Designed
Newly
Designed
18S rDNA
FJ438821
F
59.96
55
GGCCGTTCTTAGTTGGTGGA
R
59.96
55
CCCGGACATCTAAGGGCATC
F
60.07
55
CGTCACGGTTACATCAAGGGA
R
59.89
60
CAGATGATGGTTCCCTCGGG
F
-
-
CAAGGGAATTGTGAAGGAC
R
-
-
CTCTTCTTGAACCGGTACG
F
60.04
55
CTGTCTTGCCCTCCATCGTT
R
60.04
55
ACGTAGCTGTCTTTCTGGCC
F
60.11
55
AGTCTTGCGGAATCCACGAG
R
60.04
60
GAGGCTTCACTGAGACCCAC
F
-
-
CTTGCGGAATCCACGAGACC
R
-
-
CAGGGCTGTGATCTCCTTCTG
179
233
Ribosomal
Protein L8
(rpl8)
AB477344
126
194
Β-actin
(actb)
AF168615
196
190
Newly
Designed
Newly
Designed
Farmer et
al., 2012
Newly
Designed
Newly
Designed
Rhee et
al., 2012
Once primers were designed and chosen, these must be validated. A PCR is
done in order to first determine the specificity of the designed primers. The
Promega Go Taq® G2 DNA Polymerase kit and protocol was chosen for this
experiment (M7841, Promega, USA) (Annexe 4). Within the kit, the 5X Green
Go Taq® Reaction buffer was used. Furthermore, 0.5 µM of forward and
reverse primers, as well as 10 µL of template DNA was added to the mix. PCR
cycles were as follows: A 2 minute denaturation step at 95 °C. 40 annealing
cycles were conducted in three temperature steps 30 s at 95 °C, 30 s at 60 °C
and 30 s at 70 °C. The extension step was done at 73 °C for 5 min. Once the
program finished, PCR products were stored at 4 °C until further use. The PCR
product was then placed in a 1 % denaturing agarose gel dyed with SYBR®
Safe. Migration lasted 30 min at 100 V. Gel visualisation was done using Bio
Rad’s ChemicDoc MP gel visualisation machine and the ImageLab™ software.
Only the primers with a clear, single band were kept (Figure 14). However, no
band was observed for the Cytochrome P450 aromatase A/B; Estrogen Receptor
α and Growth Hormone primers. For these primers, another PCR was tested
with 1 µL of MgCl2 being added. It is thought that MgCL2 works as a cofactor in
order to increase the activity of the Go Taq® G2 DNA polymerase. However, it
decreases the polymerase’s specificity. The primers were tested in both liver and
brain samples. After MgCl2 addition, no bands were observed for GH as well as
ER α.
Figure 14: 1% agarose gel dyed with SYBR® Safe showing primer specificity after a PCR. Only primers with a clear, single band were
kept. Primers where no bands were observed, a second PCR was done with MgCl2 being added to the PCR mix.
3.6.5 Optimizing the qPCR Assay
When comparing qPCR to the conventional PCR techniques, qPCR allows
not only for the amplification of a target template but also determines the
amount of target template present in the sample. This is done by including in the
reaction a fluorescent molecule, in our case a DNA-binding dye SYBR® Green
I. This DNA-binding dye binds non-specifically to double-stranded DNA. Once
binded to dsDNA, its fluorescence increases, this increase being proportional to
an increase in DNA concentrations. As Figure 15 shows, initial fluorescence
signal remains at background levels until enough target DNA is amplified. The
cycle at which the fluorescent signal becomes detectable is known as the Ct
(Threshold cycle). If a small amount of target template is present in the sample,
the Ct will thus be high/late. Inversely, if the sample contains a high amount of
target template, the Ct will be low/early. There is thus a close relationship
between the initial amount of target DNA and the Ct value obtained. Optimizing
the qPCR before any analysis is thus essential for accurate and reproducible
quantification of the samples.
Figure 15: Theoretical amplification plot. PCR cycle number is
shown on the x-axis with the fluorescence intensity represented on the yaxis. The fluorescence signal is proportional to the amount of amplified
target template present in the sample. The Ct represent the cycle at
which the fluorescence signal becomes detectable.
qPCR optimisation can be done by running serial dilutions of the target cDNA.
A standard curve can thus be generated with the results obtained. The standard
curve is used by plotting the log of the starting quantity of template present in
each dilution against the Ct obtained. The standard curve obtained allows to
determine three important criteria (Bio-Rad Laboratories, 2006):
- The Coefficient of determination (R2) of the standard curve, which should
be higher than 0.980
- The amplification efficiency (E%), which must be between 90 and 110 %.
This represents the percentage of template amplified after each cycle. It is
calculated using the slope of the standard curve. The formula %Efficiency
= (E – 1) X 100 % (with E equalling to 10-1/slope) can be used. Low
efficiency percentage may be due to poor primer design while high
efficiency often indicates pipetting errors during the serial dilutions. The
amplification of primer-dimers or the presence of inhibitors in the sample
can also lead to an increase in efficiency.
- Similar Ct must be obtained for each replicate reaction.
Furthermore, an optimized qPCR should have a single peak in the melt curve
graph. This confirms the specificity of the chosen primers observed during the
PCR primer verification step.
In the case of this experiment, a 5-fold serial dilution of the target cDNA was
done in order to optimize the qPCR. Three technical replicates per dilution were
done. Figure 16 shows the 96-multiplate well set up. Serial dilution wells
contained 5 µL of cDNA sample, 5 µL of the primer (5 µM of forward and
reverse primers) being tested and 10 µL of SYBR® Green PCR Master Mix
(A25741, ThermoFisher Scientific, USA). The blank wells contained 5 µL of
RNase-free water, 5 µL of primers (5 µM of forward and reverse primers) being
tested and 10 µL of SYBR® Green PCR Master Mix. The negative control
contains exactly the same products, the only difference being that 5 µL of
pooled RNA samples after DNase treatment, but before the reverse transcriptase
process, was added instead of RNase-free water. If amplification occurs in the
blank and/or negative control wells, contamination from unwanted DNA has
more than likely occurred. Amplification of the negative control could also
indicate a failed DNase treatment procedure. The StepOnePlus Real-Time PCR
system and program (4376600, ThermoFisher Scientific, USA) was used to run
the different qPCR cycles. The standard ramp speed was chosen. qPCR
optimisation were mainly done on liver samples as well as some brain and
gonad samples. Table 6 summarises the different information obtained after
qPCR optimisation.
Table 6: Summary of the efficiency (%) and coefficient of determination obtained after qPCR
optimisation for each target gene.
vtg
Efficiency %
R2
igf1
Efficiency %
R2
igf2
Efficiency %
R2
erb
Efficiency %
R2
rpl8
Efficiency %
R2
Liver 28 dph
Liver 168 dph
Gonad 168 dph
103.170
0.998
108.010
0.997
102.273
0.998
110.59
0.999
124.762
0.968
97.252
0.992
100.040
0.994
100.773
0.999
1.962
0.987
140.575
0.978
104.55
0.991
102.577
0.994
104.375
0.985
103.546
0.979
Figure 16: Set-up of the 96-multiplate for the optimisation of the qPCR. A 5-fold serial dilution was used.
The Blank comprises of ARNase free water while the negative control consists of a pool of numerous ARN
samples before the DNase treatment.
3.6.6 RT-qPCR
Once primer validation and qPCR optimisation were completed, analyses on
actual samples were conducted. In the case of this experiment, a singleplex
relative quantification assay was chosen. Thus reference genes were used to
ensure that the relative quantification between samples could be compared. Data
analysis was done using the Standard Curve Method. Such method required the
least amount of validation as efficiencies of the primers do not have to be
equivalent between target genes (Applied Biosystems, 2004). However, one
plate consisted of one organ and one gene. Thus a new standard curve was
needed for each new plate. Once again, the standard curve was obtained using a
5-fold dilution of the target cDNA. For target liver and gonad samples, a 25X
cDNA dilution was used. As qPCR optimisation for brains was not successful,
no gene expression analyses on brain samples were done. As mentioned, per
reaction plate, one gene and one organ was tested. Figure 17 shows a general
set-up of a reaction plate allowing for analysis using the Standard Curve
Method. Three technical replicates per sample were used with 4 – 6 biological
replicates used per treatment. Each well, excluding controls, contained 5 µL of
cDNA sample, 5 µL of the primer (5 µM of forward and reverse primers) and 10
µL of SYBR® Green PCR Master Mix. The blank wells contained 5 µL of
ARNase-free water, 5 µL of primers (5 µM of forward and reverse primers) and
10 µL of SYBR® Green PCR Master Mix. The negative control contains
exactly the same products as the blanks, the only difference being that 5 µL of
pooled ARN samples after DNase treatment, but before the reverse transcriptase
process, was added instead of ARNase-free water. The StepOnePlus Real-Time
PCR system and program (4376600, ThermoFisher Scientific, USA) was used to
run the different qPCR cycles. The standard ramp speed was chosen.
Figure 17: Set-up of the 96-multiplate for qPCR Standard Curve Method. A 5-fold serial dilution was used
for the standard curve. A 25 X cDNA dilution was used for liver and gonad samples. No brain samples were
used. Three technical replicates and 4 – 6 biological replicates, per treatment, were used. The Blank comprises of
RNase-free water while the negative control consists of a pool of numerous ARN samples before the DNase
treatment.
4 Results
It must be noted that the data analysis of individuals present in the 4a, 120a
and CTLa groups was done separately from the data analysis of individuals
present in the 4b and CTLb groups. While the type of exposure to EE2 (earlylife exposure or continuous exposure) may be considered a valid reason for such
an analysis separation, the main reason is due to the different types of housing.
As mentioned above, once 28 dph was reached, the 4b and CTLb individuals
were housed in 700 mL sized glass jars (Figure 11). The 4a, 120a and CTLa
groups were housed in 1.2 L plastic containers (Figure 10). When comparing
results from both control groups (CTLa and CTLb), significant differences in
some reproduction parameters (sexual maturity and total egg laid) was observed,
leading to the hypothesis that if differences in response between early-life and
continuous exposure groups was observed, this was due to the housing of the
individuals and not to the type of exposure to EE2. Data comparison between
the two different exposures (4a, 120a, CTLa VS 4b, CTLb) can thus not be
conducted.
4.1 Growth
4.1.1 Early-Life Exposure
As seen in Figure 17 and Table 7, after 21 days of exposure, individuals from
the 120a group were significantly bigger (p<0.01) in standard length compared
to the 4a and CTLa groups. Individuals were around 7% longer compared to 4a
and 4% longer compared to CTLa, with the 4a group even inclining to being
smaller than the controls. This significant size difference was observed until 56
dph , where at 56 dph the 120a group was only significantly longer than the
CTLa group (by about 4%). After 70 dph, no significant differences could be
determined, however a clear tendency could be observed: both the 4a and 120a
individuals tended to be longer than the CTLa. This tendency was confirmed
starting at 140 dph, where both 4a and 120a individuals became significantly
longer (p<0.01) than the CTLa (with the 4a being longer by 3% and 120a by
4%). This significant difference was noted until 168 dp (both 4a and 120a were
longer by 4% compared to CTLa) (p<0.01), moment where all individuals were
sacrificed.
Table 7: Statistical summary (mean ± SEM) for the standard length on K. marmoratus individuals exposed to
4ng EE2/L (4a) ; 120 ng EE2/L (120) as well as controls (CTLa). Individuals were exposed to EE2 for 28 dph
before being transferred into clean water until 168 dph. Data in bold represent significant differences (p < 0,05)
Standard Length ± SEM (mm)
CTLa
7.34 ± 0.07
9.64 ± 0.09
11.87 ± 0.11
13.47 ± 0.10
17.85 ± 0.26
19.88 ± 0.29
22.12 ± 0.23
23.47 ± 0.16
25.49 ± 0.32
26.56 ± 0.27
28.71 ± 0.11
29.86 ± 0.23
a
a
a
a
ab
ab
a
a
a
a
a
a
a
a
a
a
b
a
a
a
a
a
b
b
120
7.44 ± 0.12
9.86 ± 0.16
12.34 ± 0.12
14.02 ± 0.11
18.49 ± 0.20
20.77 ± 0.25
22.54 ± 0.20
23.91 ± 0.25
26.00 ± 0.15
27.34 ± 0.19
29.98 ± 0.21
31.14 ± 0.16
**
168
**
112
98
84
*
70
**
56
***
28
21
**
***
42
CTLa
4a
120
**
D a y P o s t H a t c h in g
140
a
a
b
b
b
b
a
a
a
a
b
b
***
7
14
21
28
42
56
70
84
98
112
140
168
4a
7.23 ± 0.10
9.55 ± 0.14
11.53 ± 0.14
13.07 ± 0.16
17.63 ± 0.22
20.07 ± 0.18
22.19 ± 0.17
23.69 ± 0.12
25.70 ± 0.14
27.02 ± 0.18
29.61 ± 0.17
30.66 ± 0.21
***
Days Post
Hatching
14
0
3
0
2
0
1
0
7
S ta n d a r d L e n g th (m m )
Figure 17: Standard Length ± SEM (mm) of K. marmoratus individuals exposed to 4 ng EE2/L (4a) and 120
ng EE2/L (120a) as well as controls (CTLa). Individuals were exposed for 28 dph to EE2 before being transferred
to uncontaminated water until 168 dph. Standard length was measured every 7 days until 28 dph was reached.
Afterwards, standard length was measured every 14 days. Significant differences was set a p<0.05 and are
represented with *. * p<0.05; **p.0,01, ***p<0.001
4.1.2 Continuous Exposure
No significant differences in the standard length could be observed between
the 4b and CTLb groups in the beginning of the growth monitoring (Figure 18)
(Table 8). However, a general trend shows that the 4b inclined to be bigger than
the CTLb. This is partially confirmed by the fact that at certain time points such
as 84 dph and 168 dph the 4b individuals were significantly bigger, by about
3%, compare to CTLb individuals (p<0.05).
