INOC

Transcription

INOC

‘’Estuaries and Costal Protected Areas’’
‘’Estuaires et Aires Marines Côtières Protégées’’
Dokuz Eylül University Sabancı Kültür Merkezi, İzmir - Turkey
DOKUZ EYLÜL
ÜNİVERSİTY
INOC
04 – 06 November 2014
PROCEEDINGS
Edited by
Mustafa ERGÜN
Şukran CİRİK
Karl Christofer K. KİNGUELEOUA
INOC – June 2015
IMST
PROCEEDİNGS OF THE INTERNATIONAL CONGRESS ON ‘’ESTUARIES AND
COSTAL PROTECTED AREAS’’ ECPA
(İzmir – Turkey, 04 – 06 November 2014)
For bibliographics purposes, this document should be cited as follows: (eds).
Proceedings of ECPA – 2014.
ISBN 000-000-0000-0-15
Cover arranged by Dr. Bariş AKÇALI
Inter Islamic Science & Technology Network on Oceanography (INOC)
Baku Bulvari no: 100, Inciralti- 35340 Izmir –TURKEY
Tel: +90 232 279 15 22 ; Fax: +90 232 278 50 82
Email: [email protected]
Website: http://www.inoctr.org
No part of the material protected by the copyright notice may be reproduced or
utilized in any form by any means, electronic or mechanical, including photocopying,
recording or by any information storage and retrieval system, without written
permission from the copyright owner.
Disclaimer
Authors are responsible for the choice and the presentation of the facts contained in
signed articles and for the opinions expressed therein, which are not necessarily those
of INOC and do not commit the Network.
The designations employed and the presentation of material throughout this
publication do not imply the expression of any opinion whatsoever on the part of
INOC concerning the legal status of any country, territory, city or area or of its
authorities or concerning the delimitation of its frontiers or boundaries.
i
Scientific Committee – Commité Scientifique
Pr. Marie ABBOUD ABI S.
Pr. Abdeselem ARAB
CNRS / NCMS, Batroun- LEBANON
U.S.T.H.B, Algiers- ALGERIA
Dr. Sujjat AL AZAD
Dr. M. Khaleel AL-ZIBDAH
Pr. Nour-el-Islam BACHARI
Pr. Ali BAKALEM
Pr. Şengül BESIKTEPE
Pr. Amel CHAFFAI
Pr. Mustafa ERGUN
Pr. Patrick FRANCOUR
Dr. Harun GÜÇLÜSOY
Pr. Amir IBRAHIM
Pr. Indra JAYA
Dr. Ehsan KAMRANI
Pr. Talib A. KHALAF
Pr. Ahmed KERFOUF
Dr. Samina KIDWAI
Dr. Hratch KOUYOUMJİAN
Pr. Wagdy LABIB
Pr. Sami LAKKIS
Pr. Sahar F. MEHANNA
University Malaysia Sabah, Kota Kinabalu-MALAYSIA
Univ. Aqaba-JORDAN
U.S.T.H.B, Algiers- ALGERIA
INA, Algiers- ALGERIA
IMST, Izmir- TURKEY
University of Sfax - TUNISIA
University Dokuz Eylul, Engineering Faculty-Izmir -TURKEY
University of Nice- FRANCE
IMST, Izmir- TURKEY
Tisrhreen University, Lattakia- SYRIA
Faculty of Fisheries &Marine Sciences, Bogor University-INDONESIA
University of Hormozgan, Banddar-Abbas- IRAN
MSC, Basra University- IRAQ
University of Sidi Bel Abbes-ALGERIA
National Institute of Oceanography, Karachi- PAKISTAN
INOC, Beirut/London- ENGLAND
National Institute of Oceanography and Fisheries, Alexandria- EGYPT
Lebanese University, Beirut-LEBANON
Pr. Mohammed MELHAOUI
Dr. karim MEZALI
Pr. Samia K. MIKHAIL
Pr. Mohamed MOUHIDDINE
University of Oujda -MOROCCO
University of Mostaganem- ALGERIA
University Hassan II, Mohammedia- MOROCCO
Dr. Fereidoon OWFI
IFRO, Tehran- IRAN
INOC, Izmir- TURKEY
MedPAN, Marseille-FRANCE
Faculty of Sciences, IIUM, Kuantan -MALAYSIA
Pr. Orhan USLU
Dr. Chloë WEBSTER
Pr. Kamaruzzaman YUNUS
Organising commitee
Pr. Abdelouahab CHOUIKHI
Pr. Erdeniz ÖZEL
Pr. Gökdeniz NESER
Dr. Harun GÜÇLÜSOY
Dr. Gökhan KABOĞLU
Dr. Remzi KAVCIOGLU
Dr. Idil AKÇALİ
INOC, Izmir- TURKEY
IMST, Izmir- TURKEY
IMST, Izmir- TURKEY
IMST, Izmir- TURKEY
IMST, Izmir- TURKEY
IMST, Izmir- TURKEY
IMST, Izmir- TURKEY
ii
PREFACE
The International Congress on Estuaries and Protected Areas (ECPA) meeting was held in
Izmir-Turkey from 04-06 November 2014 at the Sabancı Culture Centre of Dokuz Eylül
University, organized jointly by the Inter-Islamic Science and Technology Network on
Oceanography (INOC) and the Institute of Marine Sciences and Technology of Dokuz
Eylül University. The main themes of this congress were Coastal Ecosystems,
Environmental Impacts and Impacts of Human Activities on Coastal Change.
In recent years the role of the oceans in the maintenance of the life supporting system of the
globe as a whole, has received particular attention. Ocean resources are often referred to as
“the last resources”. These resources are located within the Exclusive Economic Zones of
coastal countries, and future utilization of those resources may result in significant shifts in
the world economy. Particularly for many developing countries, this could lead to
unprecedented opportunities for national development, provided the utilization of being
rational and within the sustainable development. Therefore, the countries of coastal areas
needs concerted efforts as scientifically organized, well-coordinated programs in order to
exploit marine resources in a protective way with sustainability. The challenging and
bounding oceanic frontier calls for imaginative and innovative endeavors and concerted
efforts of our scientists, technologists, leaders in trade and development finance institutions.
There were 46 papers and 53 posters on the theme of Coastal Ecosystems. On the theme of
Environmental Impacts there were 28 papers and 46 posters. About the theme of Impacts of
Human Activities on Coastal Change there were 35 papers and 28 posters. Total of 38
manuscripts were received from the scientists who attended the congress.
We are very grateful to Prof.Dr. Abdelouahab Chouikhi, the former Executive Director of
INOC, who was the organizer of ECPA and he was also very deliberate and efficient to
look after more than 200 participants in İzmir. Also we are thankful to his efforts for
running of the affairs of INOC more than two decades. Also, we are grateful to the
organizing committee for their kind efforts and surveillance
iii
AVANT-PROPOS
Le Congrès International sur les Estuaires et Aires Marines Côtières Protégées (ECPA) a eu
lieu à Izmir en Turquie du 04 au 06 Novembre 2014 au Centre Culturel Sabanci de
l’Université de Dokuz Eylül, organisé conjointement par le Réseau Inter-Islamique des
Sciences et de Technologie sur l'Océanographie (INOC) et par l'Institut des Sciences
Marines et de Technologie de l'Université de Dokuz Eylül. Les principaux thèmes de ce
congrès étaient comme suit : Ecosystèmes côtiers, Impacts Environnementaux et Impacts
des Activités Humaines sur les Changements Côtiers.
Au cours des dernières années, le rôle des océans dans le maintien du système d'entretien de
la vie de la planète comme un tout a reçu une attention particulière. Les ressources des
océans sont souvent désignées comme "les dernières ressources". Ces ressources sont
situées dans les zones économiques exclusives des pays côtiers, et l'utilisation future de ces
ressources peut entraîner des changements importants dans l'économie mondiale. En
particulier pour de nombreux pays en développement, cela pourrait conduire à des
opportunités sans précédent pour le développement national, à condition que leur utilisation
soit rationnelle et incrustée dans le développement durable. Par conséquent, les pays des
zones côtières ont besoin d’efforts concertés comme des programmes scientifiquement
organisés et bien coordonnés afin d'exploiter les ressources marines d'une manière
protectrice et durable. La stimulante et unifiante frontière océanique demande des initiatives
novatrices et imaginatives et des efforts concertés de nos scientifiques, techniciens, leaders
dans le commerce et dans les institutions financières de développement.
Il y avait 46 documents et 53 posters sur le thème des Ecosystèmes Côtiers. Sur le thème
des Impacts sur l'Environnement, il y avait 28 documents et 46 posters. À propos du thème
des Impacts des Activités Humaines sur les Changements Côtiers, il y avait 35 documents
et 28 posters. Au total, 38 manuscrits ont été reçus des scientifiques qui ont assisté au
congrès.
Nous sommes très reconnaissants envers Prof.Dr. Abdelouahab Chouikhi, l'ancien Directeur
exécutif de INOC, qui était l'organisateur de l'ECPA et il était aussi très délibérée et efficace
dans la prise en charge de plus de 200 participants à İzmir. Aussi, nous sommes
reconnaissants envers ses efforts pour la gestion des affaires d’INOC pendant plus de deux
décennies. Aussi, nous sommes reconnaissants au Comité d’Organisation pour leurs
aimables efforts et leur surveillance.
iv
TABLE OF CONTENTS – TABLES DE MATIERES
ITEM
PREFACE
AVANT-PROPOS
TABLE OF CONTENTS
THEME 1: COASTAL ECOSYSTEMS: UNDERSTANDING THE
PHYSICAL AND BIOLOGICAL COMPLEXITY OF COASTAL
ENVIRONMENTS
Morphodynamics of the coastal zone of Sidi-Fredj Peninsula (West Algiers)
Pages
iii
iv
v
ix
1
AISSA AINI
Population genetic structure of the Black- lipped Oyster (Pinctada
margaritifera) using PCR-RFLP method in the Persian Gulf
13
M. MOAZAMI, M. A. SALARI-ALIABADI, B. ARCHANGI, H. ZOLGHARNEIN, A. GHASEMI
Water and Nutrient Budgets of Lake Burullus, Egypt
18
T. M. EL-GEZIRY, A.A. M. RADWAN, M. A. SAID, FATHY T. TAYEL
L’anguille (Anguilla anguilla l.) dans les estuaires du Sebou et du Loukkos
(Atlantique, Maroc)
26
F. WARIAGHLI, R. HANEL , M. FEKHAOUI , A. YAHYAOUI
Water, nitrogen and phosphorus budgets in the Arabian-Persian Gulf
43
MOHAMED A. SAID; ABEER EL-SAHARTY
The status of the cartilaginous fish species in the Lebanese coastal waters
MYRIAM LTEIF, GABY KHALAF, MARION JARRAYA, RITA MOUAWAD and PHILIPPE
LENFANT
Population dynamical parameters of the Atlantic lizardfish (Synodus saurus)
from the Mediterranean waters of Egypt
50
56
MYRIAM LTEIF, GABY KHALAF, MARION JARRAYA, RITA MOUAWAD1 AND PHILIPPE
LENFANT
Évaluation bioécologique de la qualité du milieu à travers la faune associée du
genre Cystoseira
65
SELLAM L., BENALI MYRIAM, CHAFIKA R. Z.
Food and feeding of Scorpaena scrofa Linnaeus, 1758 in the Western part of
Libya
69
ESMAIL SHAKMAN; SALWA SHAHRANI
Analyse dynamique de l'état du stock d’un poisson Centracanthidae (Spicara
maena, Linnaeus, 1758) dans la région centre de l’Algérie
75
HARCHOUCHE KAMEL
Reproductive cycle of the sea cucumber Holothuria tubulosa (Holothuroidea:
Echinodermata) in the Southwestern Mediterranean Sea
88
MEZALI K.; SOUALILI D. L.
Identification and Illustration of macrobentic Crabs in the intertidal zone of
Khark Island (Persian Gulf)
95
Y. PARSA, S. M. B. NABAVI, M. A. SALARI-ALIABADI, A. SAVARI, A. VAZIRIZADE
International Congress on "Estuaries and Coastal Marine Protected Areas" ECPA 2014 (Izmir –Turkey)
Page v
Macrozooplanktonic fauna in the Algerian coast
HAFFERSSAS A AND KHERCHOUCHE A.
Etude de la reproduction de l’Anchois européen Engraulis encrasicolus dans le
golfe de Béjaïa
99
107
RAHMANI AMINA., KADJI-DJOUDAD HAFSA, IGUEROUADA MOKRANE.
Suivi de l’activité de la pêche hauturière de la sole Solea aegyptiaca dans le
Gouvernorat de Sfax
111
KHALIFA FATEN, HAJJI FERID, GHORBEL MOHAMED, JARBOUI OTHMAN
Performance reproductive des femelles de la daurade royale (Téléostéen,
Sparidae) des côtes sud de la Tunisie (Golfe de Gabes) selon les critères
anatomiques et histologiques
116
A. HADJ TAIEB, M. GHORBEL & O. JARBOUI
Assessment of diversity and distribution of macro benthic invertebrates in Anzali
Lagoon- Iran
120
MAHSHID JALILI1, FATEMEH AMINI YEKTA
Structure and diversity of macrobenthic communities’ along the northwestern
coasts of the Gulf of Tunis
123
BOULAJFENE WAFA, CHEMKHI DORSAF, BEN ISMAIL DORSAF, BEN HASSINE OUM
KALTHOUM AND TLIG - ZOUARI SABIHA
Otolith morphology description of some Sparidae in the central coasts of Algeria
(South Mediterranean Sea)
130
BOUFERSAOUI SAMIRA, BAKIRI NESRINE, SOUIDI NASSIMA, HARCHOUCHE KAMEL
Description of Gastrocotyle trachuri Van Beneden &Hesse, 1863 (Monogenea:
Gastrocotylidae) parasitizing Trachurus trachurus (Linnaeus, 1758) from the
gulf of Béjaia
135
ICHALAL KELTOUM, IDER DJAMILA AND RAMDANE ZOUHIR
Diversity and distribution of epibiotic bryozoans of molluscs of the north and
northeast Tunisian coasts
139
BEN ISMAIL DORSAF, FILALI WAJDI, BEN JEMAA SOUAD, BEN HASSINE OUM
KALTHOUM, TLIG ZOUARI SABIHA
Reproduction of round sardinella (Sardinella aurita Valenciennes, 1847) from
Bou-Ismail Bay (Central Algerian coast, south-western Mediterranean)
147
A. BOUAZIZ, A. NOUAR
Status of artisanal fisheries of the Libyan coast
159
SHAKMAN E.; ETYAB K.; TABONI I., ET-WAIL M.; BEN ABDALLAH A.
Community Structure of Bloomer Phytoplanktons around the Shrimp Culture
Sites in Bushehr Province Coastal, in Persian Gulf
KHOSROW AEIN JAMSHID; FATEMEH MOHSENIZADEH; SOHEILA OMIDI ; FERIDOON
OWFI
164
Page vi
Contribution to the phylogenetic and phylogeographic study of some limpets
species in the Algerian coastline
173
KARIM MEZALI AND ZOHEIR BOUZAZA
Étude de la diversité génétique de trois espèces du genre Epinephelus : E.aeneus,
E.costae et E.marginatus dans le Golfe de Gabès par analyse du gène
cytochrome b de l’ADN mitochondrial
179
ELGLID.A, FADHLAOUI-ZID K., CROUAU-ROY B., BRADAI M. N.
Faune vertébrée de quelques milieux insulaires d’Algérie : Diversité et aspects
de conservation
183
RIADH MOULAÏ, ABDELAZIZE FRANCK BOUGAHAM, LYES AISSAT, ABDELMADJID
CHELLI, MOHAMMED GHERMAOUI ET KAMEL HAMADI
Reproductive dynamics as a management tool for the spotted grunter Pomadasys
commersonnii (Lacepède, 1801) from the Arabian Sea off Oman
191
SAADAOUI A., SAIDI B., BRADAI M. N.
Reproductive parameters of the common stingray Dasyatis pastinaca from the
Gulf of Gabès (central Mediterranean Sea)
201
F. R. AL-KIYUMI; SAHAR F. MEHANNA; BADRIA AL-SIYABI
THEME 2: ENVIRONMENTAL IMPACTS: COASTAL HAZARDS
Use of hematological and biochemical parameters and histological changes to
assess the toxicity of drumstick tree (Moringa oleifera) seeds extract on Tilapia
(Oreochromis niloticus) fish
204
205
HOSSAM H. ABBAS AND ASHRAF A. EL-BADAWI
Vulnérabilité des écosystèmes littoraux et impacts des changements globaux : les
facteurs de dégradation des dunes maritimes de l’Est-Algérois
221
HANIFI N., BENCHOUK N. et TAGUEMOUT C.
Impact de la pollution sur Donax trunculus dans la baie d’Annaba (Algerie):
croissance et mesure de biomarqueurs durant deux années
232
SOLTANI NOUREDDINE, AMIRA AKILA, SIFI KARIMA
Le Barbeau de la Soummam est-il sterile ?
DJOUDAD-KADJI HAFSA, RAHMANI AMINA, CHEVALIER CHRISTINE, KADJI BELAID,
EXBRAYAT JEAN-MARIE, MOUHOUB CHAFIKA
Décontamination biologique des eaux résiduaires de l’Oeud Méboudja (Annaba,
Algérie) par élimination des microorganismes sous l'effet épurateur d'un
hydrophyte : Elodea canadensis
242
248
LECHEKHAB S., LECHEKHAB H., BELAZ A.
Evaluation of the sea water quality of Mostaganem bay through the sea urchin
Paracentrotus lividus (Lmk) bioindicator
255
OULHIZ A., SOUALILI D. L. ; MEZALI K.
Page vii
Risque environnemental du cadmium chez Donax trunculus (Mollusca, Bivalvia)
: effet sublétal sur le taux des acides nucléiques dans les gonades
260
MERAD ISMA, SOLTANI NOUREDDINE
Isolation of multiresistant opportunistic bacteria from estuarine waters in Algiers
DJOUADI L.N., ARAB D., BOULARAF M., BOUACEM K., BOUANANE-DARENFED A.,
ABDERRAHMANI A ., FARDEAU M.L., NATECHE-METIAZ F.
Qualité menaçante des eaux de l’Oued Méboudja (Annaba, Nord-Est Algérien)
affluant dans la Méditerranée
268
273
LECHEKHAB S., LECHEKHAB H., BELAZ A., TERFAYA M.
Acetylcholinesterase activity as a biomarker response to methylmercurychloride
exposure in brain of Epinephelus coiodes (orange spotted grouper)
283
SHARAREH SAVARI, ALIREZA SAFAHIEH, BITA ARCHANGI, AHMAD SAVARI AND
RAHIM ABDI
THEME 3: THE IMPACTS ASSOCIATED WITH HUMAN ACTIVITIES
AND RESPONSES TO COASTAL CHANGE
The human impact: a principal factor of the environment disturbance in Algeria,
example of Algiers coast
290
291
BOUHADAD R
Effect of Anthropogenic Activities on the costal waters of Persian Gulf
299
ALIAKBAR HEDAYATI
La conchyliculture en Algerie : situation actuelle et perspectives de
developpement
308
MESLEM-HAOUI N., BOUBECHICHE Z., LOURGUIOUI H., REBZANI C.
Etude socio-économique pour la mise en place d’une Aire Marine Protégée au
Cap de garde à Annaba, Nord - Est Algérien
312
SERIDI A., BOUBEKRI I. ET DJEBAR A. B.
Elasmobranchs bycatch in trawl fisheries in the Gulf of Gabès (Southern
Tunisia, Eastern Mediterranean)
320
ENAJJAR SAMIRA, SAIDI BECHIR, SAADAOUI ABDESSELEM, MOHAMED NEJMEDDINE
BRADAÏ
Concentration, enrichment and distribution of heavy metals in sediments of the
Tafna estuary (Algeria)
325
AMEL FELLAH AND NACÉRA DALI YOUCEF
Etude quantitative et qualitative des protéines gonadiques de Donax trunculus
(Mollusca: Bivalvia) de la baie d’Annaba (Algérie)
334
NADIA SOLTANI-MAZOUNI & AMEL HAMDANI
Page viii
THEME 1: Costal Ecosystems: Understanding the Physical and Biological complexity
of coastal environments
Page ix
Morphodynamics of the Coastal Zone of Sidi-Fredj Peninsula (West Algiers)
Morphodynamics of the coastal zone of Sidi-Fredj Peninsula
(West Algiers)
Aissa AINI
University of Abderrahmane Mira. Bejaia, Algeria [email protected]
SUMMARY
Along the sandy coasts such as the eastern coast of Sidi-Fredj, waves and currents induced mainly by the
means which play a major role in the morphological evolution of beaches. The eastern coast of Sidi -Fredj,
which is the focus study area, is characterized by sandy formations developed over a distance of about 3km
from Sidi-Fredj port to Moretti beach. Within the recent decades, Moretti beach has experienced a significant
decline and diminution of the coastline after the construction of Sidi-Fredj port in 1970, and also with a
dramatic deterioration of the beach outside El Riad El Minzah hotel which is caused by the poor
implementation of protective structures in this area. The main goal is to study the morphodynamical evolution
of this coast portion. From a diachronic position analysis of the shoreline from 1921 to 2008, In fact, between
1921 to 1956, the area was affected by an erosion of about 50 m, or 1.4 m / year. From 1972 to1980,
experienced large scale erosion with an average rate of 4 m / year in the eastern part. From 1980 to 1993, the
coast went through a steady state with the appearance of two sectors; the first eroded at an average rate of 4.64 m / year, and the second fattening at an average rate of 1.85 m / year. Degradation continued at the
beach leaning against the south jetty of the port where an advanced erosion of more than 22 m (+2.4 m yr-1)
had been recorded between 1993 and 2003. From 2003 to 2008, the area recorded a higher rate of shoreline
of 8 m (1.66 m yr-1). The comparative study of sediments transport using the three empirical formulas showed
that the predominant transit is the one caused by the swell from the West side. In Vector modeling, residual
sediments transport from the Sidi-Fredj beach underwater by the GSTA model of Gao and Collins, 1994.This
treatment with both FB - and FB +, does not show much changes between the direction of vectors. Results
obtained onsite also showed the consistency between McLaren model and Gao/Collins model with
sedimentary characteristics of the beach. Application of McLaren / Gao and Collins models revealed that the
sediments transport was in succession and the spreading of waves within the beach was mainly done offshore.
Sediments are first suspended by waves at the time of breaking and then driven out to the sea by the return
currents (rip-current). Sediments movement is closely linked to the breaking waves and longshore currents.
Key words: Shore line, Erosion, Grit, Beach, Sediment Dynamics, Modeling.
RESUME
Le long des littoraux sableux tels que la côte Est de Sidi-Fredj, les vagues et principalement les courants
moyens induits par celles-ci jouent un rôle majeur dans l’évolution morphologique des plages. La côte Est de
Sidi Fredj, notre zone d’étude, est caractérisée par des formations sableuses développées sur une longueur
de 3km environ entre le port de Sidi-Fredj et la plage de Moretti. Durant ces dernières décennies, cette
plage a connu d’importants démaigrissements et recul du trait de côte après la construction du port de SidiFredj (1970), aussi une dégradation spectaculaire de la plage devant l’hôtel El Riad et El Minzah,
causée par la mauvaise implantation des ouvrages de protection de cette zone. Le but essentiel est d’étudier
l’évolution morphodynamique de cette portion du littoral de la Baie d’El Djemila. D’une analyse
diachronique de la position de la ligne du rivage de 1921 à 2008. En effet, entre 1921-1956, la zone a connu
une érosion d’ordre 50 m, soit 1,4m/ an. La période de 1972-1980 a enregistré une érosion généralisée avec
un taux moyen de – 4 m/an dans la partie Est. La période de 1980 à1993 a été marquée par état d’équilibre
avec l’apparition de deux secteurs, le premier en érosion avec un taux moyen de-4.64 m/an, le deuxième en
engraissement au taux moyen de 1.85 m/an. La progradation s’est poursuivie au niveau de la plage
adossée à la jetée sud du port où une avancée de plus de 22 m (+2.4 m an-1) a été constatée entre
1993 et 2003.A partir de 2003 à 2008 cette zone a enregistré un taux d’avancée de la ligne de rivage de 8 m
(soit 1.66 m an-1). L’étude comparative du transit sédimentaire par les trois formules empiriques, fait
ressortir que le transit prédominant est celui provoqué par la houle du secteur Ouest. D’une modélisation
vectorielle du transport sédimentaire résiduel de la plage sous-marine de Sidi-Fredj, par le modèle GSTA de
Gao et Collins, 1994.Le traitement avec les deux cas (FB- et FB+) ne montre pas beaucoup de changements
entre les vecteurs de direction. Les résultats obtenus sur le site montrent aussi la cohérence entre le modèle
de McLaren/Gao et Collins avec les caractéristiques sédimentaires de la plage. L’application du modèle de
McLaren/Gao et Collins nous a révélé que le transport sédimentaire au cours de succession et de l’étalement
des vagues sur la plage s’effectue essentiellement vers le large. Les sédiments sont d’abord mis en
suspension par les houles au moment de leur déferlement et sont entraînés ensuite vers le large par les
Page 1
courants de retour (rip-current). La circulation sédimentaire est donc très liée aux houles déferlantes et aux
courants littoraux.
Mots Clés: Ligne de rivage, Erosion, Granulométrie, Plage, Dynamique sédimentaire, Modélisation.