Table 8: Statistical summary (mean ± SEM) for the standard length of K. marmoratus individuals exposed to
4 ng EE2/L (4b) as well as controls (CTLb). Individuals were exposed to EE2 for 168 dph. Data in bold
represents significant differences (p< 0.05)
Days Post
Hatching
7
14
21
28
42
56
70
84
98
112
140
168
Standard Length ± SEM (mm)
CTLb
7.28 ± 0.12
9.31 ± 0.15
11.51 ± 0.17
13.37 ± 0.17
17.88 ± 0.16
20.12 ± 0.13
22.54 ± 0.12
23.72 ± 0.14
26.06 ± 0.11
27.41 ± 0.16
29.35 ± 0.17
30.25 ± 0.22
a
a
a
a
a
a
a
a
a
a
a
a
4b
7.59 ± 0.11
9.50 ± 0.11
11.73 ± 0.11
13.45 ± 0.12
17.85 ± 0.14
20.64 ± 0.08
22.62 ± 0.15
24.29 ± 0.10
26.30 ± 0.14
27.30 ± 0.13
29.69 ± 0.10
31.80 ± 0.20
a
a
a
a
a
a
a
b
a
a
a
b
**
168
112
98
84
*
70
56
42
28
21
CTLb
4b
14
0
4
0
3
0
2
1
0
7
0
D a y P o s t H a t c h in g
140
S ta n d a r d L e n g th (m m )
Figure 19: Standard Length ± SEM (mm) of K. marmoratus individuals exposed to 4 ng EE2/L (4b) as well as
controls (CTLb). Individuals were exposed for 168 dph to EE2. Standard length was measured every 7 days until
28 dph was reached. Afterward, standard length was measured every 14 days. Significant differences was set a
p<0.05 and are represented with *. * p<0.05 ; **p.0.01, ***p<0.001
4.2 Reproduction
After 162 dph, all hermaphrodites were sexually active. EE2 exposure did not
significantly affect the age at which K. marmoratus hermaphrodites became
reproductively active (Figure 20). Nevertheless, the totality of individuals in the
120a group reached sexual maturity earlier (around 110 dph) compared to
individuals in the 4a and CTLa groups. Median age of maturity for 4a
individuals was reached at 97 dph, 96 dph for the 120a group and 98 dph for the
CTLa. Thus in all three treatment groups 50% of individuals reached sexual
maturity around the same time. It must be noted that males were not taken into
account during the analysis.
Furthermore, there was no significant difference in the proportion of males
and reproductively active hermaphrodites among the different treatment groups
(Figure 21). 1 male appeared in the 4a, CTLa and CTLb treatment. 2 males
were obtained in the 120a group while no males developed in the 4b exposure
group.
Like for total egg laid, early-life EE2 exposure significantly impaired the total
amount of eggs produced. Individuals exposed to 120 ng EE2/L significantly
laid fewer eggs compared to CTLa and 4a individuals (Figure 22). Between 84
dph and 168 dph, individuals in the 4a group laid a total of 349 eggs with an
average of 18.37 ± 5.52 eggs per individuals. Individuals in the 120a group laid
a total of 254 eggs (14.11 ± 2.13 eggs per individuals) with individuals in the
CTLa group laying a total of 334 eggs (17.58 ± 2.75 eggs per week).
% R e p ro d u c tiv e ly A c tiv e
100
50
C TLa
4a
120
0
100
150
200
D a y s P o s t H a t c h in g
Figure 20: Percentage of reproductively active K. marmoratus individuals after 28 dph exposure to
EE2. Sexual maturity was monitored once 84 dph was reached. Individuals were treated to 4 ng EE2/L
(4a) and 120 ng EE2/L (120) for 28 days before being transferred into untreated water until 168 dph was
reached. Males were not taken into account. NCTLa = 19; N4a =19; N120 = 18
M a le s
H e r m a p h r o d ite s
100
% P r o p o r t io n s
Eggs Layed
25
20
15
10
80
60
40
20
0
C T La
4a
120
Figure 22: Mean ± SEM number of eggs laid per week for each
treatment group. Eggs were collected between 84 dph and 168
dph. Individuals were either exposed to 4 ng EE2/L (4a) or 120 ng
EE2/L (120) for 28 dph then placed in untreated water until 168
dph. Controls (CTLa) are also shown. Males were not taken into
account. NCTLa = 19; N4a =19; N120 = 18
C T La
4a
120
Figure 21: Proportion of males and reproductively active
hermaphrodites after 168 dph. Individuals were exposed to either 4
ng EE2/L (4a) or 120 EE2/L (120) for 28 dph before being transferred
into untreated water until 168 dph. Controls (CTLa) are also included.
After 168 dph, all hermaphrodites were sexually active.
4.2.2 Continuous Exposure
No significant differences in the reproduction parameters monitored could
be observed for the chronic exposure. Indeed, there was no significant difference
in the time sexual maturity was reached between individuals exposed 168 days
to 4 ng EE2/L (4b) and controls (CTLb) (Figure 23). There is a general trend,
however, indicating that 4b individuals became reproductively active later
compared to CTLb. This trend was partially confirmed with the median age
which was 110 dph for the CTLb and 121 dph for the 4b group. Additionally,
the proportion of males compared to the proportion of sexually active
hermaphrodites was not significantly different, even if no males were observed
in the 4b group compared to 1 male for CTLb (Figure 24). Total egg lay did not
differ between individuals exposed to 4 ng EE2/L and the controls. Between 84
dph and 168 dph, individuals in the 4b group laid a total of 103 eggs with an
average of 4.90 ± 1.49 eggs per individuals (Figure 25). Controls laid a total of
88 eggs giving an average of 4.64 ± 0.66 eggs laid per individuals.
% R e p r o d u c t iv e l y A c t i v e
100
50
C TLb
4b
0
100
120
140
D a y s P o s t H a tc h in g
Figure 23: Percentage of reproductively active K. marmoratus individuals after 168 dph exposure
to EE2. Sexual maturity was monitored once 84 dph was reached. Individuals were treated to 4 ng
EE2/L (4b) for 168 dph. Controls (CTLb) are also included. Males were not taken into account. N CTLb =
19; N4b = 20
M a le s
H e rm a p h ro d ite s
100
´ % P r o p o r t io n
Eggs Layed
6
4
2
80
60
40
20
0
0
C T Lb
4b
Figure 25: Mean ± SEM number of eggs laid per week for
each treatment group. Eggs were collected between 84 dph
and 168 dph. Individuals were exposed to 4 ng EE2/L (4b)
for 168 dph. Controls (CTLb) are also shown. Males were
not taken into account. NCTLb = 19; N4b = 20
CTLb
4a
Figure 24: Proportion of males and reproductively active
hermaphrodites after 168 dph. Individuals were exposed to 4 ng
EE2/L (4b) for 168 dph. Controls (CTLb) are also included. After
168 dph, all hermaphrodites were sexually active.
4.3 qPCR
After qPCR optimization, no analysis on brain samples could have been
performed due the presence of inhibitors in the samples. In general, the qPCR
curves were flatten and very early Cts were obtained hinting at inhibitors
interfering with the fluorescence product (Schrader et al., 2012). A simple and
effective solution to this problem would be to increase the serial dilution of the
samples. This will decrease the concentration of inhibitors to a level that does
not affect the different qPCR products/enzymes. While this method is effective,
it must not be forgotten that the target sample is also diluted. Concerning primer
design for gh, era and cyp19a/b1, even after addition of MgCl2 primer
specificity could not be confirmed, thus no result concerning gene expression of
gh, era and the two types of aromatase (cyp19a1 and cyp19b1) was obtained.
Furthermore, in the case of our study, the results obtained for the gene
expression are criticisable due to low biological replicates and high biological
variability between samples. This could explain that, in some cases, Turkey’s
test could not distinguish between treatment groups, limiting the ability to
observe significant results. Thus numerous trends, even if not significant, were
observed.
4.3.1.1 Liver 28 dph
After 28 dph of exposure to EE2, no significant differences in gene
expression for igf2 and erb were determined in the liver. However, individuals
exposed to 120 ng EE2/L significantly over-expressed vtg (p<0.05). Indeed, as
seen in Figure 26, a 814.80 ± 424.54 fold increase was observed. Concerning
igf1, it was found that individuals in the 120a group significantly over-expressed
(p<0.01) the gene compared to controls (2.31 ± 0.27 fold increase). Individuals
in 4a group had a 1.53 ± 0.24 igf1 fold increase compared to controls but this
was not significant.
ig f1
R e la t iv e m R N A e x p r e s s io n
v tg
*
1400
1200
1000
800
2 .0
1 .5
1 .0
0 .5
0 .0
C T La
4a
3
**
2
1
0
C T La
120
1 .5
1 .0
0 .5
0 .0
C T La
4a
120
e rb
ig f2
4a
120
1 .5
1 .0
0 .5
0 .0
C T La
4a
120
Figure 26: Fold change ± SEM. Liver gene expression of vtg; igf1; igf2 and erb in K. marmoratus exposed to 4 ng/L (4a) and 120 ng/L (120
for 28 dph. Gene expressions of controls (CTLa) are also included
4.3.1.2 Liver 168 dph
No information for erb gene expression was obtained due to efficiency
discrepancies between qPCR plates. After 168 dph, no significant differences were
observed in the gene expression for vtg and igf1 (Figure 27). Nevertheless, individuals
in the 120a group significantly over-expressed igf2 compared with a 2.31 ± 1,13 fold
change. Furthermore, individuals exposed to 4 ng EE2/L were prone to under-express
vtg with a 2,18 ± 0,11 fold decrease. Individuals 4a individuals tended to underexpress igf2 compared to controls with a 2,52 ± 1,09 fold decrease. This, however, was
not significant.
ig f1
v tg
1 .5
1 .0
0 .5
0 .0
C T La
4a
120
1 .5
1 .0
0 .5
0 .0
C T La
4a
120
ig f2
F o ld C h a n g e
3
**
2
1
0
C T La
4a
120
Figure 27: Fold change ± SEM. Liver gene expression of vtg; igf1 and igf2 in K. marmoratus exposed to
4 ng/L (4a) and 120 ng/L (120) EE2 for 28 dph before being placed in untreated water until 168 dph.
Gene expressions of controls (CTLa) are also included
4.3.1.3 Gonads 168 dph
No significant differences could be observed in the gene expression of erb
(Figure 28). On the contrary, a significant difference was observed for gene
expression of igf2 with the 120a group over-expressing by 2.37 ± 0.26 igf2
compared to CTLa.
e rb
3
**
2
1
0
4a
1 .5
1 .0
0 .5
0 .0
120
1
C T La
ig f2
Figure 28: Fold change ± SEM. Gonads gene expression
of vtg;Continuous
igf1 and igf2 in Exposure
K. marmoratus exposed
4.3.2
to 4 ng/L (4a) and 120 ng/L (120) EE2 for 28 dph before being placed in untreated water until 168 dph.
Gene expressions of controls (CTLa)
are also included.
4.3.2.1 Liver
No information on liver expression on igf2 and erb was obtained due to
efficiency discrepancies between qPCR plates. Furthermore, after 168 dph of
exposure no significant differences were observed for vtg and igf1 (Figure 29).
ig f1
1 .5
v tg
1 .0
0 .5
0 .0
C T Lb
4b
2 .0
1 .5
1 .0
0 .5
0 .0
C T Lb
4b
Figure 29: Fold change ± SEM. Liver gene expression of vtg and igf1 in K. mar
Gene expressions of controls (CTLb) are also included
4.3.2.2 Gonads
No significant differences or general trends could be observed in the gene
expression of erb and igf2 (Figure 30).
e rb
ig f2
1 .5
1 .0
0 .5
0 .0
C T Lb
2 .0
1 .5
1 .0
0 .5
0 .0
4b
C T Lb
4b
Figure 30: Fold change ± SEM. Gonad gene expression of igf2 and erb in K. marmoratus exposed to 4 ng/L (4b) EE2 for 168 dph.
Gene expressions of controls (CTLb) are also included.
Table 9 briefly summarises the gene expression results measured:
Table 9: Summary of gene expression results. Symbols represents ↗ up-regulation; ↘ down-regulation; ±
tendency to; NS Not significant; N/A Not measured. Significant differences was set at p<0.05.
vtg
Igf1
Igf2
erb
NS
NS
NS
NS
120a
Liver 168 dph
4a
±↗
Significantly ↗
NS
NS
±↘
NS
±↘
Poor efficiency
120a
NS
NS
Significantly ↗
Poor efficiency
4b
Gonads 168 dph
4a
NS
NS
±↘
Poor efficiency
N/A
Poor efficiency
NS
NS
120a
N/A
Poor efficiency
Significantly ↗
NS
4b
N/A
Poor efficiency
NS
NS
Liver 28 dph
4a
5 Discussion
This thesis aimed to further investigate the effects of an early-life
exposure (28 dph) and continuous exposure (168 dph) to EE2 on K. marmoratus
during its development and adulthood. Two doses were used, one
environmentally relevant dose (4 ng/L) and a high, sub-lethal dose (120 ng/L). It
has been widely discussed in previous studies that the effects of EE2 on fish
individuals not only depends on the specie and the concentration of the
contaminant but also on the development stage at which the exposure occurs, the
duration of the exposure, the sex of the individuals and the type of exposure
(Nash et al., 2004; Kidd et al., 2007; Xu et al, 2008; Patisaul and Adewale,
2009 Andersen et al., 2013; Blewett et al., 2014; Baatru and Henriksen,
2015). Furthermore, some of these studies have found that the effects induced by
EE2 exposure can be reversible when adults are exposed (Baumann et al.,
2014). Studies on early-life exposure, however, show that effects are irreversible
with some effects even being observed in a delayed manner in later life-stages
on the individuals (Patisaul et al., 2009; Leet et al., 2011). Thus studies on
early-life stages as well as continuous exposure need to be done in order to
better understand the whole range of effects induced by EDCs such as EE2.
In the case of early-life exposure, results showed effects, primarily
delayed effects, on growth, reproduction and relevant genes expression. This
was more prominent at high dose exposure (120 ng/L). Surprisingly, very little
effects were observed in continuously exposed individuals, growth being the
only parameter affected.
As mentioned above, EE2 presents an impact on growth with a more
noticeable effect on individuals exposed to 120 ng EE2/L. A high dose of EE2
induced an increase in growth starting at 21 dph with the effects persisting even
after the exposure has ended. At 4 ng/L individuals showed a similar trend. The
increase in growth became noticeable around 70 dph and significant at 112 dph,
long after the exposure ceased. Individuals exposed for 168 dph also showed
accelerated growth however this was significant only at random time points. It
was hypothesised by Voisin et al., 2016 that the effect on growth, as a result of
EE2 exposure, was due to the fact EE2 interacts with the somatotropic axis (also
known as the Growth Hormone/Insulin-Like Growth Factor-1 axis). Several
studies have shown that the main physiological role of this axis is the regulation
of growth (Reinecke, 2010 ; Dai et al., 2015). In brief, growth hormonesreleasing hormone (GH-RH) stimulates the anterior pituitary which in turns
releases GH. Via its receptors (GHR), GH induces the expression of igf1 and
igf2 leading to the synthesis of IGF-1 and IGF-2. Synthesis of IGFs mainly
occurs in the liver, but synthesis in the brain, gills, spleen and gonads have also
been recorded (Hanson et al., 2014). Furthermore, there has been a growing
interest on the influence of EDCs on the GH/IGF-1 system. Indeed, the fact that
EDCs can disrupt hormone-controlled physiological processes means that they
could potentially have effects on growth and reproduction, among other things.
Thus, in the case of this study, measurements on the gene expression of gh, igf1
and igf2 was attempted. As mentioned, primer design for gh was unsuccessful,
however interesting effects on the gene expression for both liver igf1 and igf2
were noted. After 28 dph, liver igf1 was over-expressed for individuals exposed
to 120 ng EE2/L. No significant differences were observed for igf2 in any
treatment groups. At 168 dph, igf1 expression for the 120 group was no longer
significant having returned to normal levels once the EDC was removed.
However, individuals in the 120 group significantly over-expressed igf2 in both
the liver and gonads, indicating a retarded effect of EE2. The continuous
exposure group (4 ng/L for 168 dph) did not show any significant differences in
igf1 and igf2 gene expression. These results might seem surprising at first
considering that previous studies have found that EE2 induces a downexpression of one or more component of the GH/IGF-1 system (Van den Belt et
al., 2003; Schäfer et al., 2007; Shved et al., 2008). This downregulation was
often correlated with growth impairment. Indeed, one study exposed tilapia
individuals to 5 and 25 ng EE2/L for 10 to 100 day post fertilisation (dpf). A
decrease in growth was observed for all exposed individuals. Furthermore, after
30 dpf, a decrease in liver and brain mRNA igf1 and gh expression was noted
(Shved et al., 2008). While, in the case of this thesis, a correlation between
growth and igf gene expression was observed (increased growth with upregulation of genes for the 120 group), these findings go against general
observations.
It could be argued, however, that these general observations may not always
be universal due to the numerous feedback mechanisms that exist for the
GH/IGF-1 system. Numerous GH receptors (GHRs), type 1 IGF receptors
(IGFR1s), and presence, in some fish species, of IGF-3 means that regulation
mechanisms can differ between species. One study used gh1 mutant zebrafish in
order to better understand the link between GH, growth and adipogenesis. While
a decrease in somatic growth and adipogenesis was observed, no changes in
expression of both IGF-1 and IGF-2 were noted (McMenamin et al., 2013). The
link between GH, IGFs and growth is thus not yet fully understood. Differences
in responses could indicate that, in some fish, IGF expression may be
independent of GH. This partially explains what has been observed in our study.
While individuals exposed to 120 ng EE2/L did show an up-regulation in igf1 at
28 dph and igf2 at 168 dph, individuals exposed to 4 ng EE2/L (for 28 dph or
168 dph) showed no significant differences in gene expression, with liver igf2
expression even inclining to being down-regulated in the group exposed to
4ng/L for 28 dph. Yet all treatment groups (early-life and continuous exposure)
showed similar accelerated growth patterns. Differences in gene expression,
while dose dependent, could indicate that IGF expression may be independent of
GH in some fish species, including K. marmoratus. Indeed, it would seem that
growth regulation, through the GH/IGF system, might be species-specific or
dependent on the genetic background of the individuals (Devlin et al., 2009).
Perhaps, in some species, GH may have a more direct, rather than indirect,
impact on growth regulation than previously thought. In the case of this study,
crucial information on gh expression is thus missing.
Nevertheless, accelerated growth due to EE2 exposure in K. marmoratus was
also observed in a study conducted by Voisin et al., 2016. Similarly to our
study, individuals were exposed to 4 ng/L and 120 ng/L EE2 doses for 28 dph.
Individuals were then placed in uncontaminated water and reared until 168 dph.
In contrast to our findings, during EE2 exposure, growth retardation was
observed. However, once the EDC removed, accelerated growth was then
observed. No analysis on gene expression was done. While the accelerated
growth was explained through a compensatory growth process, it could be
hypothesized that K. marmoratus, being an androdioecious species, possess
different endocrine regulatory pathways compared to non-hermaphroditic fish
species. This is the case for other non-fish vertebrates such as gasteropods.
Hallgren et al., 2011 exposed two species of gasteropods to EE2 doses ranging
between 0,5 and 50 000 ng/L during early life development. While Radix
balthica individuals showed increased somatic growth rate, the opposite was
observed for Bithynia tentaculata. Differences in response were believed to be
due to the fact that R. balthica are pulmonates and thus have a different
endocrine system compared to the prosobranch B. tentaculata. Therefore while
in most fish species a decrease in IGF-1 and/or IGF-2 leads to impaired growth,
the possibility that K. marmoratus manages to circumvent such a response
through unknown or constantly activated steroidogenesis regulatory mechanisms
cannot be rejected. Indeed, it has been shown that both male and hermaphrodite
K.marmoratus synchronously secret estrogen, androgen and progestin in the
gonads (Minamimoto et al., 2005). Furthermore, it was discovered that
hermaphrodite ovaries constantly produce estrogen, androgen and progestin,
regardless of the maturation stage of oocytes. This indicates that K. marmoratus
hermaphrodites (and males) need to tolerate both sex hormones at once and at
all times. It is thus plausible that unknown regulatory and defence
steroidogenesis mechanism exist, changing the way EE2 affects K. marmoratus
individuals compared to other species. Thus further studies need to be conducted
in order to better understand how potential differences in the signalling
pathways may contribute to differences in responsiveness to EE2 in K.
marmoratus.
Nevertheless, the fact that a more prominent effect on growth and gene
expression was observed in individuals exposed to high doses of EE2 could be
explained by the fact that resistance to EE2 exposure has been shown to vary
between fish species, with species such as the Japanese medaka (Oryzias latipes)
and mummichog (Fundulus heteroclitus) being more resistant to low EE2 doses
compared to species such as the rainbow trout Oncorhynchus mykiss
(MacLatchy et al., 2003; Hogan et al., 2010). These differences in sensitivity
could be linked to biological differences such as tissue distribution, metabolism
and receptor affinity (Hogan et al., 2010). For example, a recent study
compared EE2 uptake and tissue distribution between different fish species
(Bletwett et al., 2014). While no differences in uptake rates were observed, two
distribution patterns were observed. For F. heteroclitus and O. latipes, EE2
accumulation mainly occurred in the liver and gallbladder suggesting a higher
EE2 metabolic rate. For the fathead minnow (Pimephales promelas); goldfish
(Carssius auratus); zebrafish (Danio rerio) and trout (Oncorhynchus mykiss)
EE2 was mainly distributed in the carcass. Considering that K. marmoratus is
more closely related to F. heteroclitus it can be hypothesised that EE2
distribution and thus metabolic and elimination rates are similar (Avise and
Tatarenkov, 2015). This could thus explain K. marmoratus resistance to low
and even high EE2 doses as well potential differences in regulation mechanisms.
K. marmoratus resistance to low doses is partially confirmed by vtg
expression results. As mentioned above, vitellogenin is a commonly used
biomarker for exposure to estrogenic EDCs (Jones et al., 2000). In the case of
our study, at 28 dph a clear tendency show that individuals exposed to 120 ng/L
highly over-express liver vtg while no expression differences was observed in
individuals exposed to 4 ng/L, even after 168 dph of exposure. It could thus be
hypothesised that K. marmoratus possesses unknown regulatory mechanisms
which allows it to tolerate and regulate varying concentrations of sexual
hormones. In normal conditions, the liver plays a crucial role in the
hypothalamus-pituitary-gonadal axis by producing vitellogenin when stimulated
by E2 released by the ovaries. It is thus typically expressed by females and is a
precursor protein of egg yolk. Numerous studies have shown how estrogenic
compounds, such as EE2, bind to estrogen receptors (ERs) and induce VTG
production, even in males (Hoffman et al., 2006; Crane et al., 2007; Marin et
al., 2012; Ramji et al., 2014). Furthermore, the fact that no significant effects of
EE2 on vtg expression were observed at 168 dph for early-life exposure groups
confirm results obtained in others studies. Indeed these studies showed that vtg
expression returns to normal expression levels once the estrogenic compound is
removed (Van den Belt et al., 2002; Farmer and Orlando, 2012).
Furthermore, external factors have been shown to influence EE2 effects. One
recent study conducted by Meina et al., 2013 exposed F. hereroclitus
individuals for 14 days to 250 ng EE2/L and to varying conditions of salinity (0
– 32 ppt) and temperature (10 – 26 °C). They managed to show that effects
induced by temperature were counteracted by the EE2 dose. Thus it is plausible
that an external stress could modulate the effects induced by the estrogen
contaminant. In our case, this external factor could be handling stress. When
comparing the size of K.marmoratus individuals from this experiment to those
of Voisin et al., 2016 control individuals, we observed that individuals from this
experiment were considerably bigger (Table 10). While rearing conditions were
not exactly the same in both experiments, the biggest difference was the
handling of the fish. In this experiment, fish were measured once every 1 to 2
weeks starting at 7 dph. In Voisin et al., 2016 experiments individuals were only
measured at four different time points (28; 56; 91 and 168 dph). Perhaps the
stress induced by extensive handling could have modulated or counter-acted
potential EE2 effects. The effect of chronic stress on growth is not clear, with
some type of stress reduces growth while other stimulates it (Barton, 2002;
Jentoft et al., 2005). However, the fact that a more accentuated accelerated
growth was observed in individuals exposed to 120 ng/L shows that there is a
dose dependent effect of EE2.
Table 10: Growth comparisons of control K. marmoratus individuals reared for this experiment and Voins
et al., 2016 experiment.
Type Points (dph)
28
56
91
168
Control Size± SEM Voisin
et al., 2016 (mm)
13.45 ± 0.11
17.04 ± 0.12
20.91 ± 0.11
24.58 ± 0.14
Control Size ± SEM actual
thesis (mm)
13.47 ± 0.10
19.89 ± 0.29
25.50 ± 0.33
29.87 ± 0.24
While the effects of EE2 on growth in K. marmoratus cannot be disputed, the
fact the igf2 was over-expressed in the 120 group at 168 dph is surprising. IGF1
is known to being essential to achieve optimal somatic growth. IGF2, however,
is believed to being a primary growth factor regulating early embryo
development (Dai et al., 2014). Furthermore, the fact that an increase in
expression was only observed after EE2 was removed and only in individuals
exposed to high doses of EE2, could indicate that other physiological
parameters, other than growth, were affected. Studies have shown that IGFs may
be involved in fish reproduction processes such as sexual differentiation
(Nakamura et al., 1998). IGFs thus also have paracrine or autocrine signalling
functions, their biological role being highly diverse. While very little studies
have been conducted on IGF-2’s role in reproduction, its implications in
different reproductive parameters is apparent (Reinecke et al., 2005; Reinecke,
2010). A delayed effect on igf2 expression could thus be linked, not to growth,
but to the numerous effects on reproduction which were observed in individuals
exposed to a high dose of EE2. This could explain why accelerated growth can
be observed in all exposed groups, while a significant effect on igf2 expression
was only be observed in individuals exposed to 120 ng/L. Indeed, in this study,
only individuals exposed to 120 ng/L for 28 dph showed a delayed up-regulation
of igf2 in the liver and gonads at 168 dph. Furthermore significantly fewer eggs
were laid with sexual maturity tending to being reached later compared to
controls and individuals exposed to 4 ng/L for 28 dph. No significant effects on
reproduction for early-life and whole-life exposure to 4 ng EE2/L were
observed.
The fact that EE2 exposure can negatively affect different reproduction
parameters in K. marmoratus individuals is consistent with findings in other
studies (Schäfers et al., 2007; Peters et al., 2007; Jukosky et al., 2008, Doyle
et al., 2013; Baumann et al., 2014). For example, one study exposed adult male
and female zebrafish to varying concentration of EE2 (5 to 50 ng/L) for 3 weeks
(Van den Belt et al., 2001). A dose related reduction of spawning females was
observed, with complete inhibition of spawning starting at 25 ng/L.
Morphological gonadal regression was observed in these females. In males, a
significant reduction in testis somatical index at 10 and 25 ng/L was also
measured. The fact the fish lack sex chromosomes means that sexual and
reproductive parameters are highly sensitive to environmental factors such as
temperature, pH and environmental contaminants (Devlin and Nagahama,
2002). Nevertheless, in the case of this study, the fact that only individuals
exposed to 120 ng/L showed impaired, and not inhibited, reproduction, once
again displays K. marmoratus resistance to EE2. This resistance is supported by
the results that show that no effects on reproduction were observed in groups
exposed to environmentally relevant doses of EE2, during early-life and
continuous exposure. This once again suggests that cellular, molecular and/or
physiological response mechanisms are put into place in order to maintain
metabolic and physiological homeostasis. This resistance to EE2 is further
emphasised by the fact that no differences in hermaphrodite/male ratio was
observed in the different treatment groups. This once again can be linked to the
fact that both hermaphrodites and males are capable of tolerating varying and
simultaneous levels of estrogenic and androgenic hormones (Minamimoto et
al., 2006). For other fish species, numerous studies have shown that EE2 often
induces a disproportion in the female/male ratio in natural and laboratory
populations (Jobling et al., 2005; Shved et al., 2008). One study exposed
zebrafish to 15 ng/L of EE2 at different early-life stages (fertilisation, hatching,
10 dph, 20 dph, 30 dph, 40 dph and 60 dph) (Andersen et al., 2003). Between
20 and 60 dph of exposure, effects on sex differentiation and sex ratio was
observed. Indeed, EE2 induced the development of ovo-testis and even induced
complete feminisation in some exposure groups. Another study conducted a 7years whole-lake experiment and exposed fathead minnows (Pimephales
promelas) to 5-6 ng EE2/L (Kidd et al., 2007). In males, delayed
spermatogenesis and tubules malformation were at first observed. Over the years
arrested testicular development occurred with males eventually becoming
intersex through the development of ovo-testis. Females seemed to be less
affected. Nevertheless, after 5 years reduced oogenesis occurred through
delayed oocytes development. All of these feminising effects, leading to
reproduction failure, affected population sustainability of the P. promelas
resulting in its collapse after 7 years of exposure. The fact that no sex ratio
effects were observed in K. marmoratus, even at high doses, is a positive
observation. Indeed, if changes in male/hermaphrodite proportions were to be
observed, this would more than likely influence outcrossing rates, leading to
changes in natural genetic diversity, which in K. marmoratus case, would
influence in unpredictable ways, population fitness.