INTRODUCTION
Les environnements littoraux sont situés à la frontière du continent et de l’océan. Entre des
domaines que tout oppose, ils forment une interface particulière qui reste encore mal
connue à l’heure actuelle. Ainsi, les processus dynamiques, les constituants du milieu et
leurs relations n’ont jamais été intégralement analysés. En fait, il semble que l’étude du
littoral constitue un sujet inépuisable tant les côtes sont diversifiées autour de la planète et
variables dans le temps. La compréhension de ces environnements représente donc un vaste
domaine d’investigation pour la recherche fondamentale et les sciences naturelles. Il faut
également constater que la zone côtière est un espace d’activités privilégié par les
hommes. On y trouve une grande concentration d’habitations, de plus, la pêche, le
tourisme et les activités portuaires sont des domaines économiques majeurs. La zone
côtière est donc considérée comme très attractive, mais elle est aussi particulièrement
dangereuse. En effet, les évolutions spectaculaires, l’impact des tempêtes et de l’érosion à
long terme menacent parfois les activités humaines. Ces risques et surtout la
méconnaissance du milieu naturel entraînent légitimement un sentiment de méfiance ou de
peur. Malheureusement, les réactions humaines sont trop souvent mal adaptées, très
coûteuses et parfois destructrices pour l’environnement. Encore à l’état naturel il y a
quelques décennies, le littoral Nord-Algérien connaît aujourd’hui une urbanisation
effrénée et un aménagement sans cesse croissants dus à des extensions ou à de nouvelles
constructions portuaires et au développement de stations balnéaires. Le littoral de la
presqu’ile de Sidi-Fredj, localisé à l’ouest d’Alger, est un exemple de cette évolution. Il a
connu une construction portuaire en 1969-1971 et l’implantation de plusieurs infrastructures
balnéaires directement érigées sur le cordon dunaire. Ces infrastructures ont contribué à la
modification des équilibres naturels, ce qui se traduit par une augmentation du recul du
rivage dans ce secteur. A titre d’exemple, la partie centrale de la côte, sur laquelle est bâti le
complexe touristique d’El Riad, présente des signes de maigrissement rapide. En effet,
d’une part, la dune bordière est presque totalement arasée et d'autre part les fonds marins
sont devenus de plus en plus profonds après la construction du port. Cependant, aucune
étude quantitative n’a été proposée jusqu’à présent.
Les effets induits par cette occupation du milieu littoral, se sont fait beaucoup sentir entre
l’Hôtel El-Riad, et l’extrémité Est de Moretti où d’importantes modifications du rivage ont
été constatées :
 Démaigrissement des plages et recul du trait de côte ont été enregistrés juste après la
construction du port de Sidi-Fredj(1970).
 Dégradation spectaculaire de la plage devant l’Hôtel El-Riad et El –Minzah lors des
tempêtes de 1981 et 1984.
Aspect général sur la zone d’étude
La plage Est de Sidi-Fredj qui fait l’objet de ce travail se localise dans la partie orientale
de la presqu’ile de Sidi-Fredj. Elle est limitée à l’Est par le massif d’Alger et à l’Ouest par
le massif du Chenoua, le Sahel et la plaine de la Mitidja au Sud et la mer Méditerranée au
Nord. Ce périmètre d’étude s’étend du port de plaisance de Sidi-Fredj jusqu’à la plage
de Moretti sur une distance de 03 Km environs et vers le large jusqu’à une profondeur de
20 m (Fig.1).
Page 2
Figure.1 : Situation géographique de la zone d’étude – la plage Est de la presque île de
Sidi-Fredj. (Tirée de la carte topographique de CHERAGA 1/25000e, 1960).
Du point de vue géologique, les terrains
du littoral de Sidi-Fredj sont formés de corps
sédimentaire d’âge Moi-plio-quaternaires, développés dans des formations de marnes bleu ou
gneiss recouvertes, localement par des couches gréseuses ou sableuses. la zone est située dans
une province caractérisée par une activité sismique et néotectonique. Cette activité est
matérialisée sur le terrain par la présence de failles actives, telles que celles du sahel, de
Tipaza, du Chénoua et celle supposées en mer. Entre Sidi-Fredj et Ras Acratas, le littoral est
caractérisé par une importante accumulation sableuse actuelle et subactuelle. Entre
l’embouchure de l’oued Beni Messous et la pointe de Sidi- Fredj, ce cordon sableux est limité,
du coté de la mer, par des plages plus ou moins développées (Plage de Staouali-Club des pins )
et présentent un tracé rectiligne. A l’Est de l’embouchure de l’oued Beni Messous ce même
cordon est taillé en falaises qui par endroit dominent directement la mer. Les dunes littorales
de la baie d’El-Djemila constituent le prolongement oriental d’un cordon dunaire qui
prend naissance à l’embouchure de l’Oued Mazafran et se continue jusqu’à l’Est de l’oued
Beni Messous. A la suite du cordon dunaire, et vers la mer, s’étale principalement une zone de
plage sableuse. Cette plage, qui s’adosse contre la jetée sud du port de Sidi Fredj, décrit un
large arc de cercle dont la concavité s’atténue progressivement vers l’Est. Les agents
hydrodynamiques les plus déterminants dans la dynamique sédimentaire le long de la côte
étudiée sont les vents et les houles.
Les données sur les régimes de vents, de notre région d’étude proviennent des
observations, de U S Naval Weather Service command (USNWSC), faites au large des
côtes algériennes à la croisée de la latitude 37º et 40º Nord et la longitude 0º et 5º Est, pour
une période allant de 1963 à 1970. L’analyse des régimes de vents fait apparaître fait
apparaître trois (3) directions essentielles des vents dominants, Est, Nord-Est et Ouest avec
des fréquences d’apparition respectives de 18,9%,16,8% et
21,9 %. Le principe de
l’analyse de la houle au large est basé sur des observations faites à bord des navires, de
L’US Naval Weather Command et publié dans leSummary of Synoptic
Meteorological Observation (SSMO), s’étalant sur une période de 8 ans de 1963 à 1970
regroupant 45000 observations. Ces données couvrent une zone au large des côtes
algériennes située en longitude Est entre 2° et 5° et en latitude Nord entre 36°50’ et 38°.La
rose annuelle : fait ressortir quatre directions prédominantes, le Nord-Est, l’Est, l’Ouest et
le Sud-Ouest avec des fréquences d’apparition de 15,24%, 18,69%, 22,19% et 9,39%
respectivement. L’état calme représente 16,14%.
Page 3
Sur le plan bathymétrique, la zone présente un fond marin assez régulier qui se traduit par
des isobathes parallèles à la côte. Ces isobathes se serrent au fur et à mesure que l’on
avance vers l’Est des épis réalisés au niveau de la plage de Moretti, entre 0 et – 4 m. Au
delà des -4 m de profondeur, ces isobathes s’élargissent au fur et à mesure que l’on avance
vers le large.
METHODOLOGIE
Pour atteindre les objectifs tracés à travers ce thème, nous étions dans l’obligation de proposer
une méthodologie de recherche et de sélectionner un certain nombre de techniques fiables pour
élaborer ce travail.
Analyse du trait de côte par la photographie aérienne et les images satellitales
ALSAT1
L’étude des changements passés d’un littoral peut se faire par différentes méthodes
d’analyse. L’interprétation de photographies aériennes, l’analyse de cartes (historiques,
topographiques et hydrographiques), l’étude des images satellitales, des relevés sur le terrain et
des enquêtes auprès des gens du milieu constituent autant de sources d’information pour
étudier le trait de côte (Grenier et Dubois, 1990). Dans le cas étudié l’analyse diachronique de
l’évolution du littoral a été abordée en comparant les fonds cartographiques disponibles à
différentes échelles et les missions de photographies aériennes. Ces documents (missions
aériennes et cartes) ont été sélectionnés d’une manière à couvrir l’ensemble du linéaire côtier.
Les résultats les plus significatifs ont été obtenus en comparant des photos aériennes de 1972
et 2003, concernant le secteur de Sidi-Fredj, campagnes donc séparées par un laps de temps
de 32 ans. Ces données issues de clichés et des cartes correspondantes ont été complétées
par des levés de terrain. Les données satellitales disponibles pour effectuer ce travail
appliqué à la problématique de l’érosion côtière que subit notre zone d’étude, sont des
images satellitaires acquises par le satellite ALSAT 1.
Deux scènes satellitales acquises par ce satellite, pendant la période juillet 2008 à
novembre 2009 ont été utilisées pour extraire le trait de côte de 2008 et celui de 2009. Ces
deux scènes ont été géoréférenciées dans un système de projection UTM Nord Sahara
1959-zone 31 et pour un ellipsoïde WGS-84.
Figure 2 : Extrait d’une scène satellitaire de la plage Est de Sid-Fredj (ALSTA 1 – Juillet 2008)
Page 4
Profils de plage
Le levé des profils de plage a été réalisé à l’aide d’un tachéomètre de type LAICA TS02, à
partir de repères fixes placés sur le haut de la plage. Quatre profils de plage ont été effectués
sur la plage Est de Sidi-Fredj.
Prélèvements d’échantillons et analyse granulométrique
Les prélèvements sur la plage aérienne de la plage Est de Sid-Fredj ont été réalisés
simultanément avec les missions de mesures topographiques effectuées en Juillet 2009 et Avril
2010. Au total huit (08) échantillons de sédiments superficiels ont été prélevés sur cette plage,
répartis sur quatre profils plus au moins perpendiculaire au rivage. Le positionnement des
points d’échantillonnage a été opéré à l’aide d’un tachéomètre.
La totalité des échantillons prélevés sont constitués d’un seul type de sédiment, le sable
caractérise la plage est de Sidi-Fredj. Dans cette étude nous avons fait appel à cette méthode
d’analyse classique et courante basée sur l’étude statistique des particules qui a pour finalité :
 La relation entre les changes sédimentaire qui s’opèrent entre l’avant plage, la plage et
l’arrière plage.
 De comprendre le sens du transport sédimentaire longitudinal de la côte dans le temps.
 Application d’un model mathématique vectorielle GSTA (Grain Sise Trend Analysis)
développé par GAO et COLLINS pour connaitre le schéma des mouvements
sédimentaires résiduels qui s’opèrent le long de cette côte (1994).
RESULTATS
Variations du trait de côte sur une période (1921-2008)
L’évolution du trait de côte depuis 1921 a été retracée d’après les levées topographiques
effectuées en 1921, 1956 et 1970 (L.C.H.F 1970) et celles de 1993 et 1995 (M.BOUTIBA
1996).
Période de 1921 à 1956.
Le trait de côte de la zone située entre la jetée secondaire du port et l’hôtel El Riad n’a connu
que très peu de changement. Le reste a connu un recul de l’ordre de 50m, soit une érosion de
l’ordre de 1,4m par an. Contrairement à la plage située à l’embouchure de la jetée sud du port
de Sidi Fredj, le secteur situé entre l’hôtel El Riad et l’hôtel El Minzah a connu deux phases
bien distinctes. Une période d’engraissement de l’ordre de 40m entre 1921 et 1956, suivie
d’une période de recul de l’ordre de 40m sur une période de 1968 à 1984, même chose pour la
frange littorale de Moretti, qui a connu un recul de son trait de côte de 70m pour la même
période.
Période de 1972 à 1980
Par rapport à la totalité du trait de côte examiné entre le port de plaisance de Sidi-Fredj et la
limite Est de Moretti, seul celui situé entre la jetée secondaire du port et l’hôtel El Riad n’a
connu que très peu de changement. Le reste a connu un recul de l’ordre de -5.54 m (-0.69 m
an-1) au niveau du profil 11 et de -44.30 m (-5.54 m an-1) au profil 5. En effet, la construction
du port de Sidi-Fredj (1969-1971) a induit des variations très importantes tout au long de son
littoral Est. Si on prend comme référence le trait de côte de 1970 nous remarquons une avancée
de l’ordre de 28.25 m (+3.53 m an-1) sur la partie adjacente à la jetée secondaire (profil 15),
mais cette valeur diminue progressivement en s’éloignant vers l’Est pour arriver à 5.81m
(+0.72 m an-1) au niveau du profil 12.
L’engraissement de la plage adjacente au port à partir de 1980, est dû à sa construction. En
effet son implantation a engendré des perturbations notables, car cet ouvrage a fait obstacle au
Page 5
transport longitudinal du sédiment et a modifié la direction des vagues du secteur Nord-ouest
par diffraction ce qui a entraîné l’érosion de la plage en allant vers Moretti. Plus précisément
l’engraissement et la forme arquée de la plage proche du port sont dus à la rotation de la houle
autour de l’extrémité de cette jetée principale, qui se traduit par la modification de sa direction
et le transfert de son énergie vers la zone protégée. Ce phénomène de diffraction entraîne la
création d’un courant, qui ramène les sables depuis la plage Est vers cette zone. En
conséquence la valeur de l'alluvionnement y augmente pour atteindre les 62 m (+5.54 m an1). Cette accrétion a des valeurs moyennes qui vont en décroissant vers l’Est pour atteindre 24
m (+1.85 m an-1) au niveau du profil 10, même chose pour la frange littorale de Moretti, qui a
connu un recul de son trait de côte de –66 m (-4.64 m an-1) pour la même période. La
réduction de la largeur des plages devenant inquiétante, on a entrepris des études pour cerner le
problème et pallier ces désordres. Des ouvrages de protection ont été implantés en 1985,qui
ont aggravé la situation, on donnant une autre allure au phénomène de l’érosion de cette zone,
soit créer des zones d’accumulations de sable le long des ouvrages installés. Ainsi, le
phénomène de diffraction entraîne la création d’un courant, qui est la cause principale de ces
accumulations de sables.
Il en ressort que la tendance à la progradation s’est poursuivie au niveau de la plage adossée à
la jetée sud du port où une avancée de plus de 22 m (+2.4 m an-1) a été constatée entre 1993 et
2003. Au contraire, le trait de côte devant Moretti a continué à reculer provoquant
ainsi la disparition presque totale de la plage dans ce secteur en 1995. Plus spectaculairement
le front de mer de Moretti a vu son trait de côte reculer de 9 à 11 m (-0.96 m an-1 et -1.10 m
an-1) durant la période de 1993 à 2001. A l’emplacement des ouvrages de protection, des
plages alvéolaires se sont reconstituées au détriment du trait de côte situé dans l’axe de la passe
qui a localement connu une érosion de l’ordre 5 m.
A partir de 2003 le taux d’avancée de la ligne de rivage est de 8 m (soit 1.66 m an-1) au niveau
de la partie gauche du profil 15. La progression de la plage s’est poursuivie au cours de la
période de 1972 à 2008 et le trait de côte a continué de progresser lui aussi vers la mer. Par
contre la plage de Moretti est caractérisée par une érosion importante et continue depuis 1972.
Cette érosion a entraîné un recul du trait de côte estimé à -3 m soit un taux de recul moyen de
l’ordre de -0.6 m/an.
Tableau.1. Taux et vitesses de variation du trait de côte du littoral Sidi-Fredj
Profil
Taux
1972-80
(m)
Vitesse
1972-80
(m/an)
Taux
1980-93
(m)
Vitesse
1980-93
(m/an)
Taux
1993-03
(m)
Vitesse
1993-03
(m/an)
Taux
2003-08
(m)
Vitesse
2003-08
(m/an)
Taux
1972-08
(m)
Vitesse
1972-08
(m/an)
P1
-33,24
-4,15
-52,63
P2
-36,01
-4,50
-54,01
-4,04
-9,69
-0,96
-2,77
-0,55
-98,33
-2,73
-4,15
-10,24
-1,02
-3,04
-0,60
-103,3
P3
-38,78
-4,84
-2,86
-55,40
-4,26
-10,52
-1,05
-2,49
-0,49
-107,9
P4
-2,97
-40,44
P5
-44,32
-5,05
-60,94
-4,58
-11,08
-1,10
-2,21
-0,44
-114,6
-3,18
-5,54
-59,55
-4,68
3,04
0,30
-1,27
-0,25
-102,1
P6
-2,83
-43,21
-5,40
-63,70
-4,90
4,43
0,44
2,71
0,54
-99,77
-2,77
P7
-37,67
-4,70
-66,48
-5,11
5,81
0,58
3,87
0,77
-94,47
-2,62
P8
-30,47
-3,80
-54,48
-4,19
8,58
0,85
4,15
0,83
-72,22
-2,00
P9
-16,62
-2,07
-34,32
-2,64
7,47
0,74
7,75
1,55
-35,72
-0,99
P10
-24,93
-3,11
24,10
1,85
6,77
0,67
8,58
1,71
14,52
0,40
P11
-5,54
-0,69
33,24
2,55
4,15
0,41
2,77
0,55
34,62
0,96
P12
5,81
0,72
51,52
3,96
11,63
1,16
4,15
0,83
51,52
1,43
P13
8,86
1,10
56,78
4,36
18,00
1,80
5,10
1,02
88,54
2,46
P14
22,16
2,77
63,72
4,90
19,35
1,93
5,54
1,11
110,77
3,07
P15
28,25
3,53
72,02
5,54
22,16
2,40
8,30
1,66
130,73
3,63
Page 6
NB : Les valeurs négatives indiquent un recul du trait de côte et les valeurs positives une avancée.
Bilan du transit sédimentaire
Approche de la dynamique sédimentaire par la granulométrie
L’analyse granulométrique nous permet de connaitre la constitution fréquentielle des
différentes fractions qui composent le stock sédimentaire d’une part et de définir les
paramètres de la dynamique (mouvement) des sédiments (zone d’accumulation, zone
d’érosion, sens du transit sédimentaire.
Figure 3 : Positionnement des points de prélèvements au niveau de la baie d’ElDjemila
a) Au niveau de la plage Est de Sidi-Fredj
Les échantillons de sédiments prélevés au niveau du jet de rive de la plage de Sidi-Fredj
affichent un grain moyen qui varie entre 2,08 et 2.68 (à l’échelle de phi). De part et d’autre de
la partie centrale de la plage de Sidi-Fredj, une organisation spatiale se dessine. À l’ouest, vers
la digue portuaire, la granulométrie montre la valeur la plus élevée tandis que vers l’Est.
Depuis la partie orientale du littoral en érosion (Moretti), la taille du sédiment décroît en
direction du secteur en accrétion (la partie occidentale). La granulométrie confirmerait la
direction de la dérive littorale dirigée vers le port depuis la partie orientale du rivage.
b) Au niveau de la baie d’El Djemila
Les résultats des analyses granulométriques effectuées par le CTH sur les 105 échantillons de
sédiments superficiels ont
été transmis au Laboratoire d’Etudes Maritime (LEM) pour les
besoins de l’étude sédimentologique dont l’objectif est la recherche de la répartition des
sédiments en mer et par conséquent leur modalité de mise en place. Sur l’ensemble des
échantillons prélevés, sept (07) échantillons se sont révélés de nature rocheuse. Leur
positionnement est donné sur la figure ci-après. L’étude sédimentologique a donc porté sur 93
échantillons de sédiments superficiels prélevés dans la baie d’El Djamila, et 4
échantillons au niveau de la passe d’entrée du port .
Le fond marin de la baie d’El Djamila entre la côte et l’isobathe -20 mètres est sableux
entrecoupé par endroit par des pointements rocheux. Le sable en général est de taille moyenne,
le diamètre médian étant compris entre 250 et 500 µm. Cette couverture de sables moyens est
entrecoupée par endroit par de petites accumulations de sable fin. La répartition des sédiments
Page 7
obéit de façon générale au schéma classique de la répartition des sédiments en mer à savoir
une décroissance graduelle de la taille des particules de la côte vers le large. Toutefois, la partie
Est du site montre une décroissance horizontale graduelle de la taille des sédiments d’Est en
Ouest. C’est ainsi que cette partie du site est tapissé à la côte par des sables grossiers à très
grossiers voir même par des galets. Cette décroissance horizontale indique d’une part la
diminution de la vitesse des courants en allant vers l’Ouest et d’autre part la forte énergie de la
houle qui y règne mettant les sédiments en perpétuel remaniement. (fig.4)
Figure 4 : Carte de répartition spatiale de la médiane (D50)
La répartition du décile supérieur est analogue à celle de la médiane granulométrique. En effet,
on retrouve la diminution de la taille du grain de la côte vers le large ainsi que la décroissance
horizontale de la taille des grains en allant d’Est en Ouest.
La répartition spatiale de ces sédiments montre d’une part une décroissance du diamètre des
sédiments en allant de l’Est vers l’Ouest en passant du gravier au sable moyen, liée
probablement à une décroissance de la vitesse des courants de la dérive littorale s’effectuant
d’Est en Ouest , et d’autre part une décroissance du diamètre des sédiments dans le profil (de la
côte vers le large), lié aux courants de retour (fig.5)
Figure 5 : Carte de répartition spatiale du décile supérieur (D90)
Page 8
Quantification des transferts sédimentaires
La quantification du transit sédimentaire de la zone d’étude a été abordée selon trois
formules empiriques. La première formule est celle du C.E.R.C. (1973), elle est basée
essentiellement sur les conditions énergétiques de la houle pour une côte rectiligne avec des
pentes régulières. La deuxième formule de BIJKER (1971) qui permet, en tenant compte d’un
certain nombre de conditions aux limites, de donner le débit solide charrié à l’action combinée
de la houle et du courant.la troisième formule est celle de
KAMPHUIS (1986) basée sur
des données du laboratoire et du terrain.
A travers l’analyse des résultats obtenus par les trois formules, les constatations sont les
suivantes :
 Selon la formule C.E.R.C. (1973), on obtient transport sédimentaire totale vers le
Ouest de l’ordre de 29131 m3/an, un transport brut vers le Nord-Est de l’ordre de
160045 m3/an et un transport résultant total vers l’Ouest d’ordre 189176 m3/an. Nous
remarquons que le transit sédimentaire prédominant est provoqué par la houle du
secteur Ouest, Nord-Est avec des volume respectifs de l’ordre 153412 m3/an, 90955
m3/an .
 Selon la formule de BIJKER (1971), un transit littoral total vers le Nord-Est de
+330.10-6 m3/s et un transit total vers l’Ouest de l’ordre de -273 m3/s avec un transit
résultant vers le Nord-Est de +47.10-6 m3/s. il est apparait de ces résultats que les
valeurs obtenues restent un peu trop élevées. La raison en est que, lors du calcul on a
supposé que le fond est complétement couvert par du sable, ce qui n’est pas le cas
dans la baie d’El Djemila où d’importantes étendues de platiers rocheux affleurent tout
le long de la plage sous-marine, ce qui réduit considérablement la capacité du
transport.
 Selon la formule de KAMPHUIS (1986), le transit sédimentaire prédominant est
celui provoqué par la houle du secteur Ouest qui est de l’ordre de 2831049 m3/an. Le
transit sédimentaire total est de l’ordre de 228 000 m3/an.
Comparaison des résultats obtenus selon les trois formules.
L’étude comparative des résultats obtenus par les trois formules fait ressortir les
constatations suivantes :
 Le transit net calculé par la formule de KAMPHUIS montre une valeur très élevée
par rapport à celle de C.E.R.C.
 Le transit net calculé par la formule du C.E.R.C (1973) demeure trop élevé par rapport
à ceux obtenus par la formule de BIJKER(1971). Cette importante différence trouve
une explication, dans la valeur de la constante « K » prise pour le calcul qui reste trop
élevée et qui ne peut être déterminé avec exactitude à cause de caractère
empirique de l’équation.
Modélisation du transport sédimentaire résiduel dans la plage sous-marine de SidiFredj
Dans cette partie de l’étude, nous avons tenté de déterminer les trajectoires principales du
transport sédimentaire par une approche semi-quantitative, basée sur la distribution spatiale et
la comparaison des paramètres granulométriques usuels, la taille moyenne, le tri et l’asymétrie
de la distribution sédimentaire. Le transport sédimentaire dans la partie plus profonde sous
l’effet des processus physiques apparaît alors limité essentiellement aux régimes plus agités,
avec une circulation forcée par les vents et dans des conditions de marée particulière ainsi
qu’aux épisodes exceptionnels de fortes houles et de tempêtes. Par contre la dynamique
sédimentaire de la zone de déferlement jusqu'à la zone de swash est influencée directement aux
Page 9
effets des agents hydrodynamiques (vague à différentes amplitudes, courant de dérive et
courant de retour).
Champs de vecteurs sur la plage Est de Sidi-Fredj (cas FB-)
L’analyse des 35 échantillons prélevés au niveau de la plage de Sidi-Fredj présentent une
faible gamme de variation des valeurs des paramètres granulométriques. La majorité des
sédiments ont une granulométrie moyenne avec une tendance vers les sédiments fins (plus
de 85% des observations). Les sédiments sont également caractérisés par des sédiments
moyennement classés. Les échantillons présentent une symétrie granulométrique prononcée
vers les particules fines. Les paramètres sédimentologiques des prélèvements effectués ont
permis de dresser une carte des directions de transport sédimentaire par l’application du
modèle McLaren/Gao et Collins (ZEMENZER.S.2004). Dans la zone la plus côtière (haut
estran), le transit sédimentaire ne montre pas de tendance vers une direction particulière. Les
sédiments suivent plusieurs sens de transport vers le large, parallèle au rivage. Plus au large, à
partir du mi estran, le sens de transit s’organise de mieux en mieux. Nous remarquons que les
sédiments s’orientent vers le large avec une légère tendance à être parallèle au trait de côte.
Cette direction de transport qui représente 58 % de vecteurs montre un caractère érosif de la
plage. Les sédiments transportés dans cette direction sont constitués de sables fins,
moyennement classés à très bien classés avec une asymétrie vers les grandes tailles.
Figure 6 : Vecteurs de direction calculée par le modèle de McLaren/Gao et Collins sur la plage
de Sidi-Fredj (cas FB-)
Champs de vecteurs sur la plage Est de Sidi-Fredj (cas FB+)
La moitié de la zone côtière s’individualise nettement avec des vecteurs bien organisés. Elle
représente un transit sédimentaire clairement orienté vers l’Est. L’interaction entre l’énergie de
déferlement des houles Nord Nord-Ouest et la pente conduit à la manifestation d’un transport
des sédiments remaniés par le jet de rive. L’autre moitié montre globalement elle aussi une
dynamique des courants de retours. Dans le bas estran, des vecteurs de direction dans le sens
opposé (vers la côte) marquent le centre de cette zone.
Page 10
Figure 7 : Vecteurs de directions calculés par le modèle de McLaren/Gao et Collins sur la plage
de Sidi-Fredj (cas FB+).
Synthèse
Le traitement avec les deux cas (FB- et FB+) ne montre pas beaucoup de changements entre
les vecteurs de direction. Les résultats obtenus sur le site montrent aussi la cohérence entre le
modèle de McLaren/Gao et Collins avec les caractéristiques sédimentaires de l’estran.
L’application du modèle de McLaren/Gao et Collins nous a montré que le transport
sédimentaire au cours de succession et de l’étalement des vagues sur l’estran s’effectue
essentiellement vers le large. Les sédiments sont d’abord mis en suspension par les houles au
moment de leur déferlement et sont entraînés ensuite vers le large par les courants de retour
(jusant). La circulation sédimentaire est donc très liée aux houles déferlantes et aux courants
littoraux.
Impact de la construction du port de sidi Fredj et facteurs d’évolution
Quatre facteurs contribuant à l’érosion massive de la plage Est de Sidi-Fredj ont été mis en
évidence .Certains de ces facteurs sont naturels, les autres, sont dus aux différentes
activités humaines sur le littoral.
 L’action des houles, non seulement provoque un mouvement dans le profil, mais aussi
un transit littoral d’Est vers l’Ouest, créant ainsi une zone d’engraissement à l’abri de la
jetée Est du port de Sidi-Fredj. En effet les houles d’été qui proviennent de Nord-est
engendre un courant de dérive Est-Ouest c'est-à-dire vers le port provoquant ainsi
l’engraissement de cette zone. En saison hivernale, la prédominance des houles du
secteur Nord-Ouest engendre une dérive littorale Ouest-est. Ce courant de dérive touche
beaucoup plus la zone de Moretti que la zone située entre l’hôtel Eriad et la jetée sud du
port de Sidi-Fredj.
 La construction du port de Sidi-Fredj a entrainé un changement de l’angle d’approche
de la houle dominante N, ce qui accélère la dérive littorale devant El-Minzah, Eriad et
Moretti, provoquant ainsi une zone d’érosion irréversible. Le sable arraché est charrié
vers l’Est avant qu’il ne soit sédimenté sur la plage sous marine.
 L’édification du village de Moretti sur la haute plage, a entrainé la réduction de la plage,
de plus la construction d’un chemin de promenade soutenu par un muret vertical a
provoqué l’intensification de l’attaque de la houle.
 Les extractions massives et importantes des sables à l’embouchure de l’Oued Beni
Messous et au niveau de l’hôtel Eriad ont contribué au déficit sédimentaire du littoral.
Page 11
CONCLUSION
Aujourd’hui des méthodes combinées sont de plus en plus fréquemment utilisées. Elles
combinent méthodes souples et méthodes rigides. De manière générale, l’élément le plus
attractif dans l’aménagement et la réhabilitation des zones littorales est souvent une plage
artificielle. Afin de minimiser les coûts d’entretien des plages artificielles, il est souvent
nécessaire de réaligner l’orientation de ces plages par rapport à l’orientation naturelle du site
d’intérêt. Ceci nécessite typiquement la réalisation d’une structure côtière afin de stabiliser la
plage. Ainsi, dans le contexte de projet d’aménagement du littoral, l’objectif principal s’est
déplacé de la simple protection côtière vers une action plus intégrée à l’environnent naturel
avec la prise en compte de valeurs esthétiques et récréatives. Pour la réussite d’un projet
d’aménagement de plage artificielle, il est impératif d’inclure les aspects hydrauliques, côtiers
et environnementaux dès le début du planning du projet. Le design de ces éléments doit suivre
des "lois d’équilibre sédimentaire" qui imposent certaines restrictions sur le design. Les
éléments les plus importants à observer sont les suivants : la plage rechargée devrait être
exposée à la houle, orientée vers la direction prédominante de la houle pour être stable et
soutenue par des ouvrages latéraux afin d’éviter des fuites de sédiments. Le sable devrait être
moyen et bien trié avec un minimum de contenu de matériaux fins, grossiers et organiques.
Les ouvrages côtiers adjacents aux plages devraient être aménagés de façon à ne pas générer
des courants dangereux.
REFERENCES
Boutiba M., 1996.Etude vraie grandeur du mode de fonctionnement des ouvrages de protection de la plage
EST de SIDI FREDJ (OUEST- algérois). Mémoire de magister en aménagement du littoral, option :
Géomorphologie et aménagement des côtes (ISMAL).
Idir N., et AINI Aissa, 2006. Impacts des équipements côtiers sur l’évolution du littoral de Sidi-Fredj
(Évolution du trait de côte, bilan sédimentaire et fonctionnement en grandeur nature des ouvrages de
protection.) - Mémoire d’ingéniorat en Géographie et aménagement du térritoire (USTHB).
Courtaud, J., (2000).Dynamiques géomorphologiques et risques littoraux. Cas du tombolo de Giens (Var,
France méridionale). Thèse, Université de Provence Aix-Marseille.
Dehouck A., 2006. Morphodynamique des plages sableuses de la mer d’Iroise (Finistère) Ecole
Doctorale Des Sciences De La Mer-l’Universite de Bretagne Occidentale.
Durand P., 1999. L'évolution des plages de 1'ouest du Golfe du Lion au XXème siècle. Cinématique du trait de
côte, dynamique sédimentaire, analyse prévisionnelle. Université Lumière Lyon II, Lyon, 460 p.
Morellato D., 2009. Dynamique des plages sableuses soumises à l'action des vagues, de la marée et des
rechargements artificiels.
Paskoff R., 1993. Côtes en danger, pratiques de la géographie, p45.
Sabatier F., 2001. Fonctionnement et dynamiques morpho-sédimentaires du littoral du delta du Rhône. Thèse
de doctorat en géosciences de l’environnement, option géographie physique. Université d’AixMarseille III, 272 p.
Sabatier F., 2004.Transport sédimentaire de la dune à la zone du déferlement sur une plage sableuse soumise à
des vents de terre- VIII èmes Journées Nationales Génie Civil – Génie Côtier, Compiègne.
Suanez S., 1997. Dynamiques sédimentaires actuelles et récentes de la frange littorale orientale du delta du
Rhône, Université de Provence, Aix-en-Provence, 282 p.
Villaret C., 2003. Modélisation du transport sédimentaire en granulométrie étendue: étude bibliographique
Programme Biparti 2001.
Wright L.D., SHORT A.D., 1984. Morphodynamic variability of surf zones and beaches: a synthesis. Marine
Geology, 56, pp 93-118.
Zemenzer S., 2004. Ensablement du port par transport sédimentaire, simulation et application du modèle de
GAO et COLLINS (1994) au port de SIDI-FREDJ. Mémoire d’ingéniorat en aménagement du littoral
et protection de l’environnement (ISMAL).
Page 12
Population Genetic Structure of the Black- Lipped Oyster (Pinctada margaritifera) using
PCR-RFLP Method in the Persian Gulf
Population genetic structure of the Black- lipped Oyster (Pinctada
margaritifera) using PCR-RFLP method in the Persian Gulf
Maryam Moazami1, Mohammad Ali Salari-Aliabadi1*, Bita Archangi1, Hosein Zolgharnein1, Ahmad
Ghasemi2
1
Department of Marine Biology, Faculty of Marine Science, Khorramshahr University of Marine Science and
Technology, Khorramshahr, Iran.
2
Department of Marine Biology, Persian Gulf Research and Studies Center (PGRSC), Boushehr, Iran.
*
Corresponding author: E-mail: [email protected]
SUMMARY
In this study, population genetic diversity of Pinctada margaritifera was evaluated by using of PCR-RFLP
method. To determine and compare genetic diversity between their populations on northern margin of the
Persian Gulf, 47 samples were collected of depth 1-6 m from Khark, Hendorabi, lark and Shidor Islands.
DNA of samples were extracted by CTAB method. A pair of primers of Pinctada margaritifera used for
polymerase chain reaction in D-LOOP locus. Enzymatic digestion of PCR yield with 710 bp length were
performed by, AvaΙΙ, DdeΙ, HindIII, SfaNΙ and TaqΙ restriction enzymes. DNA were collected and described
after 30% poly acril amide gel electrophoresis with silver staining method. The results showed that
Electrophoresis, enzymatic digestion fragment Each of the 47 samples collected from four stations in the
northern coasta of Persian Gulf with each of the five enzymes used are the same. The results confirms that
population of pinctada margaritifera in this study, Perfectly homogeneous and have without genetic diversity.
As regards Pinctada margaritifera is the IUCN list and The situation is very vulnerable (Critically
endangered), this result such a result is expected.
Keywords: Population diversity, Pinctada margaritifera, PCR-RFLP, Persian Gulf.
INTRODUCTION
The Persian Gulf is a half-closed sea which is connected to the Gulf of Oman and the Indian
Ocean through the Strait of Hormoz. The geographical characteristics of the Gulf are
between about 48 degrees and 56 degrees to the east and between 23 degrees and 45
minutes and 30 degrees and 30 minutes to the north (Reynolds, 1993). The Persian Gulf is a
rather shallow sea, half-closed with a low water entrance index and high vaporization rate
(Sheppard, 1993). Its depth was reported to be 25 meters in the delta of the river Arvand
and 91 meters in the Strait of Hormoz (Coad, 1998). The Persian Gulf is considered one of
the richest seas in the world due to abundance in having various species of fish and wildlife.
Pearl oysters are of two types: Pinctada Roding, 1798, and Pteria Scopoli, 1777 from the
Pteriidae family. The members of this family have oval diagonal pearls pressed from the
side with a straight sole line and a deep crack in the silk area. Huge individual differences in
shape and color among them, which is mostly due to the environmental conditions, along
with some other limitations make it hard for a clear classification (Wada and Temkin,
2008). The black-lip pearl oyster Pinctada margaritifera is tropical species of the Indian
Ocean- Pacific east (Rodgers et al, 2000). The Persian Gulf is an important home to pearl
oysters especially black-lip oysters. Before the discovery of oil in the region, pearl and
shells had been important export items. The P. margaritifera has several sub-species;
zanzibarensi has been reported in the eastern coasts of Africa, persica in the Persian Gulf,
and cumingi in the eastern French Polynesia (Rao and Rao, 1974).
Usually, in Nucleotide frequency related to a gene or part o a gene in different species or
even individuals within a species, differences can be observed; these difference, no matter
how small, can be used as factors for measuring the genetic distance and the times of
splitting of two species on one hand, and remaking and remodeling the evolution history
International Congress on "Estuaries and Coastal Marine Protected Areas" ECPA 2014 (İzmir - Turkey) Page 13
and the ancestor- successor relationship on the other hand and finally drawing phylogyny
tree (Hey, 2001; Griffiths et al., 2008). Examining the mtDNA provides us with an accurate
and sensitive method for revealing the genetic differences. These differences may exist
among the populations of one species and can be used in phylogynic classification and also
in working out the affinity and genetic similarities among the creatures (Avise, 2004;
Mortiz et al, 1987). Cultivating pearls, especially black pearls, has developed significantly
in the last two decades (Anon, 2006; Tisdell and Poirine, 2008). The basis of pearl
cultivation industry in Japan, Australia, and French Polynesia is traditionally dependent on
gathering pearl oyster from nature. This gathering can be in the form of mature oysters or
young oysters, which will be kept until they get to the right size for pearl cultivation
(Southgate, 2008). Therefore, accurate knowledge of distribution, amount of stock, and
populations of this species can be a first and important step to cultivating them in the
Persian Gulf. Also, differences among genus, species, and even sub-species can make huge
differences in the quality of the final pearls. Identifying many of pearl oyster species
through their shells characteristics, especially in the first stages of growth, is a difficult task
(Wada and Temkin, 2008).
MATERIALS AND METHODOLOGY
After collecting the primary data from the coral reefs around the Persian islands located in
the northern part of the Persian Gulf and the habitats of these oysters (Tajallipour, 1985;
Ranjbar, 1999) and places where the oysters were collected from in the past, there stations
were designated including the Larak Island station in the north east of the Persian Gulf (24
samples), the Shidvar-Hendoorabi Islands in the north (22 samples) and khark Island in the
north west (5 samples) (illustration No. 1). After designation of the stations, samples were
collected from the habitats of oysters through scuba diving. A piece of each species’ mantle
was cut with scissors, placed in 96% ethanol and moved to the laboratory of Persian Gulf
Studies and Research Center in Bushehr.
Figure1: map of Persian Gulf and stations location
Illustration No. 1- the location of sampling stations of black-lip pearl oyster in the Persian
Gulf (station No.1 Larak Island in the north east of the Persian Gulf, station No. 2 the
Hendoorabi–Shidvar Islands in the north, and station No.3 Khark Island in the north west).
DNA extraction was done through the CTAP method from the oysters’ muscular tissue
(Porebski, 1997; Lind et al, 2009). In order to measure the quantity and quality of the
extracted DNA, Spectrophotometry and Electrophoresis on 1% agarose gel were used
respectively.
In order to Gene amplification of the CO1 using primers HCO2198:
TAAACTTCAGGGTGACCAAAAAATCA,LCO1490:
GGTCAACAAATCATAAAGATATTGG introduced by Folmer and colleagues, 1994 was
used. In order to do PCR and amplification the target gene, 100 nano-grams of the extracted
DNA, 1 micro-liter of the starters(10 pM) plus 0/5 micro-liter of dNTP (10 mM), 0/2 microliter of Taq (5u/μ), 2.5 micro-liter of buffer PCR (10x), 1 micro-liter of MgC12(50 Mm)
were used, and at the end the final volume including distilled water was 25 micro-liters
(Arnaud, 2001., 2008; Lind, 2009). The thermo-cycler program consisted of the primary
Denaturation in 94 degrees Centigrade for 4 minutes, followed by 30 cycles of Denaturation
in 94 degrees Centigrade for 45 seconds, connecting the primers to the target (Annealing) in
45 degrees Centigrade for 40 seconds, and extension of the primers in 72 degrees
Centigrade for 1 minute, and finally the final extension in 72 degrees centigrade for 5
minutes, respectively. After reproducing the COI gene, in total 28 samples from the three
stations were sequenced through the sanger sequencing method by Takapouzist company.
In order to examine and compare the sequences, the software BioEdit, MEGA Ver. 5, and
DNAsp Ver. 5 were used. Also, in order to compare the sequence of the Persian Gulf blacklip oyster with other parts of the world in the gene bank, similar sequences were identified
using NCBI website, and then, in order to work out the genetic distance, they were
compared in MEGA Ver. 5 software, and the phylogenetic tree was drawn.
RESULTS AND DISCUSSION
Haplotypes number (2, 3, and 4) in Larak station, Haplotype number (5) in Shidvar station,
and haplotype number (1) in all stations were observed. Also, the highest haplotype
variance in the examined gene was in Larak (0/371) and the lowest in Khark (zero). The
highest and lowest Nucleotide variance were in Shidvar (0/00193) and Khark (zero)
respectively. Genetic distinction among areas, according to AMOVA exam, was zero (Fst=
0). The sequence of the Persian Gulf’s black-lip oyster’s COI gene was compared with the
sequence of the African sub-species, the Pacific Ocean sub-species, and 6 other species
from the Pinctada type. Three species from the Pteria type were also used as out-groups.
The Phylogenetic dendrogram was drawn using MEGA5 software and is shown in
Illustration No. 2. Also, the species Nucleotide proportion in Table 3 shows that the GC
proportion of all Nucleotide in the Persian Gulf’s black-lip oyster Pinctada sp persica was
(44.2 %), in the African sub-species P. maragaritifera zanzibarensi (44.7 %), and in the
French Polynesia sub-species P. maragaritifera cumingii (42.1 %). According to the results
from the genetic distance, the Persian Gulf black-lip oyster Pinctada sp persica’s distance
from the French Polynesia sub-species P. margaritifera cumingii is 0.136, which is 0.027
more than the distance between Pinctada mazatlanica and P. margaritifera cumingii. And
the distance between the Persian Gulf black-lip Oyster with the African sub-species was
exactly 0.027.
However, the challenging findings of this study result from the comparison of the Persian
Gulf haplotype with other areas and close species. As it is shown in Table 4, the distance
between the Persian Gulf sub-species and the East African species is 0.027, and 0.136
between the Persian Gulf sub-species and cumingii sub-species is 0.136, while the distance
between cumingii sub-species and P. mazatlanica species is 0.027 which is exactly the same
as the distance between the Persian Gulf sub-species and the East African one. Phylogenetic
dendrograms (Figure 2) also show that the Persian Gulf and the East African sub-species
are of two different branches, but go in one independent clade from P. margaritifera and P.
mazatlanica. This fortifies the probability that the Persian Gulf sub-species is not from P.
maragaritifera but an independent species from it. Cunha and colleagues (2001) also
reported that P. margaritifera samples are from different races and samples from Mauritius
Island go under a different category from the samples from Japan and French Polynesia
Therefore, they might be a set of species and the Mauritius sample can be an independent
species(Cunha et.al., 2011).
Herbert and colleagues (2003) suggested that COI be used as the barcode to recognize the
species, also ITS be used to examine the bivalve phylogeny relationship (Kenchington et al,
2002; Yu et al, 2000; Lopez-Pinon et al, 2002). In recent studies on the Pinctada type it has
been suggested that COI be replaced by ITS (Yu and Chu, 2006; He et al, 2005). Therefore,
in this matter, it is suggested that ITS markers be used to confirm the results of this study.
REFERENCES
Arnaud-Haond , S., Monteforte, M., Galtier, N., Blanc, F. , Bonhomme, F., 2001. Population structure and
genetic variablity of pearl oyster Pinctada mazatlanica along Pacific coasts from Mexico to Panama.
Conserv. Genet., l: 299–307.
Arnaud-Haond S., Vonau, V., Rouxel, C., Bonhomme, F., Prou, J., Goyard, E., Boudry, P., 2008. Genetic
structure at different spatial scales in the pearl oyster (Pinctada margaritifera cumingii) in French
Polynesian lagoons: beware of sampling strategy and genetic patchiness. Mar. Biol., 155 (2): 147157.
Avise, J. C., 2004. Molecular markers, natural history and evolution. Sinauer Associates Inc Publishers.
Sunderland, Massachusetts. 541p.
Cunha, L. R., Blanc F., Bonhomme, F., Arnaud-Haond, S., 2011. Evolutionary Patterns in Pearl Oysters of the
Genus Pinctada (Bivalvia: Pteriidae). Mar. Biotechnol., 13 (2): 181-192.
Coad, B. W., (1998). Systematic biodiversity in the freshwater fishes of Iran. Ital. J. Zool., 65: 101–108.
Folmer O., Black M., Lutz R., Vrijenhoek R., (1994) DNA primers for amplification of mitochondrial
cytochrome c oxydase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol.,
3(5): 294–299.
Griffiths AJ, Wesseler S, Lewontin RC, Carroll SB (2008) Introduction to Genetic Analysis, 9th edn. W.H.
Freeman, CA
He, M., Huang, L., Shi, J., Jiang, Y., 2005. Variability of ribosomal DNA ITS-2 and its utility in detecting
genetic relatedness of pearl oyster. Mar. Biotechnol., 7: 40-45.
Hey, J., 2001. Genes, categories and species: The Evolutionary and Cognitive Causes of the Species Problem.
Oxford University Press, Oxford. 217 pp.
Kenchington, E., Bird, C.J., Osborne, J., Reith, M., 2002. Novel repeat elements in the nuclear ribosomal
RNA operon of the flat oysters Ostrea edulis C. Linnaeus,1785 and O. angasi Sowerby, 1871. J
Shellfish Res, 212: 697–705
Lind, C. E., Evans, B. S., Knauer, J., Taylor, J. J. U., Jerry D. R., 2009. Decreased genetic diversity and a
reduced effective population size in cultured silver-lipped pearl oysters (Pinctada maxima).
Aquaculture., 286: 12–19.
Liu, Z.J., Cordes, J.F., 2004. DNA marker technologies and their applications in aquaculture genetics.
Aquaculture., 238: 1–37.
Lopez-Pinon, M.J., Insua, A., Mendez, J., (2002) Identification of four scallop species using PCR and
restriction analysis of the ribosomal DNA internal transcribed spacer region. Mar. Biotechnol., 4:
495–502.
Moritz, C., Dowling, T. E., Brown, W. M., 1987. Evolution of Animal Mitochondrial DNA: Relevance for
Population Biology and Systematics. Annu. Rev. Ecol. Syst., 18: 269-292.
Nahavandi, R., Rezvani, S., Vosoughi, G., Kazemi, B., 2005. Gene 18s rRNA Variation of Cuttlefish
Population (Sepia pharaonis) InN The Persian Gulf And The Oman Sea Using PCR-RFLP Method.
IRAN J FISH SCI.; 14(2);157-168.
Porebski, S., Bailey, L. G., Baum, R. B., 1997. Modification of a CTAB DNA Extraction Protocol for Plants
Containing High Polysaccharide and Polyphenol Components. Plant. Mol. Biol. Rep., 15 (1): 8-15.
Rao, K.V., Rao, S.K., 1974. Pearl oysters. In: Nair, R.V., Rao , S.K. (Eds.),The Commercial Molluscs of
India. ICAR Bulletin of the Central Marine Fisheries Research Institute., 25: 84–105.
Reynolds, R. M., 1993. Physical oceanography of the Gulf, Strait of Hormuz, and the Gulf of Oman: results
from the Mitchell Expedition. Mar. Pollut. Bull., 27: 35-60.
Rodgers, S. K., Sims, N. A., Sarver, D. J., Cox, E. F., 2000. Distribution, Recruitment, and Growth of the
Black-Lip Pearl Oyster, Pinctada margaritifera, in Kane'ohe Bay, O'ahu, Hawaii Pacific Science.,
54(1): 31-38.
Rodriguez-Trelles, F., Tarrio, R., Ayala, F.J., 2000. Evidence for a high ancestral GC content in Drosophila.
Mol. Biol. Evol. 17: 1710-1717.
Sheppard, C.R.C., 1993. Physical environment of the Gulf relevant to marine pollution: an overview. Mar.
Pollut. Bull., 27: 3–8.
Southgate, P. C., 2008. Pearl Oyster Culture. In: Southgate, P., Lucas, J., (Ed.), The Pearl Oyster. Elsevier,
Amsterdam, The Netherlands, pp. 231-272.
Tisdell, C., Poirine, B., 2008. Economics of Pearl Farming. In: Southgate, P., Lucas, J., (Ed.), The Pearl
Oyster. Elsevier, Amsterdam, The Netherlands, pp. 473-495.
Wada T. K., I. Tëmkin., 2008. Taxonomy and Phylogeny. In: Southgate, P., Lucas, J., (Ed.), The Pearl Oyster.
Elsevier, Amsterdam, The Netherlands, pp. 37-75.
1
Tarek M. El-Geziry1, Abdel-Aziz M. Radwan2, Mohamed A. Said1 and Fathy T. Tayel2
Laboratory of Physical Oceanography, Division of Marine Environment, National Institute of Oceanography
& Fisheries (NIOF), Alexandria, Egypt, [email protected] - [email protected]
2
Laboratory of Marine Pollution, Division of Marine Environment, National Institute of Oceanography &
Fisheries (NIOF), Alexandria, Egypt, [email protected] - [email protected]
SUMMARY
Lake Burullus is the second largest lake in the northern Egyptian Delta Lakes system. Water and nutrient
budgets of Lake Burullus have been estimated by examining the different factors affecting it. The water balance
in the Lake is estimated using the water inputs (drains and precipitation), water outputs (evaporation) and
finally by the exchange process between the lake and the Mediterranean Sea through Boughaz El- Burullus.
The results indicated that, the main positive contributor in the water budget of Lake Burullus is the drainage
water being 2944.57x106 m3/y. The rainfall is a very weak positive component of 72.57x106 m3/y compared to
the drainage water. The net annual amount of outflowing water from Lake Burullus to the Mediterranean Sea
was 2555.51x106 m3/y exceeding the net amount of seawater invading the Lake estimated by 203.34x10 6 m3/y.
Accordingly, the net water exchange between Lake Burullus and the Mediterranean Sea was 2352.16x10 6 m3/y
seaward negatively affects the water budget of the lake more than the evaporation process of 664.98x106 m3/y.
For the nutrient budget of Lake Burullus, the nitrogen load from the drainage water was estimated to be 2147
tons/year and that from the rain 33.20 tons/year. The amount of nitrogen load transported to the
Mediterranean Sea through Boughaz El-Burullus was 1236 tons/year, while the inflowing nitrogen load was
estimated to be 99.39 tons/year.