However, as mentioned above, other fish species such as O. latipes and R.
heteroclitus have been shown to being reproductively resistant to varying doses
of EE2 (Ôrn et al., 2006; Peters et al., 2007). Indeed, one study exposed
sexually matured O. latipes, for 21 days, to varying concentrations of EE2 (32 to
488 ng/L) (Seki et al., 2002). No effects on reproduction were observed at low
doses. At 116 ng/L general observations showed a decrease in fecundity, this
becoming significant only at 488 ng EE2/L. A decrease in spawned egg fertility
was also only observed at this high concentration. Thus at low doses,
reproduction was not affected. In the case of K. marmoratus, its general
resistance to EE2 has been discussed; however, whether or not it is fully
reproductively resistant to low EE2 doses (as suggested by findings in this
study) can be debated. Indeed, Voisin et al., 2016 showed that individuals
exposed to 4 ng/L for 28 dph, laid fewer eggs compared to controls and 120
ng/L exposed individuals. These effects on reproduction at low EE2
concentrations were supported by Johnson et al., 2015 who observed that K.
marmoratus hermaphrodites exposed to 4 ng EE2/L showed an increase in the
number of early-stage oocytes present in the gonads. However, on study
conducted by Farmer et al., 2012 exposed K. marmoratus individuals to
extremely high doses of EE2 (0.1, 0.5 and 1 mg/L). A significant decrease in
fertility and delayed sexual maturity was only observed for the higher 0.5 and 1
mg/L doses. Such discrepancies in results show that K. marmoratus reproductive
resistance is debatable. Nevertheless, in all mentioned studies, reproduction was
never inhibited. However differences in the mode of application, in the brand of
EE2 used and life-stages targeted between studies could explain such variation
in observations.
Nonetheless, just like for the Japanese medaka and mummichog, K.
marmoratus EE2 resistance seem to decrease with an increase in EE2 dose
(Peters et al., 2007; Blewett et al., 2014). Thus, it would seem that at high
doses, the physiological effects are such that they overwhelm homeostatic
regulatory mechanisms. These mechanisms are known as allostasic mechanisms
and are put into place by an organism in order to re-establish homeostasis
(Sterling, 2012). An example of an allostatic mechanisms is energy reallocation, which is the modulation an individual’s energy demands as well as
its capacity for assimilation and conversion of energy (Post and Parkinson,
2001; Kooijman, 2010; Chambers and Trippel, 2012; Sokolova, 2013). In
brief, throughout a fish’s life, the energy available to individuals is primarily
allocated to physiological metabolism, somatic growth and reproduction
(Jorgensen et al., 2006; McBride et al., 2013). During early-life development,
a surplus in energy is predominantly allocated to somatic growth in order to
reduce size-related mortality such as predation (Ivan and Höök, 2015;
Sokolova, 2013). Once sexual maturity is achieved, the surplus of energy is then
directed towards specific reproductive strategies. A change in the usage of this
surplus of energy, due to changes in the environment for example, could thus
impact development parameters of an individual (McBride et al., 2013). At 120
ng/L early-life exposure, the fact that an increase in growth is later coupled with
a decrease in reproduction could indicate that energy re-allocation occurs in
order to face-off against the high dose effects.
As discussed, EE2 more than likely negatively effects reproduction in K.
marmoratus individuals (Farmer et al., 2012; Voisin et al., 2016; Johnson et
al., 2016). In Johnson et al., 2016 study, it was observed that hermaphrodites
exposed to 4 ng EE2/L showed an increase in early-stage oocytes. While this
was only a general observation, it could specify how EE2 disrupts (but not
inhibits) reproduction in exposed K. marmoratus individuals. Indeed, it was
hypothesised that EE2 could interfere with the maturation of primary oocytes
into secondary oocytes. This is partially confirmed by a study conducted by
Rhee et al., 2008 where it was shown that exposure to 100 ng/L of natural
oestrogen E2 decreased gonadotropin-releasing hormone (GnRH) expression.
GnRH in known to plays an important role in oocyte maturation (Grier et al.,
2009). Since EE2 is molecularly similar to E2, it can be assumed that EE2 also
down-regulates GnRH and thus, a decrease in oocyte maturation and egg
production due to EE2 exposure is plausible. A decrease in GnRH could also be
associated to the delayed increase in igf2 expression observed in this study.
Indeed, in mammals and teleost, IGFs have been shown to play a role in oocyte
maturation (Paul et al., 2009; Pramanick et al., 2013). Furthermore, some
studies have shown that IGFs are regulators of GnRH and gonadotropins
(Lackey et al., 1999; Mendez et al., 2005). Thus a combined effect of a
decrease in GnRH and an increase in igf2 expression due to EE2 exposure could
explain for the decrease in egg production.
Consequently, if oocyte maturation is reduced in exposed individuals, the
surplus of energy which would have gone into reproduction can now be reallocated into somatic growth. Nevertheless, whether or not this energy shift
benefits or not exposed individuals is unknown. Indeed, it could be hypothesised
that this shift in energy allocation into growth could allow individuals to better
flee the contaminated environment, which is known as the fight-or-flight
response (Tort, 2011). This hypothesis is conceivable considering that K.
marmoratus lives in extremely variable mangrove conditions. Rapid changes in
energy allocation would be necessary in order to take advantage of favourable or
unfavourable conditions and thus maximise their fitness (Roff, 2002). The fact
that individuals exposed to 120 ng/L during early-life development tend to
become sexually mature later, partially verifies this energy reallocation. Indeed,
it has been argued that a shift in energy allocation away from reproduction at an
early stage can delay an individuals’ rate of maturation (McBride et al., 2013).
6 Perspectives
Maintaining physiological homeostasis, through allostatic mechanisms, can
be costly for an individual exposed to a stressor, such as an EDC. Thus whether
or not the energy shift from reproduction to growth observed in exposed K.
marmoratus individuals is a positive or negative shift is yet to be determined.
Indeed, when individuals are exposed to chronic or intense stressor, allostatic
load is observed (McEwen and Wingfield, 2010). This is defined as the ’wear
and tear’ of the body associated to prolonged negative physiological effects.
Thus, chronic energy re-allocation, in order to activate and maintain allostatic
mechanisms, as well as face-off against stressors, could lead to a depletion of
energy reserves, affecting overall fitness of individuals (Encomio and Chu,
2000; Pörtner, 2010; Smolders et al., 2014). Nevertheless, the fact that EE2
exposed K. marmoratus individuals is still able to sustain fitness-related
functions, such as growth and reproduction shows that long-term survival of the
population is possible. The individuals cost of such maintenance, however, still
need to be determined in order to better understand if the long-term survival of
individuals will be affected. Thus analysis of different metabolic parameters
between exposed and control individuals would be necessary in order to better
understand how EE2 exposure disrupts energy allocation in individuals.
Parameters such as rate of oxygen consumption, lipid and glycogen reserves and
swimming performances are necessary to determine the metabolic traits of
exposed individuals (Chabot et al., 2016).
Furthermore, as discussed IGFs are known to have paracrine and autocrine
roles when present in tissues such as gonads, brain, liver and muscles. It has
been shown that in fish, both IGF-1 and IGF-2 play a role in skeletal muscle
growth (Castillo et al., 2004; Duan et al., 2010). One study induced an overexpression of igf1 in crucian carps (Carassius auratus) leading to significant
increase in levels of muscles hyperplasia (Li et al., 2014). Furthermore it was
observed that igf1 transgenic individuals produced more oxidative red muscle
compared to white muscle. This thus led to an increase in oxygen consumption.
It would thus be interesting to determine muscle gene expression of igf1 and igf2
in K. marmoratus individuals in order to determine if gene expression follows
the same pattern as in the liver and gonads. If similar effects on skeletal muscles
can be observed as in Li et al., 2014 paper, these findings could thus be linked
to effects on potential changes of metabolic rates.
While K. marmoratus high phenotypic plasticity is likely the reason for his
resistance to EE2 exposure, the transgenerational effects of EE2 on K.
marmoratus is another question of interest which need to be further examined.
While very few transgenerational effects of EE2 have yet to be studied,
increasing evidence of the impact of other EDC on subsequent generation have
been shown (Skinner et al., 2011; Corrales et al., 2014; Schwindt et al., 2014
). Bhandari et al., 2015 exposed O. latipes individuals to 50 ng EE2/L during
the first 7 days of embryonic development. As in accordance to other studies, no
phenotypic effects, other than a general observation in sex ratio disruption in
some replicate tanks, were observed in F0 as well as F1 generations. This
confirms the Japanese medaka’s resistance to EE2. However, fertilisation rate in
the F2 generation was significantly reduced followed by a significant decrease
F3 embryo survival rate. This shows that even if no immediate effects are
observed in exposed generations, an impact on subsequent generations cannot be
overlooked. Transgenerational effects could thus lead to decline in overall
population size and even perhaps the collapse of the population. It would thus be
essential to conduct further studies on the transgenerational effects of EE2 on K.
marmoratus. Furthermore, the fact that adverse effects could potentially be only
observed in following generations could indicate that epigenetic mechanisms,
such as DNA methylation and miRNA, are affected (Deans and Maggert,
2015). Considering the fact that K. marmoratus primarily reproduces through
self-fertilization, it can be hypothesised that the high phenotypic variability
observed in K. marmoratus population can be explained through epigenetic
modifications (Castonguay and Anders, 2012). One study, conducted on K.
marmoratus, discovered that varying temperature not only significantly affects
the hermaphrodite/male ratio but also induces differences in DNA methylation
patterns of several genes (Ellison et al., 2015). These results show the
importance variations in gene specific DNA methylation could have on K.
marmoratus individuals. The fact that varying temperature can influence DNA
methylation levels, studying the impact of an EDCs on methylation levels (gene
specific or whole genome) would thus be relevant. Indeed, numerous studies
have shown the impact environmental stressors can have on DNA methylation
(Vandegehutche and Jansser, 2014).
Furthermore, linking potential transgenerational effects and DNA methylation
due to EE2 exposure in K. marmoratus would be crucial. Indeed, is has been
shown that the DNA methylome in zebrafish can be transmitted to embryos
(Jiang et al., 2013). This is known as transgenerational epigenetic inheritance
(TEI). If DNA methylation modifications due to EE2 exposure were to be
observed, these changes could thus be transmitted to subsequent generations.
During development, it is believed that DNA methylation modification can
occur during what is known as the reprogramming process (Daxinger and
Whitelaw, 2010). This process involves genome-wide demethylation and
remethylation during embryogenesis. Indeed, DNA methylation patterns in the
embryo represent epigenetic barriers during development. At specific time
points, this barrier need to be dismantled when developmental potency has to be
resorted allowing for cell fate to occur. These reprogramming windows are thus
sensible to all exterior factors which could potentially modulate in DNA
methylation levels (Seisenberger et al., 2013). Once the reprogramming process
finished, the methylation patterns are fixed. A recent study managed to show
that reprogramming in K. marmoratus embryos occurred between 25 hours post
fertilization and 90 hpf (Fellous et al., unpublished). Reprogramming in K.
marmoratus thus occurs later and lasts longer compared to zebrafish (Jiang et
al., 2013). The differences in reprogramming processes have raised the question
whether, in K. marmoratus’ case, a prolonged reprogramming window could
influence phenotypic plasticity (Fellous et al., unpublished). Thus it would be
interesting to expose K. marmoratus embryos to EE2 environmentally relevant
and high doses. This will at first allow us to determine if differences in
responses can be observed when exposure occurs during different life-stages.
Additionally, it will allow us to determine if environmental stressors, such as
EDC, could affect DNA methylation levels during reprogramming and,
subsequently influence K. marmoratus sensitivity to EE2 in the exposed and
subsequent generations.
7 Conclusion
Overall, we have managed to show that exposure to 17-α-ethinylestradiol
during early-life development can affect K. marmoratus individuals. However,
these effects were only significantly observed at a high, sub-lethal, dose
exposure of 120 ng/L. At 120 ng/L, directly after 28 dph of exposure,
accelerated growth as well as igf1 and vtg over-expression was observed. Once
the contaminant removed, effects on reproduction were observed as well as
delayed effects on growth and igf2 up-regulation. These retarded effects could
be explained through epigenetic mechanisms such as modulation of genespecific and/or global DNA methylation levels. However, an environmentally
relevant dose of 4 ng/L seemed to have minimalistic effects on K. marmoratus,
both after early-life or continuous exposure (28 dph and 168 dph, respectively).
Indeed, apart from accelerated growth, no other effects on reproduction and
gene expression were observed. Furthermore, no effects on hermaphrodite/male
ratio were observed, even at a high dose. In some American water, including
Florida, 17-α-ethinylestradiol levels are, on average, below 5 ng/L (Kolpin et
al., 2005). Exposure to 17-α-ethinylestradiol might thus not have an impact on
K. marmoratus individuals and populations. While K. marmoratus resistance to
17-α-ethinylestradiol might be encouraging, future studies need to be conducted
in order to determine if such a resistance can be observed against other EDCs.
Indeed, 17-α-ethinylestradiol resistance is likely due to the fact that both K.
marmoratus hermaphrodites and males can regulate, simultaneously, both
estrogenic and androgenic sex hormones. Additionally, essential studies on
metabolism, transgenerational effects and epigenetics processes such as DNA
methylation levels during reprogramming still need to be conducted in order to
better predict 17-α-ethinylestradiol effects as well as understand K. marmoratus
resistance mechanisms. Our results need also to be completed with crucial
information on other target genes such as gh, GnRH, cyp191a1, cyp19b1, era
and erb in the liver, gonads, brain and muscles. Nevertheless, K. marmoratus
resistance to 17-α-ethinylestradiol must not discourage future studies from using
this potential model organism. Indeed, one must not forget that K. marmoratus
high levels of phenotypic plasticity and flexibility, coupled with their unique
mode of reproduction, makes it ideal for studying phenotypic and epigenetic
effects of varying environmental factors.