Keywords: Lake Burullus, Egyptian Delta Lakes, Water budget, Nutrient Budget
INTRODUCTION
Lake Burullus (Fig. 1) is the second largest lake in the northern Egyptian Delta Lakes
system. The Lake is situated at the northern part of the Nile Delta, between the two main
Nile branches. It is roughly rectangular in shape, extending between latitudes 31 o 22’ and
31o 35’N, and longitudes 30o 30’ and 31o 10’ E, 60 km east of Rosetta branch and 70 km
west of Damietta branch, with a surface area of about 420 km 2. The depth of the Lake varies
from 0.42 to 2.07 m with an average depth of one metre. [1] The present surface area of Lake
Burullus is about 420 km2. Former estimates of this surface area were 588 km 2 in 1913, 574
km2 in 1956 and 462 km2 in 1974.[2] This decrease is due to the rapid and intensive human
activities within and along the southern part of the lake coupled with the large-scale land
reclamation for agriculture and aquaculture. Lake Burullus is connected to the
Mediterranean Sea through an opening outlet in its north-eastern corner known as Boughaz
El-Burullus. This outlet is about 200 m in width whereas its maximum depth is only 2.8
m.[3] Lake Burullus is considered to be one of the best places for wintering birds, and it
greatly contributes in the field of fish aquaculture and fishing farms. Moreover, Lake
Burullus presents a unique habitat for many different breeding birds and many other
animals; that is why the scattered small islands spreading within the lake have been
declared as protected areas since 1991.[4] Finally, the possibility of using Lake Burullus as a
reservoir for the River Nile water is highly considered. The capture of superfluous Nile
water flow and its storage in a portion of the Burullus and Manzalah lagoons would permit
the saving of at least 2-3 km3 of freshwater to irrigate 200000-300000 feddans in the
vicinity of the two reservoirs.[5]
The present study throws light on the calculated water budget of Lake Burullus, compared
to those previously calculated for the Lake in 2004 and 2005. Moreover, the nutrients
budget of the Lake were estimated and compared to the results previously recorded in 2005.
This helps to know to which extent the status of the Lake has been changed.
DATA AND METHODS OF ANALYSIS
Eight hydrographic stations were sampled in Lake Burullus during 2010. The study area
and sampling stations are shown in Fig. (1). Water temperature and salinity were measured
at each station and the total nitrogen and total phosphorus were determined according to [6].
Figure 1. Sampling stations in Lake Burullus during 2010
RESULTS
Water Budget
On the basis of the water budget in Lake Burullus, under conditions that there are not any
eustatic changes of bottom configuration, it is possible to write the equation of conservation
of volume as follows [7][8]: D + R + Vi = Vo + E ;
Vi ρi Si = Vo ρo So
(1)
(2)
Where, D denotes drainage water, R rainfall and E evaporation. Si and So are the salinities
respectively of the inflowing volume transport (Vi) and the out-flowing (Vo) seawater, and
ρi and ρo are the respective densities. The same equations have been used for phosphorus
budget. The value of Si is 38.5, which represents the inner boundary of coastal water off the
Egyptian coast.[7][8][9][10][11]
Drains
The Lake receives brackish water from six main drains, one of which lies on its eastern
side: Baltim drain. The other five drains open at the southern margin of the lake. These are
Terra drain, drain 7, drain 8, drain 9 and drain 11 from east to west respectively (Fig. 1).
The western extremity of Lake Burullus is connected with Rosetta estuary through Brenbal
Canal, which represents the only source of fresh water to the lake. Lake-sea interaction
takes place via Boughaz El-Burullus (El-Burullus outlet). Figure 2 illustrates the monthly
drainage water to Lake Burullus. In one-year period, the Lake received an amount of
2944.57x106 m3. The minimum amount of drainage water to Lake Burullus was 163.85x10 6
m3 in February, and the maximum was 342.55x106 m3 in August.
350
300
Drainage Volume (x106 m3)
250
200
150
100
50
0
January
February
March
April
May
June
July
August
September
October
November December
Months
Figure 2: Total monthly amount of drainage water to Lake Burullus in 2010
Rainfall
Meteorological data reveal that during 2010, the total amount of precipitation over the Lake
surface area was 172.8 mm. This means that the total volume of water gained by rainfall
during the study period is 72.576x106 m3. No rain was observed during the summer months:
June, July and August. The maximum rain amount (44.5 mm) was recorded in December;
results in a maximum gained volume of 18.69x106 m3 (Fig. 3).
20
18
16
Rainfall Volume (x106 m3)
14
12
10
8
6
4
2
0
January
February
March
April
May
June
July
August
September
October
November
December
Months
Figure 3. The monthly rainfall volume gained by Lake Burullus during 2010.
Evaporation
During the study period, the evaporation rate was 1583.29 mm causing a volume loss from
the Lake’s surface water of 664.98x106 m3. While the minimum water volume loss by
evaporation was 45.74x106 m3 in February, the maximum was 63.79x106 m3 in May (Fig. 4)
70
60
Evaporation volume (x10 6 m3)
50
40
30
20
10
0
January
February
March
April
May
June
July
August
September
October
November
December
Months
Figure 4 : The monthly water volume loss due to evaporation process at Lake Burullus during 2010
Water exchange
The monthly amounts of water volumes exchanged between Lake Burullus and the
Mediterranean Sea are driven using equations (1 and 2). The monthly water volumes
entering Lake Burullus through Boughaz El-Burullus and that outflowing seaward during
the study period are shown in Fig. (5). From the figure, it is clear that the water tends to
outflow from the lake seaward all over the period of investigation. The lowest amount of
outflowing water from Lake Burullus seaward was 134.37x10 6 m3 in April, and the highest
was 305.53x106 m3 in August. On the other hand, the lowest amount of seawater invading
Lake Burullus through Boughaz El-Burullus was 11.07x106 m3 in February, and the highest
was 23.65x106 m3 in August. The lowest net water exchange seaward was 120.72x10 6 m3 in
April, while the highest net amount was 281.88x106 m3 in August.
Vi
Vo
350
Volume of water exchange (x106 m3)
300
250
200
150
100
50
0
January
February
March
April
May
June
July
August
September
October
November
December
Months
Figure 5: The monthly water volume exchanged between Lake Burullus and the Mediterranean Sea
during the study period.
Diagram (1) represents the annual values of water budget components of Lake Burullus
during 2010. The main positive contributor in the water budget of Lake Burullus is the
drainage water being 2944.57x106 m3/y. The annual rainfall is 72.57x106 m3/y and the
evaporation is 664.98x106 m3/y. The net annual amount of outflowing water from Lake
Burullus to the Mediterranean Sea is 2555.51x106 m3/y exceeding the net amount of
seawater invading the Lake estimated by 203.34x10 6 m3/y. Accordingly, the net water
exchange between Lake Burullus and the Mediterranean Sea was 2352.16x10 6 m3/y
seaward negatively affects the water budget of the lake.
Nutrient Budget
The nutrient salt budget in Lake Burullus is written as follows:
NDD+NPP+NiVi+NoVo+NE = 0
(3)
Where, ND denotes the concentration of nutrients in the drainage water, N P that of rain, Ni
that of the inflowing seawater and No that of the outflowing Lake water. NE is the amount of
nutrient load/loss due to the biological processes at the Lake
Lake Burullus received an annual amount of 2990 tons of total nutrients, of which total
nitrogen is 2150 tons/yr and phosphorus is 845 tons/yr. The maximum load of nitrogen
from the drainage system into Lake Burullus was 245.58 tons in August and the minimum
was 120.904 tons in February. The phosphorus load into Lake Burullus was maximum in
August (96.24 tons) and minimum in February (47.757 tons), as shown in Figure (6).
Total Nitrogen
Phosphorus
250
Drainage Nutrients Load (ton/yr)
200
150
100
50
0
January
February
March
April
May
June
July
August
September
October
November
December
Months
Figure 6: Annual loads of total nitrogen and phosphorus into Lake Burullus from different drains
Due to precipitation, Lake Burullus gained 51.5 tons of nutrients, of which nitrogen is 33.2
tons and phosphorus is 18.3 tons. The maximum load of nitrogen from precipitation into
Lake Burullus was 8.14 tons in December and the minimum 0 tons during the summer
season, of no precipitation. The maximum phosphorus load, on the other hand, was 8.08
tons in March and minimum during the summer season (0 tons), as shown in Figure (7).
Nitrogen
Phosphorus
June
July
9
8
7
Nutrient loads (tons)
6
5
4
3
2
1
0
January
February
March
April
May
August
September
October
November
December
Months
Figure 7: Annual loads of total nitrogen and phosphorus into Lake Burullus from precipitation process
The nutrients load exchange between Lake Burullus and the Mediterranean Sea through
Boughaz El-Burullus (Fig. 8) indicated that the maximum incoming load from the
Mediterranean was 15.962 tons in August (15.962 tons) and the minimum was 6.510 tons in
February (6.510 tons. The seaward load from the Lake was maximum in August (206.223
tons) and minimum in February (83.552 tons). The total annual loss of nutrients into the Sea
is 1551.224 tons. This loss refers to the absorbed budget of nitrogenous compounds by
aquatic organisms.[8]
In
Out
200
Total Nutrient Exchange (tons)
150
100
50
0
January
February
March
April
May
June
July
August
September
October
November
December
Months
Figure 8: Total nutrient amounts exchanged between Lake Burullus and the Mediterranean Sea
The nutrient salt load of nutrient from the drainage water is estimated to be 2990 tons/yr
and from the rain 51.4 tons/yr. The total annual amount of total nitrogen transported
seaward is 1236.036 tons and that of phosphorus is 450.982 tons. On the other hand, the
total annual amount of total nitrogen transported from the Sea is 99.396 tons and that of
phosphorus is 36.397 tons. The nutrient budget is shown in Figs (6, 7 and 8) and in Diagram
1.
Diagram 1: Water, Nitrogen and Phosphorus budgets of Lake Burullus
CONCLUSION
In the present work, both the water and nutrient budgets of Lake Burullus are calculated
based on data collected during 2010. The research evaluates these budgets by a comparison
with results previously published for the Lake. This helps us to know to which extent the
status of Lake Burullus has been changed. The main positive contributor in the present
water budget of Lake Burullus was the drainage water (2944.57x106 m3/y).
The rainfall was a very weak positive component being 72.57x10 6 m3/y while the amount of
water loss due to the evaporation was 664.98x106 m 3/y. The net annual amount of
outflowing water from Lake Burullus to the Mediterranean Sea was 2555.51x106 m3/y and
the net amount of seawater invading the Lake was 203.34x10 6 m3/y. This is in agreement
with the results [7][8] previously calculated for the Lake.
The components of nitrogen budget given from the present study in Lake Burullus are high
compared to the results [8] previously calculated for the period 2002-2003 (Table 1). This is
may be due to the pronounced increase in the land reclamation processes around the Lake,
which use the nitrogenous fertilizers, which, in turn, are washed with the agriculture
drainage water into the Lake. This is beside the sewage wastes from human activities and
fish farms.
Table 1. Components of nitrogen and phosphorus budgets in Lake Burullus
(tons/year).
Tons/year
ND
PD
NP
PP
Ni
Pi
No
Po
Said et al. (2005) 814.97 1297 10.80 24.82 50.81 40.97 480.26 600.11
Present study
2147 844.53 33.2 18.3 99.39 36.39 1236 450.98
REFERENCES
[1] Maiyza, I.A., Beltagy, A.I. and El-Mamoney, M.H.: “Heat balance of Lake Burullus, Egypt”. Bulletin of
National Institute of Oceanography & Fisheries 17 (1): 45 – 55. (1991)
[2] Meininger, P.L. and Atta, G.A.M.: “Ornithological studies in Egyptian wetlands 1989/90”. FORE Report
Nr. 94-01, WIWO Report Nr.40, Netherlands, 402p. (1994)
[3] Maiyza, I.A.: “Water budget of Lake Burullus, Egypt”. (Unpublished manuscript). (1989)
[4] Ramsar Advisory Missions: Lakes Bardawil and Burullus, Egypt. Report No.26, 4-15 October, 1991, 10p.
(1991)
[5] Ministry of Irrigation: Conservation of Nile outflows to the Mediterranean: A preliminary report. Arab
Republic of Egypt, Ministry of Irrigation, Cairo, 35p. (1985)
[6] Grasshoff, K.: “Methods of seawater analysis”. Verlag Chimie, Weinheim and New York, 317 p. (1976)
[7] El-Geziry, T.M.: “Water and Heat Budgets of Lake Burullus”. M.Sc. Thesis, Faculty of Science,
University of Alexandria, 104p. (2004)
[8] Said, M.A., Shakweer, L.M. and Radwan, A.: “Water and nutrient budgets of Lake Borullus”. Journal of
Egyptian German Society of Zoology 48A: Comparative Physiology, 1-15. (2005)
[9] El-Maghrabi, A. M. and Halim, Y.: “A quantitative study of the plankton of Alexandria water”.
Hydrobiologia, 25: 221 – 238. (1965)
[10] Abdel-Moati, A.R. and Said, M.A.: “Hydrographic structure of the Mediterranean shelf waters off the
Egyptian coast during 1983-1986”. Thalassographica 10(2): 23 – 29. (1987)
[11] Said, M.A. and Moati, M.A.R.: “Water budget study of Lake Manzalah, Egypt”. Mahasagar 28(1-2): 7581. (1995).
L’Anguille (Anguilla anguilla l.) Dans les Estuaires du Sebou et du Loukkos
(Atlantique, Maroc)
L’anguille (Anguilla anguilla l.) dans les estuaires du Sebou et du Loukkos
(Atlantique, Maroc)
1
F. Wariaghli1, R. Hanel 2, M. Fekhaoui3, A. Yahyaoui1
Université Mohammed V, Faculté des Sciences, Rabat - e-mail: [email protected] [email protected]
2
Thunen Institut (FI), Institut für Fischereiökologie, Palmaille 9, 22767 Hamburg-Germany
E-mail: [email protected]
3
Université Mohammed V, Institut Scientifique, B.P. 703 Agdal 10106 Rabat-Maroc
http://www.israbat.ac.ma –Email : [email protected]
SUMMARY
The common eel (Anguilla anguilla) is a fish of high ecological and economic value. However, since the
1980s, eel populations have been suffering from a dramatic decline throughout its range of distribution,
including Morocco. Since 1998, the eel is classified as species beyond their biological limits. The causes are
many: overfishing, migration barriers, parasitism or pollution. This pollution could be caused by organic
contaminants (such as polycyclic aromatic hydrocarbons and PAHs) and metallic (heavy metals). In
Morocco, estuaries of Sebou and Loukkos are the most important fishing area of eels. However, they suffer
from a poly-metallic and organic pollution from different sources (domestic, agricultural and industrial).
This work aimed to determine the growth and age of eels by otolithometry and to identify the degree of
metallic and organic contamination of eels. By the tissular identification of heavy metals (Cu, Cr, Cd, Pb and
Hg) and of PAH metabolites in bile of eels. On the other hand, this study is also monitoring the anguillicolosis
caused by Anguillicoloides crassus in Loukkos and Sebou estuaries. Thus, the ecotoxicological study showed a
contamination of eels in different sites by 1- OH pyrene and 1-OH phenanthrene while the compound of 3 benzo [a] pyrene (PAH) was absent. The hepatosomatic factor (RHS) was sensitive to the contamination by
these pollutants. A significant negative correlation (p<0.05) was recorded between RHS and the rate of PAHs.
The analysis of metallic elements reveals a widespread tissue contamination with higher concentrations of
copper and chromium. The average concentration of mercury in the muscle of eels from the two estuaries is
high: 0.47 µg/g (Loukkos) and 0.46 µg/g (Sebou). Eels of large size (50 to 60 cm) are contaminated with toxic
levels of the order of 0.58 µg/g. Exceeding the standard set by WHO (0.5 µg/g wet weight for human
consumption). The parasitological study reveals that the degeneracy factor of swim bladders (SDI) has a
positive correlation with the variation of the number of parasite (A. crassus) in both estuaries (p <0.05).
While the monitoring of anguillicolosis (2004-2009) showed a prevalence of 54% in Sebou and of 34% in
Loukkos (2008-2009).
Keywords: Anguilla anguilla, heavy metals, PAH, Anguillicoloides crassus, Estuary, Sebou, Loukkos,
Morocco.
RESUME
L’Anguille (Anguilla anguilla) est un poisson de haute valeur écologique et économique. Cependant, depuis
les années 1980, ce poisson a souffert d’une très nette régression sur toute son aire de répartition y compris
au Maroc. Depuis 1998, l’Anguille est classée parmi les espèces hors de leurs limites biologiques. Les causes
de ce déclin dramatique sont multiples : la pêche, le braconnage, les obstacles aux migrations, le parasitisme
ou encore la pollution. Cette dernière est causée par des contaminants organiques (tels que les hydrocarbures
aromatiques et polycycliques HAP) ou métalliques (métaux lourds). Au Maroc, les estuaires du Sebou et du
Loukkos sont les sites les plus importants de pêche des anguilles et des civelles. Or, ils souffrent d’une
pollution poly-métallique et organique de différentes origines (domestiques, agricoles et industrielles).
Les travaux, menés au cours de cette étude, s'intéressent à la détermination de la croissance et l’âge des
anguilles par otolithométrie. Ils visent, par le dosage tissulaire des métaux lourds (Cu, Cr, Cd, Pb et Hg) et
des HAP biliaires, l’identification du degré de contamination métallique et organique auxquels sont soumises
ces anguilles. Cette étude s'intéresse aussi au suivi de l’anguillicolose causée par Anguillicoloides crassus
chez l’Anguille dans les estuaires du Loukkos et du Sebou. L'étude écotoxicologique a mis en évidence la
contamination des anguilles des différents sites par le 1-OH pyrène et le 1-OH phénanthrène tandis que le
composé 3-benzo[a]pyrène (HAP) était absent. Le facteur hépatosomatique (RHS) était sensible à la
contamination par ces polluants. Une corrélation significativement négative (p<0,05) a été enregistrée entre
le facteur RHS et le taux des HAPs. Par ailleurs, l’analyse des éléments métalliques révèle une contamination
tissulaire généralisée avec des concentrations plus élevées du cuivre et du chrome. La concentration moyenne
(Atlantique, Maroc)
du mercure dans le muscle des anguilles du Sebou et du Loukkos est élevée, de l’ordre de 0,47 µg/g pf
(Loukkos) et de 0,46 µg/g pf (Sebou). Les anguilles de grande taille (50 à 60 cm) sont plus contaminées à des
valeurs toxiques, de l’ordre de 0,58 µg/g pf. Excédant ainsi la norme fixée par l’OMS (0,5 µg/g pf. pour la
consommation humaine). L’étude parasitologique, révèle que le facteur de dégénerescence des vessies
natatoires (SDI) présente une corrélation positive avec la variation du nombre du parasite (A. crassus) dans
les deux estuaires (p<0,05). Tandis que le suivi de l’anguillicolose (2004-2009) a montré une prévalence de
54% à Sebou, alors que dans Loukkos (2008-2009), elle est de l’ordre de 34%.
Mots clés: Anguilla anguilla, Métaux lourds, HAP, Anguillicoloides crassus, Estuaire, Sebou, Loukkos,
Maroc.
INTRODUCTION
Connu par son extrême diversité écologique, le Maroc est le pays d’Afrique du Nord le plus
pourvu en eaux continentales (2 000 km de cours d’eau). L’ichtyofaune des eaux
continentales marocaines compte 46 espèces dont 30 sont autochtones et 13 espèces
introduites appartenant à 7 familles [1]. Au sein de cette ichtyofaune l’Anguille (Anguilla
anguilla L.) est dotée d’une importance patrimoniale et sa pêche contribue à l'amélioration
des revenus des pêcheurs locaux, surtout après la disparition de l’alose. Au Maroc, limite
méridionale de distribution de l’Anguille européenne, la diminution générale du stock n’est
enregistrée qu’après le pic des captures en 1997 soit 17 ans après l’Europe [2]. Pour
remédier à cette situation et assurer la gestion durable de cette espèce, l’anguille a été
inscrite sur l’annexe II de la convention sur le commerce international des espèces de faune
et de de flore sauvages menacée d'extinction (CITES). Qui est entrée en vigueur le 13 Mars
2009. De sa part, le Maroc a adhéré à cette initiative. Le Haut Commissariat aux Eaux et
Forêts et à la Lutte Contre la Désertification (HCEFLCD) en qualité d’organe de gestion de
la CITES, a émis un certain nombre de mesures d’urgence tel que le contrôle des sociétés
aquacoles de l’anguille.
La présente étude rentre dans le cadre d’une contribution à la gestion du stock naturel des
populations d’anguilles au Maroc. Cette étude a été réalisée dans les plus importants sites
de pêche de l’anguille au Maroc, l’estuaire du Sebou et du Loukkos.
Les principaux objectifs de ce travail sont :
 La caractérisation des populations d’anguilles étudiées dans ces milieux par la
détermination de leur croissance et leur âge par l’otolithométrie.
 L'étude du degré de pollution métallique et organique auxquels sont soumises les
anguilles vivant dans les deux estuaires. Par l’analyse des degrés de contamination
par les métaux lourds et les hydrocarbures aromatiques polycycliques (HAP).
 Le suivi de l’évolution temporelle de l’anguillicolose causée par le parasite
nématode Anguillicoloides crassus et comparer les taux de l’infestation de ce
parasite entre ces estuaires.
MATERIEL ET METHODES
Croissance
Les échantillons d’anguilles ont été recueillis auprès des pêcheurs locaux en utilisant des
nasses (de maille de 5mm). Un nombre total de 333 anguilles jaunes et argentées ont été
collectées en 2008 et 2009. 203 anguilles du Sebou et 130 du Loukkos. Ces anguilles sont
transportées dans des glacières au laboratoire. Les paramètres suivants ont été mesurés, à
savoir : la longueur totale (L), mesurée au 0,5mm près, et le poids frais (W) évalué au
milligramme près. Ces mesures permettent d’apprécier l’évolution dans le temps de ses
deux paramètres et de calculer le coefficient d’allométrie permettant d’apprécier l’évolution
pondérale en fonction de la taille (L) à partir de la fonction suivante :
(Atlantique, Maroc)
logW = loga+blogL ;
où b = coefficient d’allométrie.
Le coefficient de condition :
Kc=100(W/Lb);
Avec L=longueur totale en cm, W est le poids frais en g et b coefficient d’allométrie.
La méthode utilisée pour la lecture d’âge est l’olithométrie. Dans notre étude nous avons
adopté la technique de clivage et de brûlage de l’otolithe [3]. On commence par la
réalisation d’une coupe transversale de la sagitta à travers son nucleus. Puis, chaque partie
est brûlée sur la flamme pendant 20 à 30 secondes. Les moitiés d’otolithes sont captées par
un pointeur, puis trempées doucement dans une petite quantité de silicone (préalablement
appliquée sur une lame de microscope). Le silicone est laissé au repos pendant environ 4560 minutes.
Bioaccumulation métallique
Les techniques de dosage des métaux lourds nécessitent l’utilisation d’échantillon sous
forme liquide. Après le prélèvement des organes (foie, branchies et muscle), nous les
plaçons dans des tubes à propylène neufs. Les échantillons prélevés suivent trois étapes: A
savoir la lyophilisation des tissus afin d’éliminer l’eau,suivi par la minéralisation et la
dilution. Les échantillons de tissus sont digérés à l'aide de l'acide nitrique (Ultra pur 65%).
Après la dilution, le dosage du Cu, Cd, Cr, Pb, est effectué par SAA de type Perkin Elmer
GFAAS SIMAA, alors que pour le dosage du mercure l’appareil utilisé est le FIMS (Flow
Injection Mercury System). Après la minéralisation, la dilution se fait avec de l’eau ultrapure (MilliQ). Afin de contrôler la fiabilité de cette méthode. Dans chaque série d’analyse
des échantillons blancs (acide pur) et certifiés (DORM) subissent les mêmes étapes de
préparation et d’analyse.
Contamination organique
Préparation des échantillons de la bile des anguilles
Après la dissection de chaque anguille, la bile est recueillie en perçant la paroi de la
vésicule biliaire avec une seringue jetable de 1 ml. Des prélèvements de bile d'environ 0,10,5 ml ont été immédiatement congelés et conservés à -20°C jusqu'à l'analyse.
Méthode analytique
Après la récupération de la bile, environ de 50 µl a été divisé en deux volumes égaux. Un
volume de 25µl est destiné pour l’hydrolyse et le dosage des HAP par HPLC-F et un autre
volume de 25µl est destiné pour la détermination du taux de la biliverdine et des protéines
biliaires par l’absorbance. Un volume de 25µl de bile a été mélangé avec 95μl d'eau et 5µl
de solution de β-glucuronidase/arylsulfatase (30-60 U/ml), puis incubé pendant 2h à 37°C
dans un agitateur chauffant. La réaction est arrêtée par l'addition de 125μl d'éthanol et la
solution finale est centrifugée (5 mn, 700G). Les surnageants ont été transférés dans des
flacons individuels pour l'analyse des HAP par HPLC.
Protocole expérimental
Les métabolites des HAP (1-hydroxypyrene, 1-hydroxphenantrene et 3hydroxybenzo[a]pyrène) ont été séparés par la technique de chromatographie en phase
liquide HPLC en utilisant un appareil de modèle Système Lachrom (Merck Hitachi)
comprenant une pompe quaternaire (L-7100). Les échantillons ont été séparés par une
colonne à nucléosil 100-5 C18 (4.6 x 250 mm) à phase inverse. Cette colonne est munie
d’une pré-colonne de 5x4 mm. La phase mobile initiale est l’acétonitrile (0,1%)/l’acide
trifluoroacétique pour un volume de 50:50 (v/v) pompé à 1 ml/mn. Après une durée de
19mn, la composition du solvant est changée à 60:40 pour 6mn puis changée en dernier lieu
(Atlantique, Maroc)
à 100% d’acétonitrile pour 3mn. Après chaque lot d’échantillons (6 Standards et 25
échantillons) la colonne est rincée par le méthanol. La limite de détection (LD) et la limite
de quantification (LQ) ont été calculées à partir d’une courbe du standard DIN 32645 (DIN,
1994) avec un intervalle de confiance de 99%. Pour 1-OH pyrène et 1-OH phénanthrène,
LD et LQ sont respectivement de l’ordre de 3,4 (0,5) et 22,5 (1,7) ng ml -1 de bile.