Bibliography
Anderson, J. L., L. T. Morran, and P. C. Phillips. "Outcrossing and the Maintenance of Males within C. Elegans Populations." Journal of
Heredity 101.Supplement 1 (2010):
Aris, Ahmad Zaharin, Aida Soraya Shamsuddin, and Sarva Mangala Praveena. "Occurrence of 17α-ethynylestradiol (EE2) in the
Environment and Effect on Exposed Biota: A Review." Environment International 69 (2014): 104-19.
Atkinson, Susanna K., Vicki L. Marlatt, Lynda E. Kimpe, David R.s. Lean, Vance L. Trudeau, and Jules M. Blais. "The Occurrence of
Steroidal Estrogens in South-eastern Ontario Wastewater Treatment Plants." Science of The Total Environment 430 (2012): 119-25.
Avise, J. C., and A. Tatarenkov. "Population Genetics and Evolution of the Mangrove Rivulus Kryptolebias Marmoratus , the World's Only
Self-fertilizing Hermaphroditic Vertebrate." Journal of Fish Biology J Fish Biol87.3 (2015): 519-38.
Bartelt-Hunt, Shannon, Daniel D. Snow, Teyona Damon-Powell, and David Miesbach. "Occurrence of Steroid Hormones and Antibiotics in
Shallow Groundwater Impacted by Livestock Waste Control Facilities." Journal of Contaminant Hydrology 123.3-4 (2012): 94-103.
Baatrup, Erik, and Per G. Henriksen. "Disrupted Reproductive Behavior in Unexposed Female Zebrafish (Danio Rerio) Paired with Males
Exposed to Low Concentrations of 17Î±-ethinylestradiol (EE2)." Aquatic Toxicology160 (2015): 197-204.
Baumann, Lisa, Susanne KnÃ¶rr, Susanne Keiter, Kristina Rehberger, Sina Volz, Viktoria Schiller, Martina Fenske, Henrik Holbech, Helmut
Segner, and Thomas Braunbeck. "Reversibility of Endocrine Disruption in Zebrafish (Danio Rerio) after Discontinued Exposure to
the Estrogen 17Î±-ethinylestradiol." Toxicology and Applied Pharmacology 278.3 (2014): 230-37.
Beaman, Julian E., Craig R. White, and Frank Seebacher. "Evolution of Plasticity: Mechanistic Link between Development and Reversible
Acclimation." Trends in Ecology & Evolution 31.3 (2016): 237-49.
Beer, Gavin De. Vertebrate Zoology; an Introduction to the Comparative Anatomy, Embryology, and Evolution of Chordate Animals. 4th ed.
London: Sidgwick and Jackson, 2011.
Belfroid, A.c, A. Van Der Horst, A.d Vethaak, A.j Schäfer, G.b.j Rijs, J. Wegener, and W.p Cofino. "Analysis and Occurrence of Estrogenic
Hormones and Their Glucuronides in Surface Water and Waste Water in The Netherlands." Science of The Total Environment 225.12 (1999): 101-08.
Bhandari, Ramji K., Frederick S. Vom Saal, and Donald E. Tillitt. "Transgenerational Effects from Early Developmental Exposures to
Bisphenol A or 17Î±-ethinylestradiol in Medaka, Oryzias Latipes." Scientific Reports 5 (2015): 9303.
Blewett, Tamzin A., Tiffany L. Chow, Deborah L. Maclatchy, and Chris M. Wood. "A Species Comparison of 17-Î±-ethynylestradiol Uptake
and Tissue-specific Distribution in Six Teleost Fish." Comparative Biochemistry and Physiology Part C: Toxicology &
Pharmacology 161 (2014): 33-40.
Booth, W., C. F. Smith, P. H. Eskridge, S. K. Hoss, J. R. Mendelson, and G. W. Schuett. "Facultative Parthenogenesis Discovered in Wild
Vertebrates." Biology Letters 8.6 (2012): 983-85.
Buffoni, G., and A. Cappelletti. "Oxygen Dynamics in a Highly Trophic Aquatic Environment. The Case of Orbetello Coastal
Lagoon." Estuarine, Coastal and Shelf Science 49.6 (1999): 763-74.
Bush, Richard T., Diane Fyfe, and Leigh A. Sullivan. "Occurrence and Abundance of Monosulfidic Black Ooze in Coastal Acid Sulfate Soil
Landscapes." Aust. J. Soil Res. Australian Journal of Soil Research 42.6 (2004): 609.
Castillo, J. "Metabolic and Mitogenic Effects of IGF-I and Insulin on Muscle Cells of Rainbow Trout." AJP: Regulatory, Integrative and
Comparative Physiology 286.5 (2004): n. pag.
Cargouet, M., D. Perdiz, A. Mouatassimsouali, S. Tamisierkarolak, and Y. Levi. "Assessment of River Contamination by Estrogenic
Compounds in Paris Area (France)." Science of The Total Environment 324.1-3 (2004): 55-66.
Chabot, D., D. J. Mckenzie, and J. F. Craig. "Metabolic Rate in Fishes: Definitions, Methods and Significance for Conservation
Physiology." Journal of Fish Biology 88.1 (2016): 1-9.
Chambers, R. Christopher, and Edward A. Trippel. "Early Life History and Recruitment: Legacy and Challenges."Early Life History and
Recruitment in Fish Populations (1997): 515-49.
Chapman, F.D and Mckenzie, D.J “Chapter 2: Behavioral Responses and Ecological Consequences.” Fish Physiology Hypoxia (2009): 48-67
Clouzot, Ludiwine, Benoît Marrot, Pierre Doumenq, and Nicolas Roche. "17α-Ethinylestradiol: An Endocrine Disrupter of Great Concern.
Analytical Methods and Removal Processes Applied to Water Purification. A Review." Environ. Prog. Environmental Progress 27.3
(2008): 383-96.
Colman, Jamie R., David Baldwin, Lyndal L. Johnson, and Nathaniel L. Scholz. "Effects of the Synthetic Estrogen, 17α-ethinylestradiol, on
Aggression and Courtship Behavior in Male Zebrafish (Danio Rerio)." Aquatic Toxicology 91.4 (2009): 346-54.
Cooper, C.a., S.l. Litwiller, C.l. Murrant, and P.a. Wright. "Cutaneous Vasoregulation during Short- and Long-term Aerial Acclimation in the
Amphibious Mangrove Rivulus, Kryptolebias Marmoratus." Comparative Biochemistry and Physiology Part B: Biochemistry and
Molecular Biology 161.3 (2012): 268-74.
Costa, W. J. "Redescription of Kryptolebias Ocellatus (Hensel) and K. Caudomarginatus (Seegers) (Teleostei: Cyprinodontiformes:
Rivulidae), Two Killifishes from Mangroves of South-eastern Brazil." Aqua:Journal of Ichtyology and Aquatic Biology 11 (2006): 512.
Corrales, Jone, Cammi Thornton, Mallory White, and Kristine L. Willett. "Multigenerational Effects of Benzo[a]pyrene Exposure on
Survival and Developmental Deformities in Zebrafish Larvae." Aquatic Toxicology 148 (2014): 16-26.
Dai, Xiangyan, Wei Zhang, Zijian Zhuo, Jiangyan He, and Zhan Yin. "Neuroendocrine Regulation of Somatic Growth in Fishes." Science
China Life Sciences 58.2 (2015): 137-47.
Dantas, David Valença, Mario Barletta, André Ricardo Araújo Lima, Jonas De Assis Almeida Ramos, Monica Ferreira Da Costa, and Ulrich
Saint-Paul. "Nursery Habitat Shifts in an Estuarine Ecosystem: Patterns of Use by Sympatric Catfish Species." Estuaries and
Coasts 35.2 (2013): 587-602.
Davis, W. P., D. S. Taylor, and B. J. Turner. "Field Observations on the Ecology and Habits of the Mangrove Rivulus (Rivulus Marmoratus)
in Belize and Florida." Icthyol Explor Fres 1 (1990): 123-24.
Deans, C., and K. A. Maggerts. "What Do You Mean, "epigenetic"?" Genetics 199.4 (2015): 887-96.
Devlin, R. H., D. Sakhrani, W. E. Tymchuk, M. L. Rise, and B. Goh. "Domestication and Growth Hormone Transgenesis Cause Similar
Changes in Gene Expression in Coho Salmon (Oncorhynchus Kisutch)."Proceedings of the National Academy of Sciences 106.9
(2009): 3047-052.
Devlin, Robert H., and Yoshitaka Nagahama. "Sex Determination and Sex Differentiation in Fish: An Overview of Genetic, Physiological,
and Environmental Influences." Aquaculture 208.3-4 (2002): 191-364.
Doyle, M.a., T. Bosker, C.j. Martyniuk, D.l. Maclatchy, and K.r. Munkittrick. "The Effects of 17-Î±-ethinylestradiol (EE2) on Molecular
Signaling Cascades in Mummichog (Fundulus Heteroclitus)." Aquatic Toxicology 134-135 (2013): 34-46.
Duan, Cunming, Hongxia Ren, and Shan Gao. "Insulin-like Growth Factors (IGFs), IGF Receptors, and IGF-binding Proteins: Roles in
Skeletal Muscle Growth and Differentiation." General and Comparative Endocrinology 167.3 (2010): 344-51.
Dussault, Ève B., Vimal K. Balakrishnan, Uwe Borgmann, Keith R. Solomon, and Paul K. Sibley. "Bioaccumulation of the Synthetic
Hormone 17α-ethinylestradiol in the Benthic Invertebrates Chironomus Tentans and Hyalella Azteca." Ecotoxicology and
Environmental Safety 72.6 (2009): 1635-641.
Earley, Ryan L., and Yuying Hsu. "Reciprocity between Endocrine State and Contest Behavior in the Killifish, Kryptolebias
Marmoratus." Hormones and Behavior 53.3 (2008): 442-51.
Elks, J. The Dictionary of Drugs Chemical Data, Structures and Bibliographies. N.p.: Springer Verlag, 2014.
Ellison, Amy, Carlos Marcelino RodrÃguez LÃ³pez, Paloma Moran, James Breen, Martin Swain, Manuel Megias, Matthew Hegarty, Mike
Wilkinson, Rebecca Pawluk, and Sofia Consuegra. "Epigenetic Regulation of Sex Ratios May Explain Natural Variation in Selffertilization Rates." Proceedings of the Royal Society B: Biological Sciences 282.1819 (2015): 20151900.
Eschmeyer, W. N. "Catalog of Fishes." Catalog of Fishes. N.p., 2015.
"Ethinyl Estradiol." The PubChem Project. PubChem Compound Database, 21 May 2016.
Evans, D. H. "The Multifunctional Fish Gill: Dominant Site of Gas Exchange, Osmoregulation, Acid-Base Regulation, and Excretion of
Nitrogenous Waste." Physiological Reviews 85.1 (2005): 97-177.
Encomio, V., and Fu-Lin E. Chu. "The Effect of PCBs on Glycogen Reserves in the Eastern Oyster Crassostrea Virginica." Marine
Environmental Research 50.1-5 (2000): 45-49.
Farmer, J. L., and E. F. Orlando. "Creating Females? Developmental Effects of 17Â -Ethynylestradiol on the Mangrove Rivulus'
Ovotestis." Integrative and Comparative Biology 52.6 (2012): 769-80.
Fellous, A., T. Labed-Veydert, AS Voisin, Mélodie Locrel, R. L. Earley, and F. Silvestre. "Global DNA Methylation Patterns Provide Insight
into Epigenetic Regulation in the Self-fertilizing Mangrove Rivulus, Kryptolebias Marmoratus." Unpublished
Frick, N. T., and P. A. Wright. "Nitrogen Metabolism and Excretion in the Mangrove Killifish Rivulus Marmoratus."The Journal of
Experimental Biology 205 (2002): 79-89.
Froehner, Sandro, Karina Scurupa Machado, Elisa Stefan, Tobias Bleninger, Edson Cordova Da Rosa, and César De Castro Martins.
"Occurrence of Selected Estrogens in Mangrove Sediments." Marine Pollution Bulletin 64.1 (2012): 75-79.
Fusco, G., and A. Minelli. "Phenotypic Plasticity in Development and Evolution: Facts and Concepts." Philosophical Transactions of the
Royal Society B: Biological Sciences 365.1540 (2010): 547-56.
Fuss, Jill O., and Priscilla K. Cooper. "DNA Repair: Dynamic Defenders against Cancer and Aging." PLoS Biology PLoS Biol 4.6 (2006):
Garcia, M. J., J. M. Ferro, T. Mattox, S. Kopelic, K. Marson, R. Jones, J. C. Svendsen, and R. L. Earley. "Phenotypic Differences between the
Sexes in the Sexually Plastic Mangrove Rivulus Fish (Kryptolebias Marmoratus)."Journal of Experimental Biology 219.7 (2016):
988-97.
Gibson, Daniel J., Emma V. A. Sylvester, Andy J. Turko, Glenn J. Tattersall, and Patricia A. Wright. "Out of the Frying Pan into the Air—
emersion Behaviour and Evaporative Heat Loss in an Amphibious Mangrove Fish ( Kryptolebias Marmoratus )." Biol. Lett. Biology
Letters 11.10 (2015): 20150689.
Gogos, Andrea, Yeewen Candace Wu, Amy S. Williams, and Linda K. Byrne. "The Effects of Ethinylestradiol and Progestins (“the Pill”) on
Cognitive Function in Pre-menopausal Women." Neurochem Res Neurochemical Research 39.12 (2014): 2288-300.
Grier, J. H., M. C. Uribe, and R. Patino. "The Ovary, Folliculogenesis and Oogenesis in Teleosts." Reproductive Biology and Phylogeny of
Fishes (n.d.): 25-84.
Grizzle, John M., and Arunthavarani Thiyagarajah. "Skin Histology of Rivulus Ocellatus Marmoratus: Apparent Adaptation for Aerial
Respiration." Copeia 1987.1 (1987): 237.
Hallgren, Per, Zaoia Sorita, Olof Berglund, and Anders Persson. "Effects of 17Î±-ethinylestradiol on Individual Life-history Parameters and
Estimated Population Growth Rates of the Freshwater Gastropods Radix Balthica and Bithynia Tentaculata." Ecotoxicology 21.3
(2011): 803-10.