L’étalonnage des solutions a été préparé dans de l’acétonitrile de 5mg/ml. L’excitation et
l’émission des longueurs d’ondes paires pour 1-hydroxypyrène et 1-hydroxyphénanthràne
sont respectivement 346/384 nm et 256/380 nm. Un matériel de référence standard (BCR720, [4]) a été utilisé pour tester la précision de cette méthode.
Détermination de la biliverdine et l’absorbance à 380nm (A380)
Un volume de 25 µl de la bile a été ajouté à un volume de 475μl d'eau et l'absorbance a été
enregistrée à 380 nm et 660 nm en utilisant la moitié des microcuvettes et un spectromètre
UV/VIS (Perkin Elmer, Lambda 2S) [5].
Parasitologie
Un total de 1138 vessies natatoires d’anguilles de l'estuaire du Sebou (2004-2009) et 100
anguilles de l'estuaire du Loukkos (2008-2009) ont été examinées. Après avoir fait les
mensurations des différentes anguilles, la vessie natatoire a été retirée et
macroscopiquement examiné pour la présence des nématodes adulte et pré –adulte
d’Anguillicoloides crassus. La prévalence et l'intensité moyenne ont été calculées [6].
Pour les anguilles capturées dans la période 2008-2009 , l'indice dégénératif de la vessie
natatoire (SDI) a été utilisé pour décrire l'état de santé de l'organe infecté. Ceci a été réalisé
du fait que les paramètres épidémiologiques couramment utilisés , mentionnés ci-dessus, ne
peuvent pas décrire l'impact global d’A. crassus sur les anguilles. De graves dommages à la
vessie natatoire entraînant une paroi fibreuse et réduit ou pas de lumière peut faire obstacle
à l'établissement de nouvelles infections. Et donc, une absence de parasites peut soit
indiquer un manque d'infection si la vessie natatoire est en bon état , ou une intensité
précédemment élevée, si la vessie natatoire montre des signes caractéristiques de la
pathologie [7]. Le SDI quantifie les dommages observés dans un indice de la pression
parasitaire , allant de 0 à 6. La valeur 0 où on n'a observé aucun signe pathologique de
l'infection (paroi de la vessie natatoire mince et transparente) à 6 qui indique une vessie
natatoire extrêmement endommagée [8].
RESULTATS
Croissance
Relation taille-poids
Les variations du poids en fonction de la longueur sont exprimées le plus souvent par
l’équation: W = aLb où W: poids (P) et L: longueur, a et b: constantes.
La constante «a» représente la condition ou l’embonpoint du poisson et la constante «b»
traduit le taux d’allométrie. La distribution du poids en fonction de la longueur s’exprime
de façon exponentielle. Le taux d’allomètrie : b>3, ce qui signifie que le poids augmente
plus vite que le cube de la longueur, la population étudiée a une allométrie majorante. Ceci
est noté pour les deux populations (Figure 1 a et b).
(Atlantique, Maroc)
Figure 1-a : Variation de la corrélation entre la
longueur (L) et le poids (P) des différentes
anguilles capturées à l’estuaire du Loukkos
Variation du coefficient de condition (Kc)
Figure 1-b : Variation de la corrélation entre la
longueur (L) et le poids (P) des différentes
anguilles capturées à l’estuaire du Sebou
Le facteur ou coefficient de condition Kc est défini par le rapport entre le poids et la taille
du poisson. Il est donné par la formule : Kc = 100 W/L3 où W : Poids en gramme ; L :
Longueur en centimètre (Figure 2).
Figure 2 : Variation du coefficient de condition Kc des échantillons d’anguilles
du Loukkos (a) et du Sebou (b)
La moyenne de Kc est presque la même chez les deux populations (Loukkos et Sebou).
Cependant en mai, on note une diminution de ce facteur chez les populations des deux sites.
Sex-ratio
Les anguilles du Loukkos sont caractérisées par la prédominance des femelles alors que
celles du Sebou sont caractérisées par une égalité du pourcentage des mâles et des femelles,
le sex-ratio est équilibré (Figure 3).
Figure 3 : Pourcentage total des anguilles indifférenciées (ID), mâles (M) et femelles (F) dans les
estuaires du Loukkos et du Sebou.
(Atlantique, Maroc)
Relation âge-longueur totale des anguilles
La longueur totale des anguilles évolue avec l’âge des populations d’anguilles de chaque
site. Cependant, cette évolution n’est pas toujours croissante. Nous trouvons des anguilles
âgées avec une faible croissance en longueur (Figure 4).
Figure 4 : Variation de la longueur totale à l’âge des anguilles selon les campagnes au Sebou (à gauche)
et au Loukkos (à droite).
DISCUSSION
Biométrie et sex-ratio
Les populations d'anguilles du Sebou et du Loukkos sont constituées par des individus
appartenant à la classe des tailles moyennes entre 20 et 40 cm. Concernant le poids, il n’y a
pas de différence significative entre les deux sites. Nous remarquons la prédominance des
anguilles de poids moyen, de 50 à 200g. L’âge correspondant à cette classe varie entre 3 et
9 ans. En 1991, Yahyaoui [9] a trouvé que les anguilles du Sebou sont représentées surtout
par les individus de petite taille. Ceci, montre que la dynamique de la population des
anguilles, dans cet estuaire, a changé. Dans les milieux estuariens et côtiers, la croissance
est forte. Ceci implique que la taille de l’argenture est plus rapidement atteinte que dans les
eaux douces. La croissance des anguilles des deux sites est exponentielle et majorante. Elle
est traduite par un taux d’allométrie supérieur à 3, le poids croit plus vite que la longueur.
Ces résultats sont en accord avec ceux de Yahyaoui [9].
Dans nos échantillons, les anguilles femelles sont plus dominantes dans l’estuaire du
Loukkos, alors que dans l’estuaire du Sebou, nous constatons une égalité entre les deux
sexes. Cavailles et Loste [10] admettent que la variation de la proportion des mâles et des
femelles serait attribuée à la salinité de l’eau, dans le sens d’une augmentation du nombre
des mâles.
Facteur Kc
Le facteur de condition est un indicateur de la qualité de la croissance des populations des
poissons. Il décrit la qualité de croissance selon les conditions du milieu. Pour les anguilles,
cet indice est de 0,16 dans les bonnes normes [11].
Le facteur de condition Kc est presque le même dans les deux sites. Il est en moyenne de
0,18 à Sebou et de 0,17 à Loukkos. De même en 1991, Yahyaoui [9] a trouvé un Kc de
l’ordre de 0,18 chez les anguilles du Sebou. Ce qui suggère que les conditions de croissance
des anguilles n’ont pas subi une grande fluctuation. Mais, au mois de mai ce facteur
diminue chez les deux populations ; cette diminution concide avec le début de la saison
estivale (sèche) et qui est traduite par une croissance plus faible.
(Atlantique, Maroc)
Relation âge-croissance
La croissance est certainement l’aspect de la biologie des poissons qui est le mieux connu,
la variabilité de la croissance (individuelle ou annuelle) à l’intérieur des populations est
également considérable [12]. Chez les anguilles, la croissance présente une grande
irrégularité. En effet, des anguilles de même taille et de poids peuvent appartenir à des
groupes d’âge différents.
Bioaccumulation métallique
Résultats
Teneurs en Cu, Cr, Cd et Pb
Les concentrations en cadmium, chrome, cuivre, plomb dans les branchies, le foie, le
muscle des anguilles sont présentées dans le tableau 1.
Tableau 1: Teneurs en métaux (µg/Kg poids frais: pf) des anguilles pêchées dans les estuaires
du Sebou et du Loukkos. (Moyennes, écart-type)
Sites
Sebou
Loukkos
Organe
Muscle (M)
Foie (F)
Branchies(B)
Muscle (M)
Foie (F)
Branchies(B)
Cadmium
23,72±9,43
164,89±80,34
16,30±8,47
14,22±9,70
131,84±60,80
23,42±10,12
Plomb
61,41±34,80
130,16±67,82
510,86±228,71
45,04±14,57
114,51±57,13
145,80±97,15
Cuivre
818,83±181,08
16283,72±679,58
1602,57±293,03
590,02±147,97
14812,66±1679,58
3355,90±298,40
Chrome
113,39±90,86
164,46±52,67
588,31±190,67
214,27±98,78
190,86±76,56
433,94±174,35
L’analyse de la distribution tissulaire des métaux traces chez l’anguille montre une forte
accumulation du cuivre dans les trois organes, suivi du chrome. Par contre, les teneurs du
cadmium et du plomb sont généralement faibles. Chez ces individus, ce sont plutôt les
branchies et le foie qui accumulent le cuivre. Quant au chrome il est surtout accumulé dans
les branchies et ce à l’échelle des deux site. Le cadmium est concenté sutout dans le foie
pour les deux sites, alors que le plomb s’accumule dans les branchies.
Teneurs en mercure
Les concentrations en mercure ont été évaluées dans le muscle et le fois des anguilles
pêchées en amont (S1), en aval (S2) de l’estuaire du Sebou et dans l’estuaire du Loukkos
(S3). Les concentrations dans le muscle (µg/Kg pf) dans S1, S2 et S3, sont réspectivement
de l’ordre de 154,54±39,06 ; 465,57±245,78 et 473,83±304,12 (Figure 5). Ces résultats
montrent une différence significative entre S1 et S2 et entre S1 et S3, avec une valeur de
p<0,05. S1 qui représente la partie amont de l’estuaire du Sebou est moins contaminé que
les deux autres sites S2 et S3.
(Atlantique, Maroc)
Figure 5: Variation des concentrations (µg/kg) du mercure dans le muscle des anguilles de l’aval du
Sebou (HGMS), Loukkos (HGML) et celles de la partie amont du Sebou (HGMV)
Discussion
L’anguille poisson benthique, passe toute sa phase de croissance dans les eaux douces et
saumâres. est un bon modèle d’étude écotoxicologique et un indicateur utile de la
contamination par les métaux lourds dans les écosystèmes aquatiques [13], [14], [15], [16],
[17]. L’analyse des métaux lourds chez l’anguille (Anguilla anguilla), a montré une
contamination généralisée du cuivre, cadmium, chrome et plomb. Avec des valeurs de
concentrations élevées du cuivre, du chrome et du mercure. Par ailleurs, les concentrations
du plomb et cadmium sont faibles. Le foie est l’organe accumulateur des métaux lourds
chez l’ensemble des anguilles étudiées. Les fortes teneurs en cuivre et chrome sont
fortement liées à leur présence dans le sédiment et l’eau. Ces estuaires reçoivent les
effulents pollués par les activités industrielles et artisanales (anthropiques). Selon la
littérature [18], la rivière du Sebou est parmi les plus polluées à l’échelle du Maroc. Cette
pollution prend son origine des déchets déversés par les industries de textiles, de fabrication
de papier, des tanneries…
A l’instar de l’estuaire du Sebou, le bas Loukkos est de plus en plus pollué. Les causes sont
diverses (domestique, industrielle ou agricole). L’estuaire du Loukkos est un réceptacle de
tous ces rejets pollués des industries (COSIMA, SUCRAL…). Les anguilles femelles de
grande taille (≥50cm) ont montré une accumulation plus importante en mercure à cause de
leurs teneurs élevées en graisses (lipides). En effet, le stade de la reprise de la nourriture est
le plus sujet à la bioaccumulation des polluants et les polluants environnementaux ne
reflètent pas toujours le niveau actuel de la contamination des individus. Sures et Siddall
[19] constatent que les métaux ionisés sont principalement bioaccumulés par les branchies
du poisson et véhiculés à travers le système circulatoire aux différents organes. Les
branchies sont les principaux organes d’absorption des polluants toxiques pour les espèces
aquatiques [20], elles ont été choisies dans un certain nombre de travaux comme outil de
surveillance de toute intoxication chez les poissons [21], en étant les premiers en contact
avec l’eau, lors d’une contamination, les processus respiratoires du poisson risque d’être
perturbés.
Dans la présente étude, le cuivre et le chrome sont les éléments les plus abondants dans les
branchies pour les anguilles des 2 sites étudiés. Ces résutats sont en accord avec ceux
trouvés par Wariaghli et al. [22] à Sebou et à Merja Zerga. Chez les classes de taille
moyenne et grande, les anguilles accumulent plus de métaux lourds par rapport aux autres
stades. Ces anguilles ont tendance à se nourrir activement, pour disposer de réserves
(Atlantique, Maroc)
énergétiques suffisantes pour effectuer leur migration vers la mer des Sargasses. Ceci a été
noté largement dans la contamination par le mercure qui a dépassé les normes de 0,5 µg/g
pf (WHO) (Tableau 2) chez les anguilles du Sebou (aval), où la concentration a atteint 0,58
µg/g pf, mettant en danger la consommation humaine. L’étude de l’organotropisme chez les
différentes anguilles, montrent une accumulation préférentielle de tous les métaux lourds
étudiés au niveau du foie.
Tableau 2 : Normes des teneurs de certains métaux toxiques exprimées en µg/g du poids
frais
ESPAGNE
CANADA
HONGRIE
AUSTRALIE
CE/R N°466/2001
WHO
(CE) N°1881/2006
Cu (µg/g p.f.)
20
100
60
60
-
Pb (µg/g) p.f.)
1
0,4
-
Hg (µg/g pf)
0,5
-
Cd (µg/g pf)
0,1
Contamination organique
Résultats
Dosage des métabolites de HAP dans la vésicule biliaire par HPLC-FD
Les chromatogrammes obtenus, lors de la mesure des concentrations en HAP par HPLC
couplée à une détection par fluorescence (HPLC-FD) dans les échantillons de la bile,
montrent que parmi les métabolites de HAP étudiés, le 1-OH pyrène (1-OH pyr) et le 1-OH
phénanthrène (1-OH Phen) ont été détectés dans tous les échantillons, alors que le 3-OH
benzo [a] pyrène (BaP) n'a pas été détecté (au-dessous du niveau de détection: LQ) dans
tous les sites (Tableau 3).
Tableau 3: Métabolites des HAP: 1-Hydorxypyrène, 1-Hydroxyphenantrène, et biliverdine
(ng/ml bile) au niveau des anguilles pêchées, en 2009, en amont (S1) et en aval (S2) du
Sebou et dans le Loukkos (S3).
Sites
N
Biliverdine
A380/ml
1-Hydroxypyrène
1-Hydroxyphenantrène
Moyenne±SE
Moyenne±SE
Moyenne±SE
Moyenne±SE
S1
13
118,1±59,1
10,5-284,9
20,8±11,2
125,0-7,7
51,5±47,3
17,7-113,1
62,2±26,3
17,8-113,1
S2
20
216,7±55,0
129,1-666,5
20,8±11,2
12,0-7,7
153,6±73,3
58,6-153,6
68,7±34,3
25,7-182,9
S3
12
487,5±494,2
85,8-2332
35,7±29,8
143,5-6,5
209,5±124,0
56,4-453,4
72,8±69,8
9,8-304,6
Nous remarquons que le métabolite 1-OH pyrène (1-OH pyr) était le composant dominant
dans la plupart des échantillons d'anguilles. Dans le site S1, les mesures de ce métabolite
varient entre 17,7-113,1ng/ml avec une moyenne de 51,5ng/ml et en S3 ses valeurs varient
entre 56,4-453,4ng/ml avec une moyenne de 209,5 ng/ml à l'exception des échantillons
issus du site S1 (amont du Sebou) où la quantité de 1-OH Phen était plus élevée par rapport
aux autres contaminants HAP déterminés avec une moyenne de 72,8ng/ml et varie entre
9,8-304,6ng/ml.
(Atlantique, Maroc)
Normalisation des métabolites HAP
Après normalisation, en divisant les concentrations biliaires de 1-OH pyrène par la valeur
de l’absorption à 380 nm (A380nm), les résultats n'ont montré aucune différence
significative entre les sites (Figure 6). Cependant, après la normalisation du métabolite 1OH pyrène par la concentration totale des HAP, les anguilles pêchées du Loukkos (S3) ont
montré des concentrations significativement plus élevées (ANOVA, Scheffé’s post hoc, p <
0,05) par rapport aux deux autres stations du Sebou (S1 et S2) (Figure 6). Les résultats de la
normalisation des métabolites biliaires HAP (1-OH pyr et 1-OH phen) par l’absorbance de
la biliverdine montrent que le tau du métabolite 1-OH pyrène/biliverdine est supérieur à
ceux du 1-OH phen/biliverdine dans les sites S1 et S3. Quant au site S2, une remarquable
augmentation du 1-OH phen/biliverdine par rapport à celui du 1-OH pyr/biliverdine est
décelée. Après normalisation par la concentration de la biliverdine de la vésicule biliaire, le
site S2 (aval de l’estuaire du Sebou) semble plus contaminé par les composés organiques de
1-OH phénanthrène.
Figure 6 : Concentration du 1-OH Pyrène (ng/ml) dans la vésicule biliaire d'Anguilla anguilla dans les 3
sites: sans normalisation des concentrations (a), après normalisation des valeurs de l’absorbance
calculée à 380 nm (b), et après normalisation des valeurs en divisant les concentrations par le total des
concentration des différents HAP (c)
Discussion
Les hydrocarbures aromatiques polycycliques (HAP) sont des contaminants
environnementaux ubiquitaires et persistants, trouvés dans les sédiments et les eaux
associés aux estuaires urbanisées et les zones côtières [23], [24], [25]. Ces substances
(Atlantique, Maroc)
organiques sont reconnues être toxiques et persistantes. Ces composants chimiques sont
prioritaires en raison d’effets préoccupants sur la santé par l’United States Environmental
Protection Agency. En particulier, certains d’entre eux à l’image du Benzo[a]pyrène (B[a]P)
génèrent des mutations au niveau de l’ADN et peuvent être à l’origine de cancers. Cette
étude a montré l’existence d’importants métabolites d’HAP tels que le 1-OH pyr et le 1-OH
phen dans la vésicule biliaire des anguilles. Alors que le métabolite Benzo(a)pyrène était
indétectable. Dans la plupart des échantillons, le 1-OH pyr est le métabolite d’HAP le plus
prédominant. D’autres études ont confirmé aussi l’utilité de ce métabolite du fait qu’il est le
principal composant des HAP trouvé dans la vésicule biliaire des poissons [26], [27], [28],
[29], [30]. La présence du 1-OH phen, un autre contaminant organique, dans les
échantillons biliaires des anguilles, montre que ce poisson est sujet à différents
contaminants des hydrocarbures aromatiques polycycliques. Cependant, les valeurs de
mesures du 1-OH phen sont significativement inférieures à celles du 1-OH pyr. Ces
résultats sont en accord avec ceux de Ruddock et al [28] et Nagel et al [31]. Ceci
s’expliquerait par le fait que les phénanthrènes sont fortement liés au sédiment ce qui
diminue leur biodisponibilité dans l’environnement aquatique notamment dans les estuaires
[32].
En outre, l’absence du métabolite mutagène et le plus cancérigène 3-OH benzo[a]pyrène
[33] est expliquée par le fait de sa production suite à de nombreux procédés industriels,
notamment les raffineries de pétrole [34]. L’énergie de formation des metabolites BaP est
de l’ordre de 82,269 Kcal.mol-1. Alors que celle des pyrènes et phénantrènes, sont
réspectivement de l’ordre de 55,389 et 61,764 Kcal.mol-1. Ceci, montre la complexité de la
formation des BaP par rapport aux autres métabolites d’HAP étudiés. La différence de
biodisponibilité des composés serait cependant un facteur déterminant leur présence dans la
matrice biologique, notamment dans le contenu biliaire des anguilles.
Ces résultats gardent les mêmes tendances, même après leur normalisation par rapport à
l’absorbance 380 nm. Les mesures trouvées restent peu variables. La même remarque a été
signalée par Ruddock et al [28], Nagel et al [31] et Vuorinen et al [35]. Les concentrations
du 1-OH pyr dans les estuaires du Loukkos (S3) et du Sebou partie avale (S2) sont
significativement plus élevées (P < 0,05) que dans la partie amont de l’estuaire du Sebou
(S1). En outre, les plus faibles concentrations du 1-OH Pyr et 1-OH phen, sont détectées
chez les anguilles du S1. Néanmoins, l’estuaire aval est le réceptacle de nombreuses
substances toxiques métalliques ou organiques d’origine anthropique. Le site S2 se trouve
proche d’une activité anthropique très intense (ville de Kénitra), ajoutant à ce fait les eaux
polluées provenant des différents affluents du bassin du Sebou.
Par ailleurs, au niveau de l’estuaire du Loukkos, zone qui connait une forte activité agricole,
El Bakouri et al [36] ont montré que la riziculture, sur le bas loukkos, est la principale
source de pollution et responsable des fortes teneurs de pesticide enregistrées dans le bas
Loukkos. Les déchets organique et métallique issus de cette culture sont déversés dans
l’estuaire [37]. Dégradant ainsi, la qualité d’habitat des anguilles et augmentent leur stress.
En plus, le trafic routier sur l’auto-route avoisinnant le Loukkos constitue une source de
pollution supplémentaire. Les métabolites d’HAP sont rejetées directement dans
l'atmosphère (par l’échappement du gaz) et ensuite transportés par les courants d'air et les
déposent, au moins en partie, sur les eaux estuariennes et fluviales. Ceci expliquerait les
taux élevés des métabolites de la pyrène trouvés chez les anguilles du bas Loukkos.
(Atlantique, Maroc)
Parasitologie
Résultats
Evolution temporelle de l’anguillicolose au Sebou
La prévalence annuelle moyenne (%) et les intensités d’A. crassus dans les anguilles de
l'estuaire du Sebou sont présentées dans la figure 7. Nous constatons que la prévalence de
l'infection varie entre 39 et 66,7% au cours des années. Les années présentant les plus
hautes prévalences ont été 2005 et 2006 avec un maximum de 66,7% en 2006. L'intensité
moyenne était de 2,93 parasites par anguille infectée (Figure 7). Par ailleurs, la taille des
anguilles étudiées montrent une différence significative entre les années 2004 et 2009
(Kruskal-Wallis ANOVA: H4,1138=34,83 ; p<0.0001). Et, toutes les catégories de taille
d'anguilles ont été infectées par A. crassus. La plus petite anguille infectée était de 14 cm
avec 2 parasites. Et, la prévalence la plus élevée a été détectée dans les classes de taille
supérieure à 60cm.
Comparaison de l'infection entre les sites
Il n'y avait pas de différence significative, en longueur moyenne, entre les anguilles étudiées
de l'estuaire du Sebou et celui du Loukkos. Cependant, des différences significatives, en
longueur moyenne, sont enregistrées entre les anguilles de la présente étude et celles des
anguilles des années 2003 à 2009 (p <0,001). Et, les valeurs de prévalence varient d'un
minimum de 12% en mai 2009 au Loukkos à un maximum de 79,36% en octobre 2004 à
Sebou.
L'intensité moyenne la plus élevée a été observée en janvier 2006 à Sebou. La majorité des
anguilles ont été infectées avec un faible nombre de parasités (45,9% des anguilles non
infectées; 41,8% avec 1-5 parasites), tandis qu'un petit nombre est fortement infecté. La
variation du facteur SDI entre 2008 et 2009 des anguilles de l’estuaire du Loukkos était
respectivement de 1,13±0,23 (2008) et 2,45±0,77 (2009), alors qu’à Sebou les niveaux de
SDI ne présentaient pas de grand changement : 1,9±2,04 (2008) et 1,97±0,44 (2009)
(Figure7).
Figure 7 : Moyenne du facteur SDI ±SD de la vessie natatoire des anguilles capturées dans les estuaires
du Sebou et du Loukkos en 2008 et 2009
Discussions
Au Maroc, les premières données épidémiologiques sur ce parasite (A. crassus) ont été
initialement décrites dans les rivières marocaines par El Hilali et al [38] où la prévalence
était de 52% dans le Sebou et 43% dans le Loukkos. Depuis, plusieurs auteurs se sont
intéressés à ce parasite au Maroc [2], [39], [40], [41], [42], [43]. La prévalence est passée de
60% en 2004 à 47% en 2009 (Sebou). A Loukkos le taux d'infestation était plus stable à
30% (2008) et 38% (2009). Dans les deux sites, le degré d'infestation dans les dernières
(Atlantique, Maroc)
années est en baisse, ce qui suggère que l'infestation par ce nématode de la vessie natatoire
est en voie de stabilisation comme cela a déjà été suggéré dans les lagunes saumâtres en
France [8] et dans d'autres pays européens (aux Pays-Bas [44], en Angleterre [45], en
Hongrie [46], en Allemagne [47]). La possibilité d’adaptation à l'hôte pourrait expliquer la
stabilisation de l'infestation. En effet, l'adaptation de la résistance est sans doute acquise
après une longue période de coévolution hôte-parasite [47]. Nous devrions considérer ainsi
que la salinité dans ces estuaires est également élevée. En effet, ce facteur limiterait la
propagation d’A. crassus sur toutes les eaux marocaines. En effet, l’augmentation de la
salinité diminue la survie et l'ineffectivité des larves. Néanmoins, les nématodes adultes
sont capables de survivre et de se reproduire en eau saumâtre ainsi que dans les eaux
marines. Nos données ont montré une corrélation entre le nombre de parasites et les valeurs
SDI, plus la vessie natatoire nourrissait des parasites plus elle a montré le signe de
dégradation. Compte tenu de la variation saisonnière et inter-annuelle (2004-2009) au
Sebou, il ya une diminution globale du taux d'infestation au printemps, en été et en automne
mais, pas de variation importante en hiver. Au Loukkos, la variation mensuelle montre la
même baisse, sauf en octobre 2009 où un taux élevé a été enregistré (65%) ainsi que dans le
Sebou au cours du même mois (51%). Cela ne peut pas être liée à la migration de
reproduction des anguilles de grande taille qui sont fortement infectées, car une baisse
saisonnière similaire s'observe encore lorsque, nous ne considérons que les classes de petite
taille (≤ 200mm). Au contraire, cette baisse pourrait indiquer soit une régénération
saisonnière du tissu de la vessie natatoire de l’hôte, ou un taux de mortalité d'accueil
saisonnier des anguilles fortement touchées (mortalité induite par le parasite) comme il a été
suggéré par Lefebvre et al [8].
La fluctuation saisonnière du taux de parasitisme peut également être liée à des
changements dans la période de l’alimentation des anguilles. En effet, les anguilles sont
soumises à deux périodes critiques au cours desquelles elles ne se nourrissent pas : une fois
en hiver, lorsque la température est inférieure à 10°C, et de nouveau en été, quand la
température peut s'élever au-dessus de 30°C [49]. Ces fluctuations de température et de
salinité expliquent, d'une part, la faible prévalence enregistrée par rapport à celles en eau
douce (prévalence en hausse de 100%) dans différentes régions d'Europe [50] et d'autre
part, la forte prévalence (83%) mentionnée en 1997 par Kheyyali et al [39] dans le Sebou
pourrait être due à un fort afflux d'eau douce pendant la période d'hiver, ce qui facilite la
dispersion des larves en phase libre.
(Atlantique, Maroc)
Tableau 4I : Epidémiologie de l’infection d’Anguilla anguilla par le nématode Anguillicoloides
crassus dans les estuaires du Sebou (S) et du Loukkos (L)
durant la période 1994-2009
Auteurs
Date
Site
Nombre
d’anguilles
ElHilali
et al.
1996
ElHilali
et al.
2004
Oct 94
Nov 94
L
S
60
60
Feb 2002
Mar 2002
Apr 2002
May 2002
Jun 2002
Jul 2002
Sep 2002
Oct 2002
Dec 2002
Jan 2003
July 2004
S
S
S
S
S
S
S
S
S
S
S
86
62
60
45
41
58
61
60
59
56
86
181,6
197,9
170,3
157,3
153,5
169,9
144,8
168,7
208,6
188,7
340,2
Apr 2004
May 2004
Oct 2004
Nov 2004
Dec 2004
Jan 2005
Mar 2005
Apr 2005
Jan 2006
Feb 2006
Mar 2006
May 2006
Apr 2008
Mar 2008
Apr 2008
May 2009
Oct 2009
Mar 2009
May 2009
Oct 2009
Nov 2009
S
S
S
S
S
S
S
S
S
S
S
S
L
L
S
L
L
S
S
S
S
107
131
63
58
39
66
60
96
60
51
41
23
33
40
30
10
17
17
37
94
20
342,0
307,0
305,0
341,0
290,4
327,4
323,0
328,1
367,9
339,7
340,1
347,9
330,2
320,8
358,83
460,1
504,8
411,7
387,5
312,1
398,1
Loukili et
Belghyti 2007
Wariaghli et
al (Présente
étude)
Taille des Nombre de
anguilles parasites
(mm)
168,6
59
170,3
49
SDI ±SD
Prévalenc Intensité
e(%)
-
51,6
43,3
1,9
1,9
27
75
49
27
26
47
48
59
46
63
335
-
12,7
37,1
43,3
40,0
43,9
46,5
47,5
50,0
38,9
55,3
65,1
2,4
3,2
1,9
1,5
1,4
1,7
1,6
1,9
2,0
2,0
3,9
148
381
155
91
75
123
73
38
173
108
97
65
35
18
37
8
37
20
44
144
3
1,3±1,4
0,9±1,5
1,9±2,0
1,9±1,8
3,0±1,5
2,4±1,3
1,4±0,7
2,2±1,2
1,8±0,7
42,0
58,7
79,3
41,3
56,4
56,0
58,3
63,5
56,6
58,8
73,1
78,2
36,3
24,0
39,0
40,0
65,0
51,0
58,0
51,0
30,0
3,3
4,9
3,1
4,0
3,4
3,3
2,0
0,6
5,1
3,6
3,2
3,6
1,6
1,8
3,1
2,0
3,3
2,2
2,0
3,0
0,5
La voie de la mise en place d’A. crassus est encore inconnue, puisque le Maroc n'a jamais
importé anguilles vivantes mais il les exportent uniquement. Comme il a été mentionné cidessus, les premières données enregistrées de ce parasite étaient en 1994 dans les estuaires
du Loukkos et du Sebou [38]. En 1987 et 1993, des alevins de poissons cyprinidés de
Bulgarie ont été introduits dans les hydrosystèmes marocains afin de lutter contre le
problème de l’eutrophisation. Ce poisson est considéré comme l'hôte paraténique de ce
nématode [46]. Par ailleurs, en 1991, Székely et al [46] publient la première occurrence de
l’anguillicolose (par A. crassus) en Hongrie qui a importé des anguilles de la Bulgarie,
pour le repeuplement du lac Balaton.
L'hypothèse qui semble la plus convaincante est que ce nématode a été introduit dans les
eaux continentales marocaines, par ces cyprinidés importés de la Bulgarie. Et, par la suite
(Atlantique, Maroc)
l’Anguillicoloides crassus a désormais envahie presque toutes les eaux marocaines.
Cependant, l'intensité moyenne a commencé à diminuer, donc il peut y avoir de l'espoir d'un
équilibre évolutif de ce parasite.
CONCLUSION
Cette étude sur la caractérisation des anguilles des estuaires du Sebou et du Loukkos,
principaux sites de pêche de l’Anguille au Maroc, a permis d’évaluer leur croissance tout en
identifiant le degré de leur contamination métallique et organique, par le dosage tissulaire
des métaux lourds (Cu, Cr, Cd, Pb) et des HAP biliaires. Et, de réaliser un suivi de
l’évolution de l’anguillicolose causée par le parasite Anguillicoloides crassus dans les
écosystèmes aquatiques marocains. L’étude écotoxicologique a mis en évidence, une
contamination tissulaire généralisée avec des concentrations plus élevées du cuivre et du
chrome. La concentration moyenne d’Hg dans le muscle des anguilles des deux estuaires est
élevée, elle est de 0,47 µg/g (Loukkos) et de 0,46 µg/g (Sebou). Les anguilles de grande
taille (50-60 cm) sont plus contaminées à des valeurs toxiques, de l’ordre de 0,58 µg/g,
excédant ainsi la norme fixée par WHO (0,5 µg/g pf pour la consommation humaine). De
plus, cette étude révèle une contamination des anguilles, des différents sites, par le 1-OH
pyrène et le 1-OH phénanthrène et l’absence du composé 3-benzo[a]pyrene (HAP) dans la
bile des anguilles analysées. Alors que le facteur hépatosomatique était sensible à la
contamination par ces polluants. Une corrélation significativement négative (p<0,05) entre
le RHS et le taux des HAPs a été enregistrée. Le suivi de l’anguillicolose a montré une
prévalence de 54% dans le Sebou contre seulement 34% dans le Loukkos. Et cette étude
parasitologique montre que le facteur de dégenerescence des véssies natatoires (SDI)
présente une corrélation positive avec la variation du nombre du parasite (A. crassus) dans
les deux estuaires (p<0,05). Face à la diminution alarmante du stock d’anguilles au Maroc,
il est urgent de restaurer et améliorer la qualité des habitats de l'anguille et de réduire les
effets néfastes de la pollution et de surveiller l’introduction d'espèces allochtones pour
éviter la dégradation de l'habitat et l’apparition de nouvelles maladies. Il est aussi urgent de
mettre en place un suivi régulier de l'impact social et économique de la pêche de l'anguille
et d'évaluer l'efficacité des mesures entreprises sur la préservation de l'anguille, qui est une
espèce en danger critique d’extinction dans toute son aire de répartition.
REMERCIEMENTS
Cette étude a été réalisée grâce au soutien de la Coopération Maroco-Allemande (Projet
PMARS II n°12/30).
REFERENCES
[1] Azeroual,A-Crivelli,A-Yahyaoui,A-Dakki,M: “L'ichtyofaune des eaux continentales du Maroc” Cybium,
24 (3) suppl.: 17–22, 2000.
[2] Wariaghli,F-Al Amouri,M-Khodari,M-Fekhaoui,M-Yahyaoui,A: “Report on the eel stock and fisheries in
Morocco” EIFAAC/ICES Wgeel, 509-543, 2012.
[3] Hu,LC-Todd,PR: “An improved technique for preparing eel otoliths for aging” New Zealand journal of
marine and freshwater research, 15: 445-446, 1981.
[4] Ariese,F-Beyer,J-Wells,D: “Two fish bile reference materials for PAH metabolites” J Environ Monitor. 7,
(9): 869-876, 2005
[5] Grossbard,Ml-Boyer,Jl-Gorden,ER: “The excretion pattern of biliverdin and bilirubin in bile of the small
skate (Raja erinacea)” J. Comp. Physiol., B 157:61–66, 1987.
[6] Bush,AO-Lafferty,KD-Lotz,MJ-Shoslak,AW: “Parasitology meets ecology on its own terms “ Margolis et
al revisited. J. Parasitol. 83, 4: 575-583, 1997.
(Atlantique, Maroc)
[7] Lefebvre,F-Crivelli,AJ: “Anguillicolosis: dynamics of the infection over two decades” Dis. Aquat. Org.,
62: 227–232, 2004.
[8] Lefebvre,F-Contournet,P-Crivelli,AJ: “The health state of the eel swimbladder as a measure of parasite
pressure by Anguillicola crassus” Parasitology, 124: 457–463, 2002.
[9] Yahyaoui,A: “Contribution à l’étude de la biologie de l’Anguille (A. anguilla L., 1758) dans son aire
méridionale de répartition géographique : littoral atlantique et méditerranéen marocain “ Doct. d'Etat,
Océanologie, Univ. Mohammed V, Rabat, 314 p., 1991.
[10] Cavailles,M-Loste,C: “L'exploitation de l'anguille en Languedoc- Roussillon“ CEPRALMAR Août,
1988.
[11] Bauchot,R-Bauchot,ML: “Coefficient de condition et indice pondéral chez les Téléostéens “Cybium,
3ème Série, 4: 3-16, 1978.
[12] Philippart,JC: “Dynamique des populations de poissons d’eau douce non exploitées“ In : Problèmes
d’écologie. Lamotte,M-Bourlière,F, Masson, Paris: 291-394, 1975.
[13] Barak,NAE-Mason,CF: “A catchment survey for heavy metals using the eel (Anguilla anguilla)”
Chemosphere 21: 695-9, 1990.
[14] Bruslé,J: “L’Anguille européenne Anguilla anguilla un poisson sensible aux stress environnementaux et
vulnérable à diverses atteintes pathogènes“ Bull. Fr. Pêche Piscic., 335: 237-260, 1994.
[15] Gunkel,G: “Grundlagen der Verfahren zur Bioindikation” In : Gunkel, G. Ed., Bioindikation in
aquatischen Okosystemen. Fischer Verlag, Jena, Stuttgart, 323–420, 1994.
[16] Robinet,T-Feunteun,E: “Sublethal effects of exposure to chemical compounds : a cause for the decline in
Atlantic eels?” Ecotoxicology, 11, 265-277, 2002.
[17] Klavins,M-Potapovics,O-Rodinov,V: “Heavy Metals in Fish from Lakes in Latvia: Concentrations and
Trends of Changes” Bul. of envir. contamination and toxicology, 82(1): 96-100, 2009.
[18] Bouachrine,M-Fekhaoui,M-Benasser,L-Idrissi,L: “Distribution of selected metals in tissue samples of
fish from industrially contaminated stream (The river Sebou, Morocco)” Acta Hydrobiol, 40: 173–
179, 1998.
[19] Sures,B-Siddall,R: “Pomphorhynchus laevis: the intestinal acantho- cephalan as a lead sink for its fish
host, chub (Leuciscus cephalus)” Experimental Parasitology, 93: 66-72, 1999.
[20] Ahmad,I-Pacheco,M-Santos,A: “Anguilla anguilla L. oxidative stress biomarkers: An in situ study of
freshwater wetland ecosystem (Pateira de Fermentelos, Portugal)” Chemosphere, 65: 952-962, 2006.
[21] Fekhaoui,M-Keck,G: “Toxicité aiguë et distribution tissulaire du cuivre lors d’intoxication subaiguë chez
la truite arc-en-ciel (Salmo gairdneri)“ Bull Ins. Sci., Rabat. 10:143-153, 1986.
[22] Wariaghli,F-Tilghman,A-El Abidi,A-El Hamri,H-Fekhaoui,M-Yahyaoui,A: “Anguilla anguilla L. :
Evaluation of the degree of heavy metals contamination in the Sebou estuary and in Moulay
Bousselham lagoon reserve (Morocco)” Int. J. Aqu. Sci: Vol 4, No.2, 69-82, 2013.
[23] Meador,J-Stein,J-Reichert,W-Varanasi,U: “Bioaccumulation of polycyclic aromatic hydrocarbons by
marine organisms” Rev. Environ. Contam Toxicol 143: 79-165, 1995.
[24] Woodhead,RJ-Law,RJ-Matthiessen,P: “Polycyclic aromatic hydrocarbons in surface sediments around
England and Wales and their possible biological significance” Mar Pollut Bull. 38(9): 773-790,1999.
[25] Blahová,J-Havelková,M-Kružíková,K-Hilscherová,K-Halouzka,R: “Assessment of contamination of the
Svitava and Svratka rivers in the Czech Republic using selected biochemical markers” Environ
Toxicol Chemi. 29(3): 541–549, 2010.
[26] Van Der Oost,FJ-Van Schooten,F-Ariese,H-Satumalay Heida,K-Vermeulen,N: “Bioaccumulation,
biotransformation and DNA binding of PAHs in feral eel (Anguilla anguilla) exposed to polluted
sediments: a field survey” Environ Toxicol Chem. 13: 859–870, 1994.
[27] Aas,E-Beyer,J-Goksøyr,A: “PAH in fish bile detected by fixed wavelength fluorescence” Mar Environ
Res 46: 225–228, 1998.
[28] Ruddock,PJ-Bird,DJ-Mcevoy,J-Peters,LD: “Bile metabolites of polycyclic aromatic hydrocarbons
(PAHs) in European eels Anguilla anguilla from United Kingdom estuaries” Sci. Total. Environ.
301: 105–117, 2003.
[29] Beyer,J-Jonsson,G-Porte,C-Krahn,MM-Ariese,F: “Analytical methods for determining metabolites of
polycyclic aromatic hydrocarbon (PAH) pollutants on fish bile: a review” Environ Toxicol
Pharmacol. 30: 224–244, 2010.
[30] Nagel,F-Kammann,U-Wagner,C-Hanel,R: “Metabolites of polycyclic aromatic hydrocarbons (PAHs) in
bile as biomarkers of pollution in European eel (Anguilla anguilla) from German rivers “Arch.
Environ. Contam Toxicol 62: 254-263, 2012.
[31] Nagel,F-Wagner,C-Hanel,R-Kammann,U: “The silvering process of European eel (Anguilla anguilla)
influences PAH metabolite concentrations in bile fluid: Consequences for monitoring” Chemosphere
87: 91-96, 2012.
(Atlantique, Maroc)
[32] Yuan,Sy-Chang,JS-Yen,JH-Aas,E-Beyer,J-Goksøyr,A: “PAH in fish bile detected by fixed wavelength
fluorescence” Mar Environ Res. 46: 225–228, 2001.
[33]Penning,TM-Burczynski,ME-Hung,CF-Mccoull,KD-Palackal,NT-Tsuruda,LS:
“Dihydrodiol
dehydrogenases and polycyclic aromatic hydrocarbon activation: generation of reactive and redox
active O-quinones” Chem Res Toxicol 12: 1–18, 1999.
[34] Lin,ELC-Cormier,SM-Racine,RN: “Synchronous fluorometric measurement of metabolites of polycyclic
aromatic hydrocarbons in the bile of brown bullhead” Environ Toxicol Chem. 13: 707-715, 1994.
[35]Vuorinen,PJ-Keinänen,M-Vuontisjärvi,H-Barsiene,J-Broeg,K-Förlin,L-Gercken,J-Kopecka,J-Köhler,AParkkonen,J-Pempkowiak,J-Schiedek,D: “Use of biliary PAH metabolites as a biomarker of pollution
in fish from the Baltic Sea” Mar. Pollut Bull. 53: 479-487, 2006.
[36] El Bakouri,H-Ouassini,A-Morillo,J-Usero,J: “Pesticides in ground water beneath Loukkos perimeter,
Northwest Morocco” J Hydrol 348: 270-278, 2008.
[37] El Morhit,M-Fekhaoui,M-Elie,P-Girard,P-Yahyaoui,A-El Abidi,A-Jbilou,M:. “Heavy metals in sediment,
water and the European glass eel, Anguilla anguilla (Osteichthyes: Anguillidae) from Loukkos River
estuary (Morocco, Atlantic)” Cybium, 33 (3) : 219-228, 2009.
[38] El Hilali,M-Yahyaoui,A-Sadak,A-Maachi,M-Taghy,Z: “Premières données épidémiologiques sur
l’Anguillicolose au Maroc“ Bull. Fr. Pêche Piscic., 340: 57-60, 1996.
[39] Kheyyali,D-Lachheb,K-Yahyaoui,A-Hilali,JH: “Status of European eel infestation by the nematode
Anguillicola crassus in aquatic ecosystems in Morocco” Actes Institut Agronomique Vétérinaire
(Maroc), 19 (3): 177-180, 1999.
[40] Rahhou,I-Melhaoui,R-Lecomte-Finiger,R-Morand,S-Chergui,H: “Abundance and distribution of
Anguillicola crassus (Nematoda) in eels Anguilla anguilla from Moulouya estuary (Morocco)”
Helminthologia, 38, 2: 93-97, 2001.
[41] El Hilali,M-Yahyaoui,A-Chetto,N: “Etude de l’infestation des anguilles (Anguilla anguilla) par le
parasite (Anguillicola crassus) dans l’estuaire du Sebou au nord-ouest du Maroc“ Bull de l’Institut
Scientifique, sect. Sci. de la Vie, 26-27: 39-42, 2004.
[42] Yahyaoui,A-Freyhof,J-Steinmann,I: “Diversité ichtyologique et biologie d’Anguilla anguilla L., 1758
(Actinopterygii, Anguillidae) dans le Rhin moyen“ Zool. Baetica, 15 : 39-60, 2004.
[43] Loukili,A-Belghyti,D: “The dynamics of the nematode Anguillicola crassus, Kuvahara 1974 in eel
Anguilla anguilla (L. 1758) in the Sebou estuary (Morocco)” Parasitol. Res., 100: 683–6862007.
[44] Haenen,OLM-Van Banning,P-Dekker,W: “Infection of eel Anguilla anguilla and smelt Osmerus
eperlanus (L.) with Anguillicola crassus (Nematoda, Dracunculoidea) in the Netherlands from 1986
to 1992” Aquaculture 126: 3-4, 1994.
[45] Ashworth,ST: “Possible regulation in the Anguillicola crassus host-parasite system. In: Pike AW, Lewis
JW (eds) Parasitic diseases of fish” Samara Publishing, Tresaith: 141–150, 1994.
[46] Székely, CS-Lang,M-Csaba,GY: “First occurrence of Anguillicola crassus in Hungary” Bull of the
European Association of Fish Pathologists 11, 162–163, 1991.
[47] Koops,H-Hartmann,F: “Anguillicola infestations in Germany and in German eel imports” Journal
Applied Ichthyology, 5: 41-45, 1989..
[48] Kirk,RS: “The impact of Anguillicola crassus on European eels” Fish. Manage. Ecol., 10: 385–394,
2003.
[49] Tesch,FW: “The eel. 3rd edition” Blackwell publishing. Ltd, Oxford, UK 5th Ed. 408p, 119–212, 2003.
[50] Kennedy,CR-Fitch,DJ: “Colonization, larval survival and epidemiology of the nematode Anguillicola
crassus, parasitic in the eel Anguilla anguilla in Britain” J. Fish Biol., 36: 117-131, 1990.
Water, Nitrogen and Phosphorus Budgets in the Arabian-Persian Gulf
Water, nitrogen and phosphorus budgets in the Arabian-Persian Gulf
1,2
Mohamed A. Said1; Abeer El-Saharty2
National Institute of Oceanography and Fisheries (NIOF), Alexandria, Egypt
[email protected], [email protected]
SUMMARY
The study presents an attempt to calculate water flux, nitrogen and phosphorus transportation in the ArabianPersian Gulf using data collected during the NOAA Mt. Mitchell and the joint ROPME-Japanese Umitaka
Maru expeditions and the published scientific literatures. The hydrographic structure of the Arabian-Persian
Gulf indicated the existence of an inflow of low salinity (37) surface water from the Gulf of Oman and an
outflow of a more saline (41) subsurface water in the opposite direction. The present data indicated that, the
inflowing surface water from the Gulf of Oman exhibited the levels of NO2 (0.10-0.89 µmole/l, mean 0.46
µmole/l), NO3 (0.10-5.22 µmole/l, mean 2.04 µmole/l), NH4 (0.70-2.05 µmole/l, mean 1.20 µmole/l) and
phosphorus (0.36-0.65 µmole/l, mean 0.50 µmole/l). The bottom water outflow from Persian Gulf is
characterized by NO2 (0.29-0.94 µmole/l, mean 0.62 µmole/l), NO3 (0.96-4.82 µmole/l, mean 3.10 µmole/l),
NH4 (0.74-2.11 µmole/l, mean 1.32 µmole/l) and phosphorus (0.37-0.51 µmole/l, mean 0.47 µmole/l).
The total evaporation from the Gulf Area amounted to 0.013 Sv of which 0.0006 Sv returned to the area in the
form of precipitation and 0.003 Sv in the form of land runoff. The computed ingoing water from the Gulf of
Oman to the Gulf area through the Strait of Hormuz and the outgoing water based on the salinity
measurements were 0.088 Sv and 0.079 Sv respectively. Nitrogen and phosphorus transported to the ArabianPersian Gulf area from Shatt el-Arab Rivers are 125.2 and 5.3 tons/day, while 395.6 and 119 tons/day enters
to the area from Gulf of Oman through the Strait of Hormuz respectively. The amount of nitrogen and
phosphorus loads transported out of the Arabian-Persian Gulf through the Strait of Hormuz with the bottom
current is 483.8 and 98 tons/day.
Key words: water budget, nitrogen, phosphorus, Arabian-Persian Gulf.
INTRODUCTION
The Persian Gulf, referred to in some countries as the Arabian Gulf, is an important
military, economic and political region owing to its oil and gas resources and is one of the
busiest waterways in the world. In the present study, we will use the word Arabian-Persian
Gulf. Countries bordering the Arabian-Persian Gulf are the United Arab Emirates, Saudi
Arabia, Qatar, Bahrain, Kuwait and Iraq on one side and Iran on the other side (Fig. 1).
Arabian-Persian Gulf Area is a semi-enclosed marginal sea trending in the NW-SE
direction with an opening connected to the Gulf of Oman through the Strait of Hormuz. the
Gulf is about 990 km long ; the maximum width is about 338 km. the surface area and
volume of Gulf are estimated to be 239,000 km 2 and 8,63× 103 km3 respectively [1], which
correspond to a mean depth of about 36m. The maximum depth is about 100m near the
Strait of Hormuz; much smaller than the typical depth (900m) of the Gulf of Oman on the
other side of the strait.
Due to its shallow nature, the Arabian-Persian Gulf appears to be influenced by winds and
surface thermohaline fluxes. The persistent southward wind stress, at least in the northern
half of the Gulf, appears to set up coastal current regimes along both the Saudi
(Downwelling) and Iranian (upwelling) coasts. A persistent thermal front across the
Arabian-Persian Gulf about the latitude of Qatar appears related to the thermohaline
exchange through the Strait of Hormuz and splits the Gulf into two regimes. The winds and
currents in the Gulf of Oman are influenced by the southwest monsoon. This influence
continues through the Straits of Hormuz and into the eastern regime.
Figure 1: Arabian-Persian Gulf
Despite of the importance and singularity of the Arabian-Persian Gulf, there is a little
number of studies to understand the water and nutrients budgets in the Gulf. [2] studied the
chemical oceanography of the Arabian-Persian Gulf. The distribution of dissolved reactive
phosphate, nitrate and nitrite in the waters of Shatt el-Arab Estuary and the NW ArabianPersian Gulf were studied from November 1979 to April 1980[3].They concluded that, the
Shatt el-Arab River holds a significant role in providing nutrients to the NW ArabianPersian Gulf. [4] studied the spreading and mixing of Arabian-Persian Gulf Water in the
thermocline of the Arabian Sea based on a bimonthly climatology of temperature and
salinity. Using oceanographic data and a dynamic model [5], studied the structure of the
Arabian-Persian Gulf outflow subjected to density variation They found that, the variability
of the outflow structure may reflect the changing ecosystem of the Arabian-Persian Gulf.
Nutrients salts, inorganic and organic contents in the waters of the Arabian-Persian Gulf
and the Gulf of Oman have been studied based on data collected during the period
February-March 1987[6]. The present study is an attempt to compute the balance of water,
nitrogen and phosphorus in the Persian Gulf based on the study of the movement of the
major masses in the Gulf.