Hanson, Andrea M., Jeffrey D. Kittilson, Lincoln E. Martin, and Mark A. Sheridan. "Environmental Estrogens Inhibit Growth of Rainbow
Trout (Oncorhynchus Mykiss) by Modulating the Growth Hormone-insulin-like Growth Factor System." General and Comparative
Endocrinology 196 (2014): 130-38.
Harrington, R. W. "Oviparous Hermaphroditic Fish with Internal Self-Fertilization." Science 134.3492 (1961): 1749-750.
Harrington, Robert W. "Delimitation of the Thermolabile Phenocritical Period of Sex Determination and Differentiation in the Ontogeny of
the Normally Hermaphroditic Fish Rivulus Marmoratus Poey." Physiological Zoology 41.4 (1968): 447-60.
Harrington, Robert W. "Environmentally Controlled Induction of Primary Male Gonochorists from Eggs of the Self-Fertilizing
Hermaphroditic Fish, Rivulus Marmoratus Poey." Biological Bulletin 132.2 (1967): 174.
Harrington, Robert W. "How Ecological and Genetic Factors Interact to Determine When Self-Fertilizing Hermaphrodites of Rivulus
Marmoratus Change into Functional Secondary Males, with a Reappraisal of the Modes of Intersexuality among
Fishes." Copeia 1971.3 (1971): 389.
Hogan, Natacha S., Suzanne Currie, Sacha Leblanc, L. Mark Hewitt, and Deborah L. Maclatchy. "Modulation of Steroidogenesis and
Estrogen Signalling in the Estuarine Killifish (Fundulus Heteroclitus) Exposed to Ethinylestradiol." Aquatic Toxicology 98.2 (2010):
148-56.
Hoffmann, J.l., S.p. Torontali, R.g. Thomason, D.m. Lee, J.l. Brill, B.b. Price, G.j. Carr, and D.j. Versteeg. "Hepatic Gene Expression
Profiling Using Genechips in Zebrafish Exposed to 17α-ethynylestradiol." Aquatic Toxicology79.3 (2006): 233-46.
Huehner, M. K., M. E. Schramm, and M. D. Hens. "Notes on the Behavior and Ecology of the Killifish Rivulus Marmoratus Poey 1880
(Cyprinodontidae)." Florida Scientist 48 (1985): 1-6.
Humble, Joseph L., Elaine Hands, Minna Saaristo, Kai Lindström, Kari K. Lehtonen, Oihane Diaz De Cerio, Ibon Cancio, Gemma Wilson,
and John A. Craft. "Characterisation of Genes Transcriptionally Upregulated in the Liver of Sand Goby (Pomatoschistus Minutus) by
17α-ethinyloestradiol: Identification of Distinct Vitellogenin and Zona Radiata Protein Transcripts." Chemosphere 90.11 (2013):
2722-729.
Hung, C. Y. C., K. N. T. Tsui, J. M. Wilson, C. M. Nawata, C. M. Wood, and P. A. Wright. "Rhesus Glycoprotein Gene Expression in the
Mangrove Killifish Kryptolebias Marmoratus Exposed to Elevated Environmental Ammonia Levels and Air." Journal of
Experimental Biology 210.14 (2007): 2419-429.
Ip, Y.k., S.f. Chew, and D.j. Randall. "Ammonia Toxicity, Tolerance, and Excretion." Fish Physiology Nitrogen Excretion (2001): 109-48.
Ivan, Lori N., Tomas O. HÃ¶Ã¶k, and John Post. "Energy Allocation Strategies of Young Temperate Fish: An Eco-genetic Modeling
Approach." Canadian Journal of Fisheries and Aquatic Sciences 72.8 (2015): 1243-258.
Jentoft, Sissel, Are H. Aastveit, Peter A. Torjesen, and Ã˜ ivind Andersen. "Effects of Stress on Growth, Cortisol and Glucose Levels in
Non-domesticated Eurasian Perch (Perca Fluviatilis) and Domesticated Rainbow Trout (Oncorhynchus Mykiss)." Comparative
Biochemistry and Physiology Part A: Molecular & Integrative Physiology 141.3 (2005): 353-58.
Jiang, Lan, Jing Zhang, Jing-Jing Wang, Lu Wang, Li Zhang, Guoqiang Li, Xiaodan Yang, Xin Ma, Xin Sun, Jun Cai, Jun Zhang, Xingxu
Huang, Miao Yu, Xuegeng Wang, Feng Liu, Chung-I Wu, Chuan He, Bo Zhang, Weimin Ci, and Jiang Liu. "Sperm, but Not Oocyte,
DNA Methylome Is Inherited by Zebrafish Early Embryos." Cell 153.4 (2013): 773-84.
Jobling, S., D. Casey, T. Rodgers-Gray, J. Oehlmann, U. Schulte-Oehlmann, S. Pawlowski, T. Baunbeck, A.p Turner, and C.r Tyler.
"Comparative Responses of Molluscs and Fish to Environmental Estrogens and an Estrogenic Effluent." Aquatic Toxicology 65.2
(2003): 205-20.
Johnson, E. L., K. L. Weinersmith, and R. L. Earley. "Changes in Reproductive Physiology of Mangrove RivulusKryptolebias
Marmoratusfollowing Exposure to Environmentally Relevant Doses of Ethinyl Oestradiol." Journal of Fish Biology 88.2 (2015):
774-86.
Johnson, Andrew C., Egon Dumont, Richard J. Williams, Rik Oldenkamp, Iwona Cisowska, and John P. Sumpter. "Do Concentrations of
Ethinylestradiol, Estradiol, and Diclofenac in European Rivers Exceed Proposed EU Environmental Quality
Standards?" Environmental Science & Technology Environ. Sci. Technol. 47.21 (2013): 12297-2304.
Johnson, E. L., K. L. Weinersmith, and R. L. Earley. "Changes in Reproductive Physiology of Mangrove Rivulus Kryptolebias Marmoratus
following Exposure to Environmentally Relevant Doses of Ethinyl Oestradiol."Journal of Fish Biology J Fish Biol 88.2 (2015): 77486.
Jones, P. D., L. A. Trembley, W. M. De Coen, and J. P. Giesy. "Vitellogenin as a Biomarker for Environmental Estrogens." Water Science
& Technology 6.7 (2000): 45-58.
Jukosky, James A., Mary C. Watzin, and James C. Leiter. "The Effects of Environmentally Relevant Mixtures of Estrogens on Japanese
Medaka (Oryzias Latipes) Reproduction." Aquatic Toxicology 86.2 (2008): 323-31.
Kime, David E. "A Strategy for Assessing the Effects of Xenobiotics on Fish Reproduction." Science of The Total Environment 225.1-2
(1999): 3-11.
Kidd, K. A., P. J. Blanchfield, K. H. Mills, V. P. Palace, R. E. Evans, J. M. Lazorchak, and R. W. Flick. "Collapse of a Fish Population after
Exposure to a Synthetic Estrogen." Proceedings of the National Academy of Sciences104.21 (2007): 8897-901.
King, Judy A. C., Daniel C. Abel, and Donald R. Dibona. "Effects of Salinity on Chloride Cells in the Euryhaline Cyprinodontid Fish Rivulus
Marmoratus." Cell and Tissue Research Cell Tissue Res. 257.2 (1989): 367-77.
Knight, Jon M., Lachlan Griffin, Pat E.r. Dale, and Marcus Sheaves. "Short-term Dissolved Oxygen Patterns in Sub-tropical
Mangroves." Estuarine, Coastal and Shelf Science 131 (2013): 290-96.
Kolpin, Dana W., and Dana T. Buxton. "Pharmaceuticals, Hormones, and Other Organic Wastewater Contaminants in U.S. Streams." Water
Encyclopedia (2005):
Kooijman, S. A. L. M. "Dynamic Energy and Mass Budgets in Biological Systems." (2000): n. pag.
Kötter, D. Fate of the Synthetic Vertebrate Hormone 17 -ethinylestradiol in Different Aquatic Systems and the Associated Effects on the
Development and Reproduction of the Freshwater Invertebrate Chironomus Riparius. Thesis. RWTH AAchen University, Institute
for Environmental Research, 2008.
Kuch, Holger M., and Karlheinz Ballschmiter. "Determination of Endocrine-Disrupting Phenolic Compounds and Estrogens in Surface and
Drinking Water by HRGC−(NCI)−MS in the Picogram per Liter Range."Environmental Science & Technology Environ. Sci.
Technol. 35.15 (2001): 3201-206.
Labadie, P., and E. M. Hill. "Estrogens and Progestogens in Wastewater, Sludge, Sediments, and Soil." Journal of Chromatography 1st ser.
11.4 (2007): 174-81.
Lackey, Brett R., Sandra L. Gray, and Donald M. Henricks. "The Insulin-like Growth Factor (IGF) System and Gonadotropin Regulation:
Actions and Interactions." Cytokine & Growth Factor Reviews 10.3-4 (1999): 201-17.
Lai, K.m., M.d. Scrimshaw, and J.n. Lester. "Prediction of the Bioaccumulation Factors and Body Burden of Natural and Synthetic Estrogens
in Aquatic Organisms in the River Systems." Science of The Total Environment 289.1-3 (2002): 159-68.
Lai, K.m., M.d. Scrimshaw, and J.n. Lester. "Prediction of the Bioaccumulation Factors and Body Burden of Natural and Synthetic Estrogens
in Aquatic Organisms in the River Systems." Science of The Total Environment 289.1-3 (2002): 159-68.
Lam, Siew Hong, and Zhiyuan Gong. "Modeling Liver Cancer Using Zebrafish: A Comparative Oncogenomics Approach." Cell Cycle 5.6
(2006): 573-77.
Langston, W.j., G.r. Burt, B.s. Chesman, and C.h. Vane. "Partitioning, Bioavailability and Effects of Oestrogens and Xeno-oestrogens in the
Aquatic Environment." Journal of the Marine Biological Association of the UK J. Mar. Biol. Ass. 85.1 (2005): 1-31.
Larcher, Simone, Geraldine Delbès, Bernard Robaire, and Viviane Yargeau. "Degradation of 17α-ethinylestradiol by Ozonation —
Identification of the By-products and Assessment of Their Estrogenicity and Toxicity."Environment International 39.1 (2012): 6672.
Larsen, Mia G., Katrine Bilberg, and Erik Baatrup. "Reversibility Of Estrogenic Sex Changes In Zebrafish (Danio Rerio)." Environmental
Toxicology and Chemistry Environ Toxicol Chem 28.8 (2009): 1783.
Larsson, D.g.j, M. Adolfsson-Erici, J. Parkkonen, M. Pettersson, A.h Berg, P.-E Olsson, and L. Förlin. "Ethinyloestradiol — an Undesired
Fish Contraceptive?" Aquatic Toxicology 45.2-3 (1999): 91-97.
Laurenson, James P., Raanan A. Bloom, Stephen Page, and Nakissa Sadrieh. "Ethinyl Estradiol and Other Human Pharmaceutical Estrogens
in the Aquatic Environment: A Review of Recent Risk Assessment Data." The AAPS Journal AAPS J 16.2 (2014): 299-310.
Leblanc, Danielle M., Chris M. Wood, Douglas S. Fudge, and Patricia A. Wright. "A Fish Out of Water: Gill and Skin Remodeling Promotes
Osmo- and Ionoregulation in the Mangrove Killifish Kryptolebias Marmoratus."Physiological and Biochemical Zoology 83.6 (2010):
932-49.
Lee, Young-Mi, Jung Soo Seo, Il-Chan Kim, Yong-Dal Yoon, and Jae-Seong Lee. "Endocrine Disrupting Chemicals (bisphenol A, 4nonylphenol, 4-tert-octylphenol) Modulate Expression of Two Distinct Cytochrome P450 Aromatase Genes Differently in Gender
Types of the Hermaphroditic Fish Rivulus Marmoratus." Biochemical and Biophysical Research Communications 345.2 (2006): 894903.
Lee, J.-S., S. Raisuddin, and D. Schlenk. "Kryptolebias Marmoratus (Poey, 1880): A Potential Model Species for Molecular Carcinogenesis
and Ecotoxicogenomics." Journal of Fish Biology J Fish Biology 72.8 (2008): 1871-889.
Lei, Bingli, Shengbiao Huang, Yiqi Zhou, Donghong Wang, and Zijian Wang. "Levels of Six Estrogens in Water and Sediment from Three
Rivers in Tianjin Area, China." Chemosphere 76.1 (2009): 36-42.
Leet, Jessica K., Heather E. Gall, and Maria S. SepÃºlveda. "A Review of Studies on Androgen and Estrogen Exposure in Fish Early Life
Stages: Effects on Gene and Hormonal Control of Sexual Differentiation." Journal of Applied Toxicology 31.5 (2011): 379-98.
Li, Dongliang, Qiyong Lou, Gang Zhai, Xuyan Peng, Xiaoxia Cheng, Xiangyan Dai, Zijian Zhuo, Guohui Shang, Xia Jin, Xiaowen Chen,
Dong Han, Jiangyan He, and Zhan Yin. "Hyperplasia and Cellularity Changes in IGF-1-Overexpressing Skeletal Muscle of Crucian
Carp." Endocrinology 155.6 (2014): 2199-212.
Liang, Shan, Renchao Zhou, Suisui Dong, and Suhua Shi. "Adaptation to Salinity in Mangroves: Implication on the Evolution of Salttolerance." Sci. Bull. Science Bulletin 53.11 (2008): 1708-715.
Lin, Hui-Chen, and William A. Dunson. "An Explanation of the High Strain Diversity of a Self-Fertilizing Hermaphroditic
Fish." Ecology 76.2 (1995): 593-605.
Lin, Hui-Chen, and William A. Dunson. "An Explanation of the High Strain Diversity of a Self-Fertilizing Hermaphroditic
Fish." Ecology 76.2 (1995): 593-605.
Litwiller, S. L. "Rapid Increase in the Partial Pressure of NH3 on the Cutaneous Surface of Air-exposed Mangrove Killifish, Rivulus
Marmoratus." Journal of Experimental Biology 209.9 (2006): 1737-745.
Liu, R., J.l Zhou, and A. Wilding. "Microwave-assisted Extraction Followed by Gas Chromatography–mass Spectrometry for the
Determination of Endocrine Disrupting Chemicals in River Sediments." Journal of Chromatography A 1038.1-2 (2004): 19-26.
Länge, Reinhard, Thomas H. Hutchinson, Charlotte P. Croudace, Fred Siegmund, Hermann Schweinfurth, Peter Hampe, Grace H. Panter, and
John P. Sumpter. "Effects of the Synthetic Estrogen 17α-ethinylestradiol on the Life-cycle of the Fathead Minnow (Pimephales
Promelas)." Environmental Toxicology and Chemistry Environ Toxicol Chem 20.6 (2001): 1216-227.
Loos, R. "Analytical Methods for the New Proposed Priority Substances of the European Water Framework Directive (WFD)." European
Commision, Institute for Environment and Sustainability, Institute for Environment and Sustainability (2012):
Mackay, D., and A. Fraser. "Bioaccumulation of Persistent Organic Chemicals: Mechanisms and Models."Environmental Pollution 110.3
(2000): 375-91.
Mackiewicz, M., A. Tatarenkov, D. S. Taylor, B. J. Turner, and J. C. Avise. "Extensive Outcrossing and Androdioecy in a Vertebrate Species
That Otherwise Reproduces as a Self-fertilizing Hermaphrodite." Proceedings of the National Academy of Sciences 103.26 (2006):
9924-928.
Maclatchy, Deborah L., Simon C. Courtenay, Charles D. Rice, and Glen J. Van Der Kraak. "Development Of A Short-Term Reproductive
Endocrine Bioassay Using Steroid Hormone And Vitellogenin End Points In The Estuarine Mummichog (Fundulus
Heteroclitus)." Environmental Toxicology and Chemistry 22.5 (2003): 996.
Maes, H. Fate of Ethinylestradiol in the Aquatic Environment and the Associated Effects on Organisms of Different Trophic Levels. Thesis.
RWT AAchen University, 2011.
Martínez, Noelia A., Sirley V. Pereira, Franco A. Bertolino, Rudolf J. Schneider, Germán A. Messina, and Julio Raba. "Electrochemical
Detection of a Powerful Estrogenic Endocrine Disruptor: Ethinylestradiol in Water Samples through Bioseparation
Procedure." Analytica Chimica Acta 723 (2012): 27-32.
Mcbride, Richard S., Stylianos Somarakis, Gary R. Fitzhugh, Anu Albert, Nathalia A. Yaragina, Mark J. Wuenschel, Alexandre AlonsoFernÃ¡ndez, and Gualtiero Basilone. "Energy Acquisition and Allocation to Egg Production in Relation to Fish Reproductive
Strategies." Fish and Fisheries 16.1 (2013): 23-57.
Mcewen, Bruce S., and John C. Wingfield. "What Is in a Name? Integrating Homeostasis, Allostasis and Stress."Hormones and
Behavior 57.2 (2010): 105-11.
Mcmenamin, Sarah K., James E.n. Minchin, Tiffany N. Gordon, John F. Rawls, and David M. Parichy. "Dwarfism and Increased Adiposity
in Thegh1Mutant Zebrafishvizzini." Endocrinology 154.4 (2013): 1476-487.
Meina, Esteban Gillio, Andrea Lister, Thijs Bosker, Mark Servos, Kelly Munkittrick, and Deborah Maclatchy. "Effects of 17Î±ethinylestradiol (EE2) on Reproductive Endocrine Status in Mummichog (Fundulus Heteroclitus) under Differing Salinity and
Temperature Conditions." Aquatic Toxicology 134-135 (2013): 92-103.
Mes, Titia De, Grietje Zeeman, and Gatze Lettinga. "Occurrence and Fate of Estrone, 17β-estradiol and 17α-ethynylestradiol in STPs for
Domestic Wastewater." Reviews in Environmental Science and Bio/Technology Rev Environ Sci Biotechnol 4.4 (2005): 275-311.
Mills, Lesley J., Ruth E. Gutjahr-Gobell, Gerald E. Zaroogian, Doranne Borsay Horowitz, and Susan C. Laws. "Modulation of Aromatase
Activity as a Mode of Action for Endocrine Disrupting Chemicals in a Marine Fish."Aquatic Toxicology 147 (2014): 140-50.
Minamimoto, Masako, Yoshitaka Sakakura, Kiyoshi Soyano, Yoshiaki Akaba, and Atsushi Hagiwara. "Plasma Sex Steroid Levels and
Steroidogenesis in the Gonad of the Self-fertilizing Fish Rivulus Marmoratus."Environmental Biology of Fishes 75.2 (2006): 159-66.
Moczek, A. P., S. Sultan, S. Foster, C. Ledon-Rettig, I. Dworkin, H. F. Nijhout, E. Abouheif, and D. W. Pfennig. "The Role of
Developmental Plasticity in Evolutionary Innovation." Proceedings of the Royal Society B: Biological Sciences 278.1719 (2011):
2705-713.
Mourabit, Sulayman, Mathew Edenbrow, Darren P. Croft, and Tetsuhiro Kudoh. "Embryonic Development of the Self-fertilizing Mangrove
Killifish Kryptolebias Marmoratus." Dev. Dyn. Developmental Dynamics 240.7 (2011): 1694-704.
Muyzer, Gerard, and Alfons J. M. Stams. "The Ecology and Biotechnology of Sulphate-reducing Bacteria." Nature Reviews Microbiology
Nat Rev Micro (2008): n. pag.
Nash, Jon P., David E. Kime, Leo T. M. Van Der Ven, Piet W. Wester, François Brion, Gerd Maack, Petra Stahlschmidt-Allner, and Charles
R. Tyler. "Long-Term Exposure to Environmental Concentrations of the Pharmaceutical Ethynylestradiol Causes Reproductive
Failure in Fish." Environ Health Perspect Environmental Health Perspectives 112.17 (2004): 1725-733.
Nijhout, H. Frederik. "Development and Evolution of Adaptive Polyphenisms." Evol Dev Evolution and Development5.1 (2003): 9-18.
Nordlie, Frank G. "Physicochemical Environments and Tolerances of Cyprinodontoid Fishes Found in Estuaries and Salt Marshes of Eastern
North America." Rev Fish Biol Fisheries Reviews in Fish Biology and Fisheries 16.1 (2006): 51-106.
Ong, K. J., E. D. Stevens, and P. A. Wright. "Gill Morphology of the Mangrove Killifish (Kryptolebias Marmoratus) Is Plastic and Changes
in Response to Terrestrial Air Exposure." Journal of Experimental Biology 210.7 (2007): 1109-115.
Oomen, Rebekah A., and Jeffrey A. Hutchings. "Genetic Variability in Reaction Norms in Fishes." Environ. Rev. Environmental
Reviews 23.3 (2015): 353-66.
Orlando, E. F., Y. Katsu, S. Miyagawa, and T. Iguchi. "Cloning and Differential Expression of Estrogen Receptor and Aromatase Genes in
the Self-fertilizing Hermaphrodite and Male Mangrove Rivulus, Kryptolebias Marmoratus." Journal of Molecular
Endocrinology 37.2 (2006): 353-65.
Owen, R., and S. Jobling. "Ethinyl Oestradiol in the Aquatic Environment." Emerging Lessons from Ecosystems(2012):
Partridge, Charlyn, Anne Boettcher, and Adam G. Jones. "Short-term Exposure to a Synthetic Estrogen Disrupts Mating Dynamics in a
Pipefish." Hormones and Behavior 58.5 (2010): 800-07.
Patel, R. C., D. K. Pathod, K. S. Rajesh, and V. S. Patel. "RP-HPLC Method Development and Validation for Estimation of Drospirenone
and Ethinyl Estradiol in Bulk and Combined Dosage Form." Pharmagene 1 (2013): 15-20.
Patisaul, Heather. "Long-term Effects of Environmental Endocrine Disruptors on Reproductive Physiology and Behavior." Frontiers in
Behavioral Neuroscience 3 (2009): n. pag.
Paul, Sudipta, Kousik Pramanick, Sourav Kundu, Dhyanendra Kumar, and Dilip Mukherjee. "Regulation of Ovarian Steroidogenesis in Vitro
by IGF-I and Insulin in Common Carp, Cyprinus Carpio: Stimulation of Aromatase Activity and P450arom Gene
Expression." Molecular and Cellular Endocrinology 315.1-2 (2010): 95-103.
Peters, Rebecca E.m., Simon C. Courtenay, Steve Cagampan, Mark L. Hewitt, and Deborah L. Maclatchy. "Effects on Reproductive Potential
and Endocrine Status in the Mummichog (Fundulus Heteroclitus) after Exposure to 17Î±-ethynylestradiol in a Short-term
Reproductive Bioassay." Aquatic Toxicology 85.2 (2007): 154-66.
Perry, S.f., M.g. Jonz, and K.m. Gilmour. "Chapter 5 Oxygen Sensing And The Hypoxic Ventilatory Response." Fish Physiology
Hypoxia (2009): 193-253.
Picazo, Ofir, Adriana Becerril-Montes, Delia Huidobro-Perez, and Luis M. Garcia-Segura. "Neuroprotective Actions of the Synthetic
Estrogen 17α-Ethynylestradiol in the Hippocampus." Cellular and Molecular Neurobiology Cell Mol Neurobiol 30.5 (2010): 675-82.
Piersma, Theunis, and Jan Drent. "Phenotypic Flexibility and the Evolution of Organismal Design." Trends in Ecology & Evolution 18.5
(2003): 228-33.
Post, John R., and E. A. Parkinson. "Energy Allocation Strategy in Young Fish: Allometry and Survival." Ecology82.4 (2001): 1040.
Pojana, Giulio, Alessio Gomiero, Niels Jonkers, and Antonio Marcomini. "Natural and Synthetic Endocrine Disrupting Compounds (EDCs)
in Water, Sediment and Biota of a Coastal Lagoon." Environment International33.7 (2007): 929-36.
Pontolillo, J., and R. P. Eganhouse. "The Search for Reliable Aqueous Solubility (Sw) and Octanol-water Partition Coefficient (Kow) Data
for Hydrophobic Organic Compounds: DDT and DDE as a Case Study: U.S.G.S."Water Resources Investigations Report (2001): 151.
Pramanick, Kousik, Sourav Kundu, Sudipta Paul, Buddhadev Mallick, Sujata Roy Moulik, Puja Pal, and Dilip Mukherjee. "Changes in
Plasma Steroid Levels during Oocyte Development in Indian Shad, Tenualosa Ilisha (Hamilton, 1822): Role of Gonadotropins on in
Vitro Steroid Production and Development of Oocyte Maturational Competence." Animal Reproduction Science 141.3-4 (2013): 17788.
Ragsdale, Erik J., Manuela R. Müller, Christian Rödelsperger, and Ralf J. Sommer. "A Developmental Switch Coupled to the Evolution of
Plasticity Acts through a Sulfatase." Cell 155.4 (2013): 922-33.
Regan, K. S., M. G. Jonz, and P. A. Wright. "Neuroepithelial Cells and the Hypoxia Emersion Response in the Amphibious Fish Kryptolebias
Marmoratus." Journal of Experimental Biology 214.15 (2011): 2560-568.
Reindl, Katie M., and Mark A. Sheridan. "Peripheral Regulation of the Growth Hormone-insulin-like Growth Factor System in Fish and
Other Vertebrates." Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 163.3-4 (2012): 231-45.
Reinecke, M. "Insulin-like Growth Factors and Fish Reproduction." Biology of Reproduction 82.4 (2010): 656-61.
Reinecke, M. "Insulin-like Growth Factors and Fish Reproduction." Biology of Reproduction 82.4 (2010): 656-61.
Reinecke, Manfred, BjÃ¶rn Thrandur BjÃ¶rnsson, Walton W. Dickhoff, Stephen D. Mccormick, Isabel Navarro, Deborah M. Power, and
Joaquim GutiÃ©rrez. "Growth Hormone and Insulin-like Growth Factors in Fish: Where We Are and Where to Go." General and
Comparative Endocrinology 142.1-2 (2005): 20-24.
Rey, Jorge R., John Shaffer, Tim Kain, Robert Stahl, and Roy Crossman. "Sulfide Variation in the Pore and Surface Waters of Artificial SaltMarsh Ditches and a Natural Tidal Creek." Estuaries 15.3 (1992): 257.
Reyhanian, Nasim, Kristina Volkova, Stefan Hallgren, Tomas Bollner, Per-Erik Olsson, Håkan Olsén, and Inger Porsch Hällström. "17αEthinyl Estradiol Affects Anxiety and Shoaling Behavior in Adult Male Zebra Fish (Danio Rerio)." Aquatic Toxicology 105.1-2
(2011): 41-48.
Rhee, J. S., B. M. Kim, J. S. Seo, I. C. Kim, Y. M. Lee, and J. S. Lee. "Cloning of Growth Hormone, Somatolactin, and Their Receptor
MRNAs, Their Expression in Organs, during Development, and on Salinity Stress in the Hermaphroditic Fish, Kryptolebias
Marmoratus." Comparative Biochemistry and Physiology 161.4 (2012): 436-42.
Rhee, Jae-Sung, Young-Mi Lee, Jung Soo Seo, Jeonghoon Han, and Jae-Seong Lee. "Expression of Gonadotropin Î±, Follicle-stimulating
Hormone Î², and Luteinizing Hormone Î² Genes of the Hermaphroditic Fish Kryptolebias Marmoratus Exposed to Octylphenol, 17Î²
Estradiol, and Tamoxifen." Annals of the New York Academy of Sciences 1163.1 (2009): 508-11.
Richards, Travis M., Justin M. Krebs, and Carole C. Mcivor. "Microhabitat Associations of a Semi-terrestrial Fish, Kryptolebias Marmoratus
(Poey 1880) in a Mosquito-ditched Mangrove Forest, West-central Florida." Journal of Experimental Marine Biology and
Ecology 401.1-2 (2011): 48-56.
Roff, Derek A. Life History Evolution. Sunderland, MA: Sinauer Associates, 2002.
Rychlik, Wojciech. "Selection of Primers for Polymerase Chain Reaction." Molecular Biotechnology 3.2 (1995): 129-34.
Örn, Stefan, Henrik Holbech, Trine H. Madsen, Leif Norrgren, and Gitte I. Petersen. "Gonad Development and Vitellogenin Production in
Zebrafish (Danio Rerio) Exposed to Ethinylestradiol and Methyltestosterone."Aquatic Toxicology 65.4 (2003): 397-411.