MATERIALS AND METHODS
The temperature, salinity and nutrients data used in this study were taken from the
published scientific literatures and the NOAA Ship Mt. Mitchell expedition carried out
during the period February-June 1992. The Mt. Mitchell expedition conducted a 100-day
multi-disciplinary oceanographic research investigation in the Arabian-Persian Gulf and
focused on the fate and effects of the 1991 Gulf War oil spills on the region's marine
environment. The expedition was sponsored by the Intergovernmental Oceanographic
Commission (IOC), Regional Organization for the Protection of the Marine Environment
(ROPME), United Nations Environmental Programme (UNEP), U.S. National Oceanic and
Atmospheric Administration (NOAA) and the Marine Spill Response Corporation (MSRC).
The data collected from the 3 joint ROPME-Japanese Umitaka-Maru cruises carried out
during 1993-1994 are also used in the present study. Nutrient salts (NH4, NO2, NO3 and
PO4) were determined according to methods described by [7] [8] [9].
Circulation pattern of Arabian-Persian Gulf water
For a quantitative assessment of the water budget in the Arabian-Persian Gulf it is necessary
to make estimate of the amount of water circulating through it. The estuarine circulation
exchanges water between the Arabian-Persian Gulf and the Gulf of Oman via the Strait of
Hormuz. Up to now, the circulation in and out of the Strait of Hormuz has been poorly
studied. According to both Hunter's schematic circulation model [10] and that proposed by [1]
for the Arabian-Persian Gulf (Fig. 2), the flow is predominantly density driven with surface
flow inward from the Strait of Hormuz and adjacent to the Iranian coast. A southward
coastal flow is present along with entire southern coast of the Gulf. The flow stagnates east
of Qatar, where high evaporation and sinking forms a dense, bottom flow to the northeast
and out of the Strait of Hormuz.
Circulation in the Gulf of Oman is dominated by a clockwise gyre in the west and a
counter-clockwise gyre in the east. The interface between the two counter-rotating gyres is
a region of upwelling along the Iranian coast. The circulation pattern seems to exist in
winter and summer, but its strength and the upwelling depend on prevailing winds.
Figure 2: Schematic of surface currents and circulation processes[1]
Water fluxes and salinity in the experimental area
On the basis of the water and salt budgets in the Arabian-Persian Gulf, under conditions that
there are not any eustatic changes of bottom configuration, and that the bottom water layer
is more or less of uniform thickness, it is possible to write the box model equations as
follows:
1S1V1   2 S 2V2
V1 + R = V2+ (E-P)
;
(1)
(2)
Where P denotes precipitation, E evaporation, R river discharge, V1 volume transport
through the Strait of Hormuz from the Gulf of Oman and V2 volume transport to the Gulf
of Oman.
The Arabian-Persian Gulf experience evaporation rate of 1.5-2 m/year[11] [12] [13] [14] [1] [15];
that exceed by far the net freshwater input by precipitation[16] and river discharge. Few
attempts have been made to estimate evaporation from different zones of the ArabianPersian Gulf using different techniques. [11], calculated evaporation from the open water of
the Gulf area as 144 cm/yr. [13 ]estimated evaporation from coastal water of the central
region of the Gulf using the [17] formula, as 201.6 cm/yr. Accordingly, evaporation from the
whole Gulf area may be taken as the mean of the two above mentioned values i.e. 172
cm/yr. The amount of the annual precipitation on the Gulf area fluctuated considerably but
the average precipitation over a period of 17 years is 78 mm/yr [18], which corresponds to
0.0006 Sv (1Sv=106 m3/sec). Most river inflow into the Arabian-Persian Gulf occurs in the
north (Tigris, Euphrates and Karun) and primarily on the Iranian side. The total river runoff
is 0.003 Sv, equivalent to 46 cm/yr of depth [1].
This means that the Gulf area losses 0.013 Sv of fresh water through evaporation while it
gains 0.004 Sv from the runoff and \precipitation. Thus there is a net loss of fresh water
from the Gulf of about 0.009 Sv which must be compensated for by a flow of surface water
from the Gulf of Oman through the Strait of Hormuz. According to the outline of water
circulation in the Arabian-Persian Gulf (Fig. 3), throughout the year, relatively low-salinity
water (37) enters the Gulf through the Strait of Hormuz (V1) to freshen the hyper saline
Gulf water caused by evaporation and eventually sinks and exits the Gulf as a high-salinity
(41) undercurrent through the deeper portion of the Strait of Hormuz. This bottom layer
occupies a thickness as much as 60% of the entire cross section in the southern half of the
Strait and consists of outgoing water (V2) from the Arabian-Persian Gulf [19], with an
average salinity of 41. The Strait of Hormuz has a mean depth of 100 m, i.e. the thickness
of the incoming water is of about 40m.
Figure 3: Density-driven circulation of the Arabian-Persian Gulf[10]
Based on the water and salt budgets equations (1) and (2) together with the same resulting
water deficit, V1 and V2 could be computed as 0.088 Sv and 0.079 Sv respectively
(Diagram 1).
Diagram 1: Annual mean calculated fluxes in the Arabian-Persian Gulf based on salinity variations in
the Strait of Hormuz
The calculated inflow and outflow fluxes using the water and salt budgets equations are in a
good agreement with the results obtained by [20].
Nutrients balance
In general, nutrients show a large variation in the Arabian-Persian Gulf[21]. The present data
indicated that, nutrient salts of the inner part of the Arabian-Persian Gulf water is
characterized by NO2 (0.01-1.58 µmole/l), NO3 (0.07-10.08 µmole/l), NH4 (0.32-2.42
µmole/l) and PO4 (0.02-28.0 µmole/l). In the western area of the Gulf, nutrient
concentrations fluctuate considerably, but are generally higher in interior bays than in near
shore and offshore waters.
The inflowing surface water from the Gulf of Oman exhibited the levels of NO 2 (0.10-0.89
µmole/l, mean 0.46 µmole/l), NO3 (0.10-5.22 µmole/l, mean 2.04 µmole/l), NH4 (0.70-2.05
µmole/l, mean 1.20 µmole/l) and phosphorus (0.36-0.65 µmole/l, mean 0.50 µmole/l). The
bottom water outflow from Arabian-Persian Gulf characterized by NO2 (0.29-0.94 µmole/l,
mean 0.62 µmole/l), NO3 (0.96-4.82 µmole/l, mean 3.10 µmole/l), NH4 (0.74-2.11 µmole/l,
mean 1.32 µmole/l) and phosphorus (0.37-0.51 µmole/l, mean 0.47 µmole/l).
Nutrient concentrations around Oman vary seasonally according to the monsoon system.
For example, in areas of intensive upwelling during the south-west monsoon, nitrate levels
sire from 5 to 20 mg m3 at NO3 m3 and phosphate values to 1.5-2.5 at PO4 m3. These values
are three to five times greater than the winter, non-upwelling values[22].
The concentration of nitrate, nitrite and total phosphorus in the river water discharged
through Shatt al-Arab are 26.12-52.39 µmole/l, 0.53-0.70 µmole/l and 0.18-0.70 µmole/l
respectively, indicating that these rivers should be considered a source of nutrients to the
Arabian-Persian Gulf[3]. Owing to the dilution the impact of the Shatt el-Arab Rivers as a
source of nutrients seems to be confined to the NW region of the Arabian-Persian Gulf.
The nutrient salt budget in the Arabian-Persian Gulf is written as follows:
NDR+NPP+NiVi+NoVo = 0
(3)
Where, NR denotes the concentration of nutrients in the river water, N P that of rain, Ni that
of the inflowing water and No that of the outflowing Gulf water through the Strait of
Hormuz.
Because of the lack of information about the nutrient concentrations in the rain over the
Gulf area, the load of nutrients and phosphorus discharged to the Gulf through rainfalls will
not taken into consideration in the present study. Phosphorus released from the bottom
sediment and burial flux to the sediment are not considered in this budget.
The nutrient load of the nitrogen and phosphorus from Shatt el-Arab Rivers are estimated to
be 125.2 and 5.3 tons/day respectively. The nutrient and phosphorus budgets are shown in
Diagram 1. The amount of nitrogen load transported to the Arabian-Persian Gulf from Gulf
of Oman through the Strait of Hormuz is 395.6 tons/day, while the out flowing nitrogen
load is 483.8 tons/day.
Using the same equation (3) for calculating the phosphorus budget, we can find that the
load from rivers is estimated to be 5.3 tons/day. The amount of phosphorus transported to
the Arabian-Persian Gulf from Gulf of Oman through the Strait of Hormuz is 119 tons/day,
while the out flowing phosphorus load is 98 tons/day (Diagram 1).
CONCLUSION
The total evaporation from the Arabian-Persian Gulf Area amounted to 0.013Sv of which
0.006 Sv returned to the area in the form of precipitation and 0.003 Sv in the form of land
runoff. The computed ingoing water from the Gulf of Oman to the Gulf area through the
Strait of Hormuz and the outgoing water based on the salinity measurements were 0.088 Sv
and 0.079 Sv respectively. Nitrogen and phosphorus transported to the Arabian-Persian
Gulf area from Shatt el-Arab Rivers are 125.2 and 5.3 tons/day, while 395.6 and 119
tons/day enters to the area from Gulf of Oman through the Strait of Hormuz respectively.
The amount of nitrogen and phosphorus loads transported out of the Arabian-Persian Gulf
through the Strait of Hormuz with the bottom current is 483.8 and 98 tons/day. The outflow
carries the Arabian-Persian Gulf water into the Oman Sea water, and if it changes in terms
of marine pollution, particularly as the Gulf water is prone to oil pollution, it will change
the ecosystem of those waters. Bower et al (2000) found that, the depth of the outflow near
the Strait of Hormuz dose not change during the year. As the outflow enters into the open
sea in the Gulf of Oman it sinks and forms a warm salty water intrusion. The main depth of
the outflow is at about 250m with the outflow between 200 and 500m, especially for
summer (Bidokhti and Ezam, 2009). More extensive measurements and high resolution
numerical models are required to find the structure of inflowing and outflowing waters
through the Strait of Hormuz and the open sea affected by the outflow.
REFERENCES
[1] Reynolds R M. 1993. Physical oceanography of the Gulf, Strait of Hormuz and the Gulf of Oman: Results
from the MT. Mitchell Expedition. Mar. Poll. Bull., 27:35-59.
[2] Brewer P, Dyrssen D. 1985. Chemical oceanography of the Persian Gulf. Prog. Oceanogr., 14:41-55.
[3] Abaychi J K, Darmoian S A, DouAbul A A Z. 1988. The Shatt al-Arab River: A nutrient salt and organic
matter source to the Arabian Gulf. Hydrobiologia, 166: 217-224.
[4] Prasad T G, Ikeda M. 2001. Seasonal spreading of the Persian Gulf Water mass in the Arabian Sea. J.
Geophys. Res., 106(C8): 17059-17071.
[5] Bidokhti A A, Ezam M. 2009. The structure of the Persian Gulf outflow subjected to density variations.
Ocean Sci., 5: 1-12.
[6] Emara H I. 2011. Nutrient salts, inorganic and organic carbon contents in the waters of the Persian Gulf
and the Gulf of Oman. J. of Persian Gulf Marine Science, 1(2): 33-44.
[7] Grasshoff K. 1976. Methods of Seawater Analysis. Weinheim, New York: Varlag Cheine, 317p.
[8] Grasshoff K, Johannsen H. 1973. A new sensitive and direct method for the automatic determination of
ammonia in seawater. J. du Conseil International pour l'Exploration de la Mer, 34(3): 516-521.
[9] Koroleff F. 1983. Determination of phosphorous. In: Grasshoff, K., Ehrhardt, M. and Kremling, K.
(Editors). Methods of Seawater Analysis. Weinheim, New York: Varlag Cheine, 125-139.
[10] Hunter J R. 1983. Aspects of the dynamics of the residual circulation of the Arabian Gulf. In: Coastal
Oceanography, edited by: Gade, H.G. Edwards, A. Svendsen, H. Plenum Press, 31-42.
[11] Privett D W. 1959. Monthly charts of evaporation from the North Indian Ocean, including the Red Sea
and the Persian Gulf. Q.J.R. Meterol. Soc., 85:424-428.
[12] Hastenrath S, Lamb P J. 1979. Climatic atlas of the Indian Ocean. Part 2: The ocean heat budget. Univ. of
Wisc. Press. Madison, Wisconsin.
[13] Meshal A H, Hassan H M. 1986. Evaporation from the coastal waters of the central part of the Gulf. Arab
Gulf J. Sci. Res., 4 (2): 649-655.
[14] Ahmed F, Sultan S A R. 1991. Annual mean surface heat fluxes in the Arabian Gulf and the net heat
transport through the Strait of Hormuz. Atmos. Ocean., 29: 54-61.
[15] Bower A S, Hunt H D, Price J F. 2000. Character and dynamics of the Red Sea and Persian Gulf
outflows. J. Geophys. Res., 105(C3): 6387-6414.
[16] Johns W E, Yao F, Olson D B, Josey S A, Grist J P, Smeed D A. 2003. Observations of seasonal
exchange through the Strait of Hormuz and the inferred freshwater budgets of the Persian Gulf. J.
Geophys. Res., 108(C12): 3391, doi: 10.1029/2003JC001881.
[17] Esbensen S K, Reynolds R W. 1981. Estimating monthly average air-sea transfers of heat and
momentum using the bulk aerodynamic method. J . Phys. Oceanoger., 11:457-465.
[18] Hassan E M, Hassan H M. 1989. Contribution of the tides and of the excess evaporation to the water
budget between the Arabian Gulf and the Gulf of Oman. Arab Gulf J. Scien. Res., Math phys. Sci.,
A7 (1): 93-109.
[19] Sonu C J. 1979.oceanographic study in the Strait of Hormuz and over the Iranian Shelf in the Persian
Gulf, final report, contract NOOO 14-76-C-0720, TC 3675, U.S. Off. of Naval Res., Washington,
D.C.
[20] ROPME 1988. Marine monitoring and Research Programme in ROPME Region: Assessment of the
Oceanography of the ROPME Sea Area (Summary report by Cruzado), 27p.
[21] Sheppard C V, Prica A R G, Roberts C. 1992. Marine Ecology of the Arabian Region. In: Patterns and
Processes in Extreme Tropical Environments. United Kingdom, 359p.
[22] Barnet L, Ormond R F C, Wruthall T. 1986. Ecology and Productivity of the sublittoral Algae Ecklonia
radiate and Sargassopsis zanardini. Part 1, Ecological Studies of the Southern Oman Kelp
communities. Council for the Conservation of the Environment and water resources, Muscat, Oman
and Regional Organization for the Protection of the Marine Environment, Kuwait, 2.1-2.2.
The Status of the Cartilaginous Fish Species in the Lebanese Coastal Waters
The status of the cartilaginous fish species in the Lebanese coastal waters
Myriam Lteif1,2,3, Gaby Khalaf1, Marion Jarraya2,3, Rita Mouawad1 and Philippe Lenfant2,3
1
National Center for Marine Sciences-CNRSL
2
Université de Perpignan Via Domitia - Centre de Formation et de Recherche sur les Environnements
Méditerranéens (CEFREM) UMR 5110, 52 Avenue Paul Alduy, 66860, Perpignan, France
3
CNRS, Centre de Formation et de Recherche sur les Environnements Méditerranéens, UMR
9 5110, 52 Avenue Paul Alduy, 66860, Perpignan, France
SUMMARY
The aim of this study is to contribute to a better knowledge of cartilaginous fishes in the Lebanese coastal
waters, eastern Mediterranean. Emphasis was placed on various aspects of the ecology of these species and
fishing characteristics. In this study 225 specimens of cartilaginous fish were sampled by three different
manners: scientific survey, fisheries sampling and experimental fishing with fishermen. These specimens
caught included 25 cartilaginous fish species, 11 shark species and 14 batoid species. No chimeras were
sampled. The majority of the sharks sampled were Centrophorus granulosus, Galeus melastomus, Squalus
blainvillei, Mustelus mustelus and Carcharhinus obscurus. The majority of the batoids sampled were
Rhinobatos rhinobatos, Rhinobatos cemiculus, Torpedo marmorata, Torpedo nobiliana, Raja miraletus and
Raja clavata. These cartilaginous fish specimens were caught at depths ranging from 10 to 600 m majorly
using longlines, then trammel nets and the least were caught using gillnets. Moreover, 66.7% of all
individuals were observed at depths less than 150 m, 18.2% were observed at depths ranging from 150 to 400
m, and 10.6% were observed at depths ranging from 450 m to 600 m. In addition, demersal species, such as,
Raja clavata¸ Raja miraletus, Torpedo marmorata¸ and Torpedo nobiliana were principally caught by
trammel nets, whereas, Rhinobatos rhinobatos and Rhinobatos cemiculus were only caught by longlines, and
species such as Squatina oculata, Squatina aculeata, Mustelus mustelus, and Isurus oxyrhincus were only
caught by gillnets. Finally, the batoid species Rhinobatos rhinobatos and Rhinobatos cemiculus, the shark
species Hexanchus griseus, and sharks from the Carcharhinidae family showed high commercial significance
in Tripoli (northern of Lebanon) and in Sidon (southern of Lebanon).
Key words: cartilaginous fish, sharks, batoids, Lebanon, eastern Mediterranean
INTRODUCTION
The Mediterranean basin is known for its high biodiversity: nearly one third of the
Mediterranean fauna is endemic; in fact, the loss and destruction of habitats through the
development of coastal infrastructure, pollution, invasion of exotic species and
overexploitation has constituted high risk causes of species extinction in the Mediterranean
[1]. The Mediterranean Sea has been inhabited for a long time, and ecosystems have
changed in many ways. Thus, anthropogenic impacts are stronger in the Mediterranean than
in any other sea of the world [2]. The coasts hold a high density of inhabitants. More than
one percent of world landings come from Mediterranean fisheries and combined natural and
anthropogenic events shaped the biodiversity of the Mediterranean Sea in the past and will
continue to do so in the future [3]. The Mediterranean is known to hold a high diversity of
cartilaginous fish and many very important habitats are threatened nowadays. Over the last
200 years, the cartilaginous fishes of the Mediterranean have decreased and are in risk of
extinction if the pressure of fishing is maintained [4]. The Mediterranean Sea, is
characterized by a quite high diversity of elasmobranches species with 49 sharks and 36
rays species found in its waters [5], with three endemic species, among which one is
endemic threatened [6]. Bradai, et al. [5] stated that elasmobranches are considered as a
significant by-catch of commercial fisheries that target bony fishes, fisheries targeting
sharks are scarce; however, almost all specimen by-catch are marketed. Among 85 species
of cartilaginous fish known in the Mediterranean, 71 were assessed in the frame of the
International Union for Conservation of Nature (IUCN) red list. More than 40% are
vulnerable and endangered to critically endangered [7]. Their low fecundity, late maturity
and slow growth rates make them vulnerable to fishing [8]. Thus, fishing activity exerted on
elasmobranch populations is responsible for the reduction of their abundance [9]. They can
be caught by diverse fishing methods although bottom trawling is considered responsible
for a large amount of elasmobranch by-catches and discards throughout the world [10].In
the Mediterranean Sea, elasmobranch catches represent 1.1% of the total landings [11].
Located in the Eastern part of the Mediterranean, Lebanon is known for the richness of its littoral,
which extends along 220 km of coastline and has been a reference for the Mediterranean fishermen
for a long time. This reputation has slowly disappeared in the past years due to pollution and
questionable techniques [12]. The Lebanese fishery is artisanal and traditional [12, 13]. The most
common gear used includes trammel nets, longlines, ‘roundhaul’ nets and beach seines. Trawling is
legally forbidden although fishing nets with illegal mesh sizes are widely available in the black
market [13]. Only few vessels have a Global Positioning System (GPS), while the rest have very
limited navigational or safety equipment, with 20% of the vessels having small electronic fish
finders [12, 14]. The marine fisheries production in Lebanon from 2000 to 2010 was around 3,500
tons per year [15]. The majority of the fish caught are bony fish [12] and cartilaginous fish landings
are particularly low [13].
A lot of studies were performed on cartilaginous fish in the eastern Mediterranean with more than
100 papers ranging from the coast of Alexandria –Egypt in the South, passing through the coast of
Israel, Syria, Turkey and reaching the Adriatic Sea in the North [5], with an inventory established in
Syria in 2003 [16] reflecting the presence of cartilaginous fish species along these coasts.
No studies of these species were performed in Lebanon and along the Lebanese coastal waters;
however, cartilaginous fish species were mentioned in the inventory about fish in Lebanon and in
the eastern Mediterranean by field work performed between 1973 and 1983 [17]. This fact makes
this study one of its kind in Lebanon with emphasis on its importance in pointing out the
cartilaginous fish species in the Lebanese coastal waters by creating a recent inventory and
obtaining an estimation of the relative abundance and spatial distribution. This study provides a first
evaluation of the cartilaginous species diversity in this area.
Study area
The study area is located in the Eastern part of the Mediterranean in Lebanon. A total number of 35
ports are distributed along the Lebanese coast. The majority of these ports do not comply with the
technical conditions for the improved development of the sector whether with respect to equipment
or management. The largest fishing ports are distributed according to the governorates as follows:
Aabdeh, Tripoli and Batroun ports in the North, Dawra Port in Mount Lebanon, Ozaaii Port in
Beirut, and Tyr and Sidon Ports in the South [12].
Sampling
Throughout year 2013, from January until October 2013, data collection targeting all cartilaginous
species all along the Lebanese coast has been performed.
This data collection has been performed at random sites along the coast from North to South in three
different manners.
i.
Data collection was aided by the CIHEAM PESCA-Libano project. This project assessed
the potentiality of the marine coastal resources in order to support the Lebanese
Government in strengthening the management of the marine resources with the involvement
of the Ministry of Agriculture and the National Center for Marine Sciences – Lebanese
National Council for Scientific Research (CNRSL). In 2013, three types of gears were
lowered in 65 different sites along the coast of Lebanon and at depths ranging from 10 to
600 m. Gillnets with mesh sizes of 26, 30 and 40 mm were lowered at depths less than 100
m; trammel nets with mesh sizes of 22, 24, 26, and 28 mm were lowered at depths greater
than 100 m. Long lines were lowered at randomly specified depths.
ii.
Data collection has also been performed by randomly hiring fishermen throughout the
Lebanese coast with the collaboration of the Lebanese National Council for Scientific
Research (CNRSL) - National Center for Marine Sciences - to lower longlines at depths
ranging from 30 to 600 m aiming to catch cartilaginous species.
iii.
Data collection has also been performed through observation of major fisheries along the
Lebanese coast. The main fishery visited was a principal one in Tripoli where 52 specimens
were collected. Other fisheries were visited a minimum number of 5 times per month, and
data were collected when specimens were available.
The specimens collected by all three manners of collection were either identified and dissected on
the site of collection, whether on a port or in a fishery, or preserved in ice and brought to the
laboratories of the National Center for Marine Sciences in Batroun and placed in freezer to be later
treated.
In this study data where explored though barplot and boxplot. In the boxplot, the upper whisker
extends from the hinge to the highest value that is within 1.5 * IQR of the hinge, where IQR is the
inter-quartile range, or distance between the first and third quartiles. The lower whisker extends
from the hinge to the lowest value within 1.5 * IQR of the hinge.
100
A total of 225 specimens were collected during the sampling period; these specimens comprised 25
species, 11 sharks and 14 batoids. No chimaeras were collected. These findings correlate with these
obtained by Mouneimné [17] and Ali [16]. However, more species (39) were observed by the latter
due to the fact that more gears were employed, such as, trawlers that are legally prohibited in
Lebanon. Cartilaginous fish species were present all along the coast from Tripoli in the North to Tyr
in the South, which indicates a wide distribution of these fishes throughout the Lebanese coast.
The depths of distribution ranged between 0 and 600 m with the greatest number of individuals
observed at depths less than 50 m; individuals were observed at depths ranging from 100 to 250 m,
with fewer individuals at greater depths (600 m). No individuals were caught at depths ranging from
300 to 450 m (Figure 1). This can be attributed to the fact that the majority of the fishing operations
by longlines and gillnets were conducted at these depths.
In addition, more batoids were caught than sharks, where the majority of caught or observed species
were R. rhinobatos, R. miraletus, T. marmorata and R. cemiculus with a total of 42, 30, 22 and 21
individuals respectively. C. granulosus dominated the shark catches or observations with a total of
30 individuals. Nevertheless, some species, such as, S. aculeata, S. oculata, I. oxyrhincus, H.
griseus, D. tortonesei, G. melastomus and D. licha were only noted once (Figure 2).
60
40
55
27
20
Number of individuals
80
87
12
11
0
0
0
10
7
100
200
0
300
0
10
0
400
500
600
Depth (m)
Figure 1: The number of individuals caught according to depth classes from 0 to 600 m in 2012-2013
Moreover, knowing that trawling is prohibited in Lebanon, the main gears used for fishing are
gillnets, trammel nets and longlines. Whether according to the CIHEAM PESCA-Libano project or
the expeditions performed by hired fishermen and the observations in fisheries, cartilaginous fish
were observed to be principally caught by longlines and then trammel nets; gillnet catches were the
least. This can be attributed to the fact that longlines are majorly used by the Lebanese artisanal
fishermen to catch demersal species, such as, R. rhinobatos and R. cemiculus (Figure 2) that are of
commercial importance in some of the fisheries in Lebanon.
Number of individuals
40
30
Gillnet
Longlines
20
Trammel Net
10
T. nobiliana
T. marmorata
S. oculata
T. grabata
S. aculeata
S. blainvillei
R. miraletus
R. rhinobatos
R. clavata
R. cemiculus
P. bovinus
P. violacea
M. mustelus
I. oxyrhincus
H. perlo
H. griseus
G. altavela
G. melastomus
D. tortonesei
D.oxyrinchus
D. pastinaca
D. oxyrinchus
D. licha
D. marmorata
C. obscurus
C. granulosus
0
Species
Figure 2: The number of individuals of each species caught by the different gears used in this study in
2012-2013
Furthermore, demersal species, such as, R. clavata¸ R. miraletus, T. marmorata¸ and T. nobiliana
were principally caught by trammel nets (Figure 2). This correlates with the findings in the Aegean
Sea where elasmobranchs (mainly Rajidea) represent 6% to 10% by weight of total catches of
trammel [18]. Moreover, monitoring of fisheries in the Balearic Islands shows the capture of 12
elasmobranch species (10 sharks and 2 rays) representing 10% in abundance and 28 % in biomass of
the total catch of trammel nets. The most common species were D. pastinaca, R. radula and T.
marmorata representing respectively 48%, 24% and 15% of catches of elasmobranchs [19].
Moreover, the gears that caught the larger individuals were longlines, then gillnets, and then
trammel nets; nevertheless, more individuals were caught using longlines, then trammel nets, and
then gillnets (Figure 3).
Figure 3: A barplot (top) and boxplot (bottom) representing the number and total lengths, respectively,
of individuals caught by the different gears used in this study in 2012-2013 (For boxplot: black line in
box = median; points in box = mean for each gear; points outside box = outliers).
In addition, according the observation of fisheries, cartilaginous fish were majorly observed in the
fishery in Tripoli, where they were found to have an important economic value as they were bought
as food in that region. The same was observed in Sidon, southern Lebanon. However, in the utmost
south, Tyr, these fishes did not have a significant economic value. The species Rhinobatos
rhinobatos, Rhinobatos cemiculus, and Centrophorus granulosus and Carcharinus obscurus were
shown to have a great economic value in the fisheries in Lebanon, as they were shown to be sold in
large quantities as fish filets. Moreover, Taeniura grabata, Hexanchus griseus and Dasyatis sp.
were also observed, but with a less economic value.
ACKNOWLEDGMENTS
This work was supported by CANA-Project/CNRSL
CONCLUSION
This study is the first reflecting the actual presence of cartilaginous fish species along the Lebanese
coast. Moreover, this study also shows the exploitation of such species through by-catch or targeted
fishing. These fish species are exploited by longline fisheries; hence, laws should be implemented to
limit the fishing of cartilaginous fish. More studies should be performed dealing with the population
biology of the majorly exploited and endangered cartilaginous fish along the Lebanese coast in
order to apply management measures to prevent the vast exploitation of this fish group.
REFERENCES
[1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
A. Cuttelod, N. García, D. A. Malak, H. Temple, and V. Katariya, "The Mediterranean: A
biodiversity hotspot under threat," IUCN Switzerland2008.
J. Blondel and J. Aronson, Biology and Wildlife of the Mediterranean Region: Oxford University
Press, 1999.
M. Coll, C. Piroddi, J. Steenbeek, K. Kaschner, L. B. R. Lasram, J. Aguzzi, et al., "The Biodiversity
of the Mediterranean Sea: Estimates, Patterns, and Threats," PLoS ONE, vol. 5 2010.
F. Ferretti, R. A. Myers, F. Serena, and H. K. Lotze, "Loss of large predatory sharks from the
Mediterranean Sea," Conservation Biology, vol. 22, pp. 952 – 964, 2008.
M. N. Bradai, B. Saidi, and S. Enajjar, "Elasmobranchs of the Mediterranean and Black sea: status,
ecology and biology," General Fisheries Commission for the Mediterranean, Rome2012.
N. K. Dulvy, S. L. Fowler, J. A. Musick, R. D. Cavanagh, P. M. Kyne, L. R. Harrison, et al.,
Extinction risk and conservation of the world’s sharks and rays vol. 3, 2014.
R. D. Cavanagh and C. Gibson, "Overview of the conservation status of cartilaginous Fishes
(chondrichthyans) in the Mediterranean Sea," 2007.
J. D. Stevens, R. Bonfil, N. K. Dulvy, and P. A. Walker, "The effects of fishing on sharks, rays, and
chimaeras (chondrichthyans), and the implications for marine ecosystems," ICES Journal of Marine
Science: Journal du Conseil, vol. 57, pp. 476-494, June 1, 2000 2000.
N. K. Dulvy, J. D. Metcalfe, J. Glanville, M. G. Pawson, and J. D. Reynolds, "Fishery stability, local
extinctions, and shifts in community structure in skates," Conservation Biology, vol. 14, pp. 283-293,
2000.
R. Bonfil, "Trends and patterns in world and Asian elasmobranch fisheries," in Proceedings of the
International Seminar and Workshop Sabah, Malaysia, 1997, pp. 15 - 32.
F. Serena, Field identification guide to sharks and rays of Mediterranean and Black Sea. Rome: FAO
Species Identification Guide for Fisheries Purpose, 2005.
S. Majdalani, "The present status of fishery and information system in Lebanon," MedFisis 2004.
S. L. Fowler, Sharks, Rays and Chimaeras: The Status of the Chondrichthyan Fishes : Status Survey:
IUCN, 2005.
J. Sacchi and M. Dimech, "Report of the FAO EastMed assessment of the fishing gears in Lebanon,"
2011.
D. Pinello and M. Dimech, "Fishing fleet data for 2011," 2013.
M. Ali, "A qualitative, economical, and biological study of cartilaginous fish in Syrian marine waters
(Original text in Arabic)," Masters Thesis, Tishreen University, Syria, 2003.
N. Mouneimne, Poissons marins du Liban et de la Méditerranée Oriental, 2002.
K. I. Stergiou, D. K. Moutopoulos, and K. Erzini, "Gillnet and longlines fisheries in Cyclades waters
(Aegean Sea): species composition and gear competition," Fisheries Research, vol. 57, pp. 25–37,
2002.
G. Morey, J. Moranta , F. Riera, A. M. Grau, and B. Morales-Nin, "Elasmobranchs in trammel net
fishery associated to marine reserves in the Balearic Islands (NW Mediterranean)," Cybium, vol. 30,
pp. 125-132, 2006.
Population Dynamical Parameters of the Atlantic Lizardfish (Synodus saurus) from the
Mediterranean Waters of Egypt
Population dynamical parameters of the Atlantic lizardfish (Synodus
saurus) from the Mediterranean waters of Egypt
Sahar Fahmy Mehanna
National Institute of Oceanography and Fisheries, P.O. Box 182, Suez, Egypt
[email protected]
SUMMARY
This study was undertaken to assess the growth pattern, mortality and exploitation rates of the Atlantic
lizardfish (Synodus saurus Linnaeus, 1758) from the Mediterranean waters of Egypt. A total of 900
individuals S. saurus were collected monthly between May 2008 and May 2010, and found that the lengths
and weights range were 12-33.5 cm total length and 15-350 g, respectively. Length-Weight relationship was
W =0.0055 * L3.117 indicating positive allometric growth, while the von Bertalanffy growth constants in
length and weight were L∞ =38.61 cm, K =0.46 year-1, to = -0.11 year. It was also estimated that total
mortality was Z= 1.27 year-1 and its two components were M= 0.66 year-1, F= 0.61 year-1. When
exploitation rate was taken into account, it was found that the Atlantic Lizardfish was under exploited (E=
0.48 year-1) in the Egyptian waters of Mediterranean. Yield per recruit analysis demonstrated that there is a
probability to expand this fishery but before any action towards this purpose the commercial stocks exploited
by trawl fishery in the Egyptian Mediterranean should be assessed.
Keywords: Egypt, Atlantic lizardfish (Synodus saurus), von Bertalanffy growth model, mortality and
exploitation rates, yield per recruit.
INTRODUCTION
The Atlantic lizardfish, Synodus saurus (Linnaeus, 1758) is a demersal species belonging to
the family Synodontidae which commonly known as lizardfishes. Family Synodontidae is
found throughout the world and is distributed on the continental shelf waters of Red Sea
and coast of Africa, east to the Indo-Malayan region, south to Australia, north to southern
Japan, but also reported from the Maldives and Seychelles; has invaded the eastern
Mediterranean through the Suez Canal. S. saurus occurs in the eastern Atlantic from
Morocco to Cape Verde including Azores and the Mediterranean. Also, it is found in the
western Atlantic from the Bermudas and the Bahamas to the Leeward Islands (Sulak, 1990).
Atlantic lizardfish lives mostly on sandy bottoms and commonly found less than 50 m,
although reported once at 400 m (Sulak, 1986; Bauchot, 1987; Santos et al., 1997).
Comprehensive studies on the biology and ecology of this species are scarce, except for a
few studies on its reproduction and feeding habits (Fischer et al., 1987; Sulak, 1990; Golani
1993a&b, 2002; Kagiwara and abilhôa, 2000; Soares et al., 2002&2003).
As detailed information on biology and population characteristics of the Atlantic lizardfish
S. saurus is needed to develop strategies for its sustainable exploitation, the present study
was conducted to determine the growth constants, mortality and exploitation rates, stock
and biomass of this species inhabiting the coast of Egyptian Mediterranean. The results
from this study are expected to provide highly important information about how to manage
and develop this valuable fishery.
METHODOLOGY
Methods Study area
The Mediterranean is one of the most important enclosed seas in the world with a large
shipping circulation. It is a large saline water body between Europe, North Africa and Asia,
connected to the Atlantic Ocean in the west through the Strait of Gibraltar; the Black Sea
in the northeast through the Dardanelles, Sea of Marmera and Bosporus; and to the Red Sea
in the southeast through the man-made Suez Canal (Hogan, 2013).
The Egyptian Mediterranean coast is about 1,200 km extending from El-Salloum in the
West to El-Arish in the East (Fig. 1). The fishing grounds along the Egyptian Mediterranean
coast are divided into four regions namely; Western region (Rasheed, Alexandria and ElMex, Abu-Qir, El-Maadiya, Mersa Matrouh and El-Salloum), Eastern region (Port Said and
El-Arish), Demietta region and Nile Delta adjacent region. The main fishing gears operated
in this area are trawling, purse - seining and lining especially long and hand lining. Atlantic
lizardfish were collected from the area between Rasheed and El-Salloum with the majority
from El-Salloum (65% of the sample weight).
Figure 1: Map of Egyptian Mediterranean coast
Sampling
A total of 900 specimens were collected monthly between May 2008 and May 2010, each
individual fish was measured to the nearest millimeter total length TL and weighed with a
precision of 0.01g for total weight W. Otoliths were extracted and stored for age
determination. In 2008, the samples were collected during the bottom trawl surveys covered
the whole Egyptian Mediterranean using the NIOF RV Salsabil, while in 2009 and 2010 the
samples were collected from the commercial catch.
Methods
The LWR was calculated using the formula W=aLb, where „a‟ is constant proportionality
and „b‟ is regression coefficient which were estimated by the least squares regression
method. The growth type was identified by Student‟s t-test using the SPSS computer
program (Cicek et al., 2006).
Aging was determined through sagittal otoliths (Holden and Raitt, 1974). Age groups were
formed and mean length and weight values for each age group were calculated.
To evaluate growth, back-calculated lengths-at ages were fitted to the von Bertalanffy
growth model (Ricker, 1975). Gulland and Holt (1959) plot was applied to estimate the von
Bertalanffy growth parameters (L∞ and K).
Empirical estimates of length at maximum possible yield (Lopt) and mean length at first
maturity (Lm) were made based on L∞, following Binohlan and Froese (2009).
Natural mortality (M) was calculated as the geometric mean for three independent
estimates: Royce (1972) method as M = 4.6/(tmax)
Hoenig (1983) equation as
ln(M) = 1.44 – 0.982 ln(tmax)
Pauly (1983) formula as Log M = -0.0066 – 0.279 log L∞ + 0.6543 log K + 0.4634 log T
Where, L∞ and K are the VBGF parameters, T the mean environmental temperature
(22.5oC during this study) and tmax is the oldest aged fish in the sample.
For estimation of total mortality (Z), length-converted catch curves were developed from
the length frequencies (Gayanilo et al., 2005) as well as the catch curve of Ricker (1975)
were applied.
The exploitation ratio (E) was computed from E = F ⁄ Z,
where F is the fishing mortality (F = Z–M), while the exploitation rate was estimated as
U = (F/Z) * (1-e-Z)
In order to compare different estimates of growth parameters, the phi-prime test was used
(Ø = log k + 2 log L∞).
The midpoint of the smallest length group in the catch was taken as length at recruitment
(Lr). Length at capture (L50) was estimated by probability of capture routine in the FiSAT-II
package. The probability of capture was approximated by backward extrapolation of the
regression line of descending limb of length converted catch curve (Pauly, 1987).
Total stock (P) and biomass (B) were estimated from the ratios Y/U and Y/F respectively;
where Y is the annual average yield in tons. Maximum sustainable yield was calculated by
the equation for exploited fish stocks given by Gulland (1979) as MSY = Z x 0.5 x B.
Since both male and female Atlantic lizardfish share the same fishing ground and are
exposed to same fishing method, it is impracticable to manage the fishery separately and
hence the pooled data was used for stock assessment study. The relative yield per recruit
(Y‟/R) and relative biomass per recruit (B‟/R) at different fishing levels were estimated by
FiSAT II package using relative yield per recruit analysis method (Beverton and Holt,
1966).
Length-Weight relationship LWR
Analysis of residual sums of squares indicated no significant difference between the sexspecific length-weight relationships of S. saurus in the Egyptian Mediterranean (df = 2, F =
0.019, P > 0.05); consequently a power regression was applied to the length-weight data of
all individuals combined (Fig. 2). The total length varied from 12 to 33.5 cm while the total
weight ranged between 15 and 350 g and the resultant equation was: W = 0.0055 * L3.117
Allometric growth was observed for Atlantic lizardfish as the value of b was significantly
different from 3 (95% Confidence Interval = 2.8898 - 3.3442). The same finding was
recorded in the previous studies (Table 1).
The calculated weights by age groups were 29.73, 108.99, 224.54 and 293.36 g for the 1st,
2nd, 3rd and 4th year of life, respectively. The growth rate in weight was much slower during
the first year of life, and then the annual growth increment in weight increased reaching its
maximum at the end of the third year of life (Fig. 3).
Table 1: Length-weight parameters for Synodus saurus in different localities
Locality
Length range
a
b
Author
Greece
16.0 – 39.6
0.0200
2.715
Stergiou and Moutopoulos, 2001
Turkey
10.7 – 31.0
0.0073
3.024
Cicek et al., 2006
Spain
16.0 – 37.3
0.0040
3.190
Merella et al., 1997
Egypt
12.8 – 25.2
0.0030
3.320
Abdallah, 2002
Egypt
12.0 – 33.5
0.0055
3.117
The present study
Figure 2: Length-weight relationship of Synodus saurus from Egyptian Mediterranean
Figure 3: Growth in weight of Synodus saurus from Egyptian Mediterranean
Age and Growth in length
Age distribution was obtained from 900 Atlantic lizardfish which are given in Table 2. The
mean lengths at age were back-calculated for S. saurus as 15.76, 23.91, 30.15 and 32.85 cm
for the 1st, 2nd, 3rd and 4th year of life, respectively. Observed lengths were consistently
higher than the back-calculated lengths-at age for individual age groups, which indicated
that seasonal growth had occurred since the formation of a new annulus. Differences
between back-calculated lengths-at-age and observed lengths are in the range of observed
seasonal growth (Table 2). No statistical difference was found between the calculated and
estimated length values (P > 0.05). The greatest incremental growth in length occurred
during the first year and then declined rapidly thereafter (Fig. 4).
Figure 4: Growth in length of Synodus saurus from Egyptian Mediterranean
Table 2: Mean back-calculated lengths of Synodus saurus from the Egyptian Mediterranean
Age
group
No. of fish
Empirical
length
I
II
III
IV
297
456
103
44
16.13
24.43
30.48
32.91
Back-calculated lengths (cm) at the
end of each year of life
1
2
3
4
15.76
15.55
23.91
15.48
23.83
30.15
15.33
23.70
30.05
32.85
Growth
increment
15.76
8.15
6.24
2.7
Population parameters
A likelihood ratio test (LRT) showed no significant difference between male and female
VBGFs growth curves. Back-calculated lengths of pooled data were applied according to
the Gulland and Holt (1959) plot to estimate the von Bertalanffy growth parameters (L and
K). The obtained equations were as follows:
o For growth in length
o For growth in weight
Lt = 38.61 (1 - e -0.46 (t +0.11))
Wt = 485.41 (1 - e -0.46 (t +0.11))3.117
The only work dealing with the estimation of growth parameters is that of Manasirh et al.
(2008) from Turkey. They gave L∞ = 36.09 cm, K= 0.153 per year and t 0= -1.8 year. This
difference is due to the difference in maximum observed length in samples and the
difference in age composition between the two areas. The growth performance index (Ø)
was 2.84 which was higher than that estimated for Turkey stock (2.3) indicating the better
conditions in the Egyptian Mediterranean for this species. Based on L∞ value, the estimated
Lopt and Lm were 26.12 and 18.8 cm respectively, while the length at recruitment Lr was 12
cm TL (smallest specimen in the samples) and the length at first capture Lc was 17.73 cm
TL (Fig. 5) which is smaller than Lm indicating un-suitable mesh sizes.
Figure 5: Probability of capture for Synodus saurus from Egyptian Mediterranean
The mean total mortality coefficient Z was estimated as 1.27 year -1 (Fig. 6). The natural
mortality coefficient M was 0.66 year-1, while the fishing mortality coefficient F was 0.61
year-1. Exploitation ratio E and exploitation rate U were computed as 0.48 and 0.35
respectively. Gulland (1971) suggested that the optimum exploitation rate for any exploited
fish stock is about 0.5, at Fopt = M. More recent, Pauly (1987) proposed a lower optimum F
that equals to 0.4 M. In the present study, F was in between the two values of F opt given by
Gulland (1971) and Pauly (1987) indicating that the stock of S. saurus in the Egyptian
Mediterranean is moderately exploited.
Figure 6: Total mortality estimates of Synodus saurus from Egyptian Mediterranean
Stock assessment : Estimation of stock and MSY
The estimated annual total stock, biomass and MSY of S. saurus were 1158, 656 and 416.4
ton, respectively. The estimated MSY is slightly higher than the current annual catch (400
ton) but it will be achieved at a higher fishing mortality (0.77) which not acceptable
considering the multispecies nature of the fishery and the overexploitation of most
economic species (Mehanna, 2007a&b; Mehanna et al., 2008; Mehanna, 2009a&b;
Mehanna and Fattouh, 2009; Mehanna and Haggag, 2010).
Yield per recruit
“Selection ogive” was used for the relative yield per recruit Y‟/R analysis of S. saurus as
“knife edge selection”. The analysis showed that maximum Y‟/R could be obtained at E max
of 0.61 suggesting scope for increase in exploitation rate (Fig. 7). However, the results
should be carefully evaluated since the analysis does not consider the spawning stock
biomass which is essential for maintaining the recruitment in the future (Clark, 1991) and
Emax usually corresponds to very low levels of B‟/R. Moreover,
S. saurus is a fast growing species which is characterized by higher natural mortality and
for such species the Emax may be unrealistically high (Gulland 1983; Pauly, 1984).
Therefore, it is recommended that exploitation should be reduced to a precautionary level
i.e., E0.1 (an effort level at which the marginal increase in yield per recruit reaches 1/10 of
the marginal increase computed at a very low value of E). Therefore, E max (0.61) and E0.1
(0.52) can be used as target reference points (TRP) for the maximum sustainable yield
(MSY) and maximum economic yield (MEY), respectively (Jakubaviciute et al., 2011). In
the present study, E0.1 was slightly higher than Ecur which indicates that the fishery is
running nearly at economic reference point (MEY). On the other hand, E0.5 which
represents exploitation rate at which B‟/R reduces by 50% compared to virgin stock, i.e., to
the level which theoretically maximizes surplus production (Pauly, 1984) can be used as a
proxy for the optimum sustainable yield (OSY) (Dadzie et al., 2005). In the present study,
the optimum biomass of S. saurus can be maintained at E0.5 of 0.34 whereas; Ecur is high
and depleting the B‟/R considerably. Due to the principle of uncertainty in stock
assessment, it is advisable to use precautionary management reference points such as SSBR
(20-30% of virgin stock) to prevent recruitment overfishing or E 0.5 which maintain 50% of
the spawning stock biomass.
Figure 7: Relative yield per recruit analysis of Synodus saurus from Egyptian Mediterranean
CONCLUSION AND RECOMMENDATIONS
It could be concluded that the Synodus saurus fishery in the Egyptian Mediterranean waters
is running nearly at economic reference point, but from the management point of view the
current exploitation level should be around E0.5. So it is recommended that the fishing effort
could be reduced by at least 25% of its current level to conserve the spawners, the relation
between the spawning stock and the recruitment should be established, as well as all
commercial stocks exploited by trawling should be assessed to propose a realistic
management plan for this multispecies fishery. In addition the fisheries statistics recording
system should be improved to give a real picture about the catch and effort statistics from
the Egyptian Mediterranean.
REFERENCES
Abdallah, M. (2002). Length-weight relationship of fishes caught by trawl off Alexandria, Egypt. Naga
ICLARM Q. 25(1): 19-20.
Bauchot, M.L. (1987). Poissons osseux. In: W. Fischer, M.L. Bauchot and M. Schneider (eds.), Fiches
FAO d‟identification pour les besoins de la pêche. (rev. 1). Méditerranée et mer Noire. Zone de
pêche 37, Vol. II., pp. 891-1421. Commission des Communautés Européennes and FAO, Rome.
Beverton, R. J. H. and Holt, S. J. (1966). Manual of methods for fish stock assessment: Part 2: Tables of yield
functions. FAO Fisheries Technical Paper/FAO Doc., 38: 67 pp.
Binohlan, C. and Froese, R. (2009). Empirical equations for estimating maximum length from length at first
maturity. Journal of Applied Ichthyology, 25(5): 611-613.
Cicek, E.; Avsar, D.; Yeldan, H. and Ozutok, M. (2006). Length-weight relationships for 31 teleost fishes
caught by botom trawl net in the Babadillimani Bight (northeastern Mediterranean). J. Appl.
Ichthyol, 22: 290-292.
Dadzie, S.; Manyala, J. O. and Abou-Seedo, F. (2005). Aspects of the population dynamics of Liza klunzingeri
in the Kuwait Bay. Cybium, 29 (1): 13-20.
Fischer, W.; Bauchot, M. L.; Schneider, M. (1987). Fisches FAO D‟identification des Especes Poun les
Besoins de la Peche (Revision 1). Mediterranee et Mer Noire. Zone de Peche 37. Volume II. Vertebres.
Publication Preperee la Fao, Resultat d‟un Accord Entre la FAO et la Commision des Communautes
Europeennes (Projet GCP/INT/442/EEC) Financee Conjointement Per Ces Deux Organisation. Rome, FAO,
2: 761-1530.
Gayanillo, Jr. F. C.; Sparre, P. and Pauly, D. (2005). FAO-ICLARM Stock Assessment Tools II (FiSAT II).
User‟s guide. FAO Computerized information Series (Fisheries). No. 8, Revised version, FAO,
Roma, Italia, 126 pp.
Golani, D. (1993a). Trophic Adaptation of Red Sea Fishes to the Eastern Mediterranean. Enviromen-Review
and New Data Israel Journal of Zoology. 39: 391-402.
Golani, D. (1993b). The Biology of the Red Sea Migrant, Saurida undosquamis, in the Mediterranean and
comparison with the Indigenous Confamilial Synodus saurus (Teleostei: Synodontidae).
Hydrobiologia, 271: 109-117.
Golani, D. (2002). Lessepsian Fish Migration- Characterization and Impact on the Eastern Mediterranean.
Workshop on Lessepsian Migration, 20-21 July Gökçeada-Turkey, 1-9.
Gulland, J. A. (1971). The fish resources of the ocean. Fishing News books Ltd., Farnham, England, 255p.
Gulland J. A. (1979). Report of the FAO/UNDP workshop on the fishery resources of the Western Indian
Ocean - South Equator.
Gulland, J. A. (1983). Fish stock assessment: A manual of basic methods. Chichester, U. K. Wiley
Interscience, FAO Wiley series on food and agriculture, Vol. 1, 223p.
Gulland, J.A. and Holt, S.J. (1959). Estimation of growth parameters for data at unequal time intervals.
J.Cons.CIEM, 25(1): 47-49
Hoenig, J.M. (1983). Empirical use of longevity data to estimate mortality rates. Fish. Bull. 82: 898–903
Hogan, C. (2013). Mediterranean Sea. Oceans and seas. Marine Ecology, Biogeography.
ttp://www.eoearth.org/view/article/154548
Holden, M. J. and Raitt, D. F. S. (1974). Manual of Fisheries Science. Part 2- Methods of Recourse
Investigation and their Application. FAO Fish. Tech. Pap., (115). Rev. 1: 214.
Jakubaviciute, E.; Putys, Z.; Dainys, J. and Lozys, L. (2011). Perch (Perca fluviatilis) growth, mortality and
stock exploitation by 40-45 mm mesh-sized gillnet fishery in the Curonian Lagoon. Acta Zool.
Lituan., 21(3): 215-220.
Kagiwara, F. and Abilhôa, V. (2000). A alimentação do peixe-lagarto Synodus foetens (Linnaeus, 1766) em
um banco areno-lodoso da Ilha do Mel, Paraná, Brasil. Arq. Ciên. Vet. Zool. Unipar, Umuarama,
3(1): 9-17.
Mace, P. M. and Sissenwine, M. P