Robertson, C. E., A. J. Turko, M. G. Jonz, and P. A. Wright. "Hypercapnia and Low PH Induce Neuroepithelial Cell Proliferation and
Emersion Behaviour in the Amphibious Fish Kryptolebias Marmoratus." Journal of Experimental Biology 218.19 (2015): 2987-990.
Robinson, Brian J., and Jocelyne Hellou. "Biodegradation of Endocrine Disrupting Compounds in Harbour Seawater and Sediments." Science
of The Total Environment 407.21 (2009): 5713-718.
Saaristo, Minna, John A. Craft, Kari K. Lehtonen, and Kai Lindström. "An Endocrine Disrupting Chemical Changes Courtship and Parental
Care in the Sand Goby." Aquatic Toxicology 97.4 (2010): 285-92.
Sakakura, Yoshitaka, Kiyoshi Soyano, David L.g. Noakes, and Atsushi Hagiwara. "Gonadal Morphology in the Self-fertilizing Mangrove
Killifish, Kryptolebias
Saltys, Heather A., Michael G. Jonz, and Colin A. Nurse. "Comparative Study of Gill Neuroepithelial Cells and Their Innervation in Teleosts
and Xenopus Tadpoles." Cell Tissue Res Cell and Tissue Research 323.1 (2005): 1-10.
Schäfers, C., M. Teigeler, A. Wenzel, G. Maack, M. Fenske, and H. Segner. "Concentration- and Time-dependent Effects of the Synthetic
Estrogen, 17α-ethinylestradiol, on Reproductive Capabilities of the Zebrafish, Danio Rerio." Journal of Toxicology and
Environmental Health, Part A 70.9 (2007): 768-79.
Scholz, S. "17-α-ethinylestradiol Affects Reproduction, Sexual Differentiation and Aromatase Gene Expression of the Medaka (Oryzias
Latipes)." Aquatic Toxicology 50.4 (2000): 363-73.
Schwindt, Adam R., Dana L. Winkelman, Kristen Keteles, Mark Murphy, and Alan M. Vajda. "An Environmental Oestrogen Disrupts Fish
Population Dynamics through Direct and Transgenerational Effects on Survival and Fecundity." Journal of Applied Ecology 51.3
(2014): 582-91.
Seki, Masanori, Hirofumi Yokota, Haruki Matsubara, Yukinari Tsuruda, Masanobu Maeda, Hiroshi Tadokoro, and Kunio Kobayashi. "Effect
Of Ethinylestradiol On The Reproduction And Induction Of Vitellogenin And Testis-Ova In Medaka (Oryzias
Latipes)." Environmental Toxicology and Chemistry 21.8 (2002): 1692.
Seo, Jung Soo, Young-Mi Lee, Sang-Oun Jung, Il-Chan Kim, Yong-Dal Yoon, and Jae-Seong Lee. "Nonylphenol Modulates Expression of
Androgen Receptor and Estrogen Receptor Genes Differently in Gender Types of the Hermaphroditic Fish Rivulus
Marmoratus." Biochemical and Biophysical Research Communications 346.1 (2006): 213-23.
Shved, N., G. Berishvili, J.-F. Baroiller, H. Segner, and M. Reinecke. "Environmentally Relevant Concentrations of 17Â -Ethinylestradiol
(EE2) Interfere With the Growth Hormone (GH)/Insulin-Like Growth Factor (IGF)-I System in Developing Bony
Fish." Toxicological Sciences 106.1 (2008): 93-102.
Silva, Paula, Maria J. Rocha, Catarina Cruzeiro, Fernanda Malhão, Bruno Reis, Ralph Urbatzka, Rogério A.f. Monteiro, and Eduardo Rocha.
"Testing the Effects of Ethinylestradiol and of an Environmentally Relevant Mixture of Xenoestrogens as Found in the Douro River
(Portugal) on the Maturation of Fish Gonads—A Stereological Study Using the Zebrafish (Danio Rerio) as Model." Aquatic
Toxicology 124-125 (2012): 1-10.
Skinner, Michael K. "Environmental Stress and Epigenetic Transgenerational Inheritance." BMC Medicine 12.1 (2014): n. pag.
Sokolova, I. M. "Energy-Limited Tolerance to Stress as a Conceptual Framework to Integrate the Effects of Multiple Stressors." Integrative
and Comparative Biology 53.4 (2013): 597-608.
Speroff, Leon, and Philip D. Darney. A Clinical Guide for Contraception. Philadelphia, PA: Lippincott Williams & Wilkins, 2005.
Sterling, Peter. "Allostasis: A Model of Predictive Regulation." Physiology & Behavior 106.1 (2012): 5-15.
Sárria, M.p., M.m. Santos, M.a. Reis-Henriques, N.m. Vieira, and N.m. Monteiro. "Drifting towards the Surface: A Shift in Newborn
Pipefish’s Vertical Distribution When Exposed to the Synthetic Steroid Ethinylestradiol."Chemosphere 84.5 (2011): 618-24.
Tatarenkov, A., R. L. Earley, D. S. Taylor, and J. C. Avise. "Microevolutionary Distribution of Isogenicity in a Self-fertilizing Fish
(Kryptolebias Marmoratus) in the Florida Keys." Integrative and Comparative Biology 52.6 (2012): 743-52.
Tatarenkov, Andrey, Brian C. Ring, John F. Elder, David L. Bechler, and John C. Avise. "Genetic Composition of Laboratory Stocks of the
Self-Fertilizing Fish Kryptolebias Marmoratus: A Valuable Resource for Experimental Research." PLoS ONE 5.9 (2010): n. pag.
Taylor, D. S. "Adaptive Specializations of the Cyprinodont Fish Rivulus Marmoratus." Florida Scientist 53 (1990): 239-48.
Taylor, D. S. "Biology and Ecology of Rivulus Marmoratus: New Insights and a Review." Florida Scientist 63 (2000): 242-55.
Taylor, D. S. "Twenty-Four Years in the Mud: What Have We Learned About the Natural History and Ecology of the Mangrove Rivulus,
Kryptolebias Marmoratus?" Integrative and Comparative Biology 52.6 (2012): 724-36.
Taylor, D. S., W. P. Davis, and B. J. Turner. "Rivulus Marmoratus: Ecology of Distributional Patterns in Florida and the Central Indian River
Lagoon." Bulletin of Marine Science 57 (1995): 202-07.
Taylor, D. Scott, William P. Davis, and Bruce J. Turner. "Groveling in the Mangroves: 16 Years in Pursuit of the Cyprinodont Fish Rivulus
Marmoratus on the Belize Cays." Atoll Research Bulletin 525 (2004): 1-14.
Taylor, D. Scott, Bruce J. Turner, William P. Davis, and Ben B. Chapman. "A Novel Terrestrial Fish Habitat inside Emergent Logs." The
American Naturalist 171.2 (2008): 263-66.
Teppema, L. J., and A. Dahan. "The Ventilatory Response to Hypoxia in Mammals: Mechanisms, Measurement, and
Analysis." Physiological Reviews 90.2 (2010): 675-754.
Ternes, Thomas A., Jeannette Stüber, Nadine Herrmann, Derek Mcdowell, Achim Ried, Martin Kampmann, and Bernhard Teiser.
"Ozonation: A Tool for Removal of Pharmaceuticals, Contrast Media and Musk Fragrances from Wastewater?" Water Research 37.8
(2003): 1976-982.
Thomerson, Jamie E., and Jean H. Huber. "Review of Rivulus: Ecobiogeography, Relationships." Copeia 1993.4 (1993): 1204.
Tort, Lluis. "Stress and Immune Modulation in Fish." Developmental & Comparative Immunology 35.12 (2011): 1366-375.
Truong, Don H., Mohammad A. Eghbal, Wayne Hindmarsh, Sheldon H. Roth, and Peter J. O'brien. "Molecular Mechanisms of Hydrogen
Sulfide Toxicity." Drug Metabolism Reviews 38.4 (2006): 733-44.
Turko, A. J., C. E. Robertson, K. Bianchini, M. Freeman, and P. A. Wright. "The Amphibious Fish Kryptolebias Marmoratus Uses Different
Strategies to Maintain Oxygen Delivery during Aquatic Hypoxia and Air Exposure." Journal of Experimental Biology 217.22 (2014):
3988-995.
Turner, B. J., W. P. Davis, and D. S. Taylor. "Abundant Males in Populations of a Selfing Hermaphrodite Fish, Rivulus Marmoratus, from
Some Belize Cays." Journal of Fish Biology J Fish Biology 40.2 (1992): 307-10.
Turner, B., M. Fisher, and D. Taylor. "Evolution of ‘maleness’ and Outcrossing in a Population of the Self-fertilizing Killifish, Kryptolebias
Marmoratus." Evolutionary Ecology Research 8 (2006): 1475-486.
Vader, J.s., C.g. Van Ginkel, F.m.g.m. Sperling, J. De Jong, W. De Boer, J.s. De Graaf, M. Van Der Most, and P.g.w. Stokman. "Degradation
of Ethinyl Estradiol by Nitrifying Activated Sludge." Chemosphere 41.8 (2000): 1239-243.
Vandenbelt, K., R. Verheyen, and H. Witters. "Effects of 17Î±-ethynylestradiol in a Partial Life-cycle Test with Zebrafish (Danio Rerio):
Effects on Growth, Gonads and Female Reproductive Success." The Science of The Total Environment 309.1-3 (2003): 127-37.
Van Der Kooi, Casper J., and Tanja Schwander. "Parthenogenesis: Birth of a New Lineage or Reproductive Accident?" Current
Biology 25.15 (2015):.
Versonnen, Bram J., and Colin R. Janssen. "Xenoestrogenic Effects of Ethinylestradiol in Zebrafish (Danio Rerio)."Environmental
Toxicology Environ. Toxicol. 19.3 (2004): 198-206.
Vos, Joseph G., Erik Dybing, Helmut A. Greim, Ole Ladefoged, Claude Lambré, Jose V. Tarazona, Ingvar Brandt, and A. Dick Vethaak.
"Health Effects of Endocrine-Disrupting Chemicals on Wildlife, with Special Reference to the European Situation." Critical Reviews
in Toxicology 30.1 (2000): 71-133.
Voisin, Anne-Sophie, Alexandre Fellous, Ryan L. Earley, and FrÃ©dÃ©ric Silvestre. "Delayed Impacts of Developmental Exposure to 17Î±-ethinylestradiol in the Self-fertilizing Fish Kryptolebias Marmoratus."Aquatic Toxicology 180 (2016): 247-57.
Walker, Charles W., and John E. Watson. "Adsorption of Estrogens on Laboratory Materials and Filters during Sample Preparation." Journal
of Environment Quality 39.2 (2010): 744.
Wells, M. W., A. J. Turko, and P. A. Wright. "Fish Embryos on Land: Terrestrial Embryo Deposition Lowers Oxygen Uptake without
Altering Growth or Survival in the Amphibious Fish Kryptolebias Marmoratus." Journal of Experimental Biology 218.20 (2015):
3249-256.
West-Eberhard, Mary Jane. Developmental Plasticity and Evolution. Oxford: Oxford UP, 2003.
Wright, P. A., and C. M. Wood. "A New Paradigm for Ammonia Excretion in Aquatic Animals: Role of Rhesus (Rh)
Glycoproteins." Journal of Experimental Biology 212.15 (2009): 2303-312.
Wright, P. A. "Environmental Physiology of the Mangrove Rivulus, Kryptolebias Marmoratus, A Cutaneously Breathing Fish That Survives
for Weeks Out of Water." Integrative and Comparative Biology 52.6 (2012): 792-800.
Xu, Hui, Jian Yang, Yuexiang Wang, Qiu Jiang, Hao Chen, and Houyan Song. "Exposure to 17Î±-ethynylestradiol Impairs Reproductive
Functions of Both Male and Female Zebrafish (Danio Rerio)." Aquatic Toxicology 88.1 (2008): 1-8.
Xu, Jian, Laosheng Wu, Weiping Chen, Pingping Jiang, and Andrew Chia-Shing Chang. "Pharmaceuticals and Personal Care Products
(PPCPs), and Endocrine Disrupting Compounds (EDCs) in Runoff from a Potato Field Irrigated with Treated Wastewater in
Southern California." JOURNAL OF HEALTH SCIENCE J. Health Sci.55.2 (2009): 306-10.
Yan, Zhenhua, Guanghua Lu, Jianchao Liu, and Shaoge Jin. "An Integrated Assessment of Estrogenic Contamination and Feminization Risk
in Fish in Taihu Lake, China." Ecotoxicology and Environmental Safety 84 (2012): 334-40.
Ying, Guang-Guo, Rai S. Kookana, and Ying-Jun Ru. "Occurrence and Fate of Hormone Steroids in the Environment." Environment
International 28.6 (2002): 545-51.
Zakharov, I. A. "Intratetrad Mating and Its Genetic and Evolutionary Consequences." Russ J Genet Russian Journal of Genetics 41.4 (2005):
402-11.
Zhang, Xian, Yajie Gao, Qingzhao Li, Guoxin Li, Qinghai Guo, and Changzhou Yan. "Estrogenic Compounds and Estrogenicity in Surface
Water, Sediments, and Organisms from Yundang Lagoon in Xiamen, China." Arch Environ Contam Toxicol Archives of
Environmental Contamination and Toxicology 61.1 (2011): 93-100.
Zhou, J. L., R. Liu, A. Wilding, and A. Hibberd. "Sorption of Selected Endocrine Disrupting Chemicals to Different Aquatic
Colloids." Environmental Science & Technology Environ. Sci. Technol. 41.1 (2007): 206-13.
Zhu, B. "Functional Role of Estrogen Metabolism in Target Cells: Review and Perspectives." Carcinogenesis 19.1 (1998): 1-27.

Effets du Triclosan sur le comportement des larves de poisson zèbre

Transcription

Documents pareils

2013-14 MT Value shell concept

Presentation of LGPM Research Department - Paris

Collaborative and Computer Aided Design

Multichannel Call centers

Hands-on exercise: NPB-OMP / BT

Double lane fish Equipment for worldwide fish and seafood sector

Regards Croisés, Ecole Centrale Paris Newsletter n°7, October 2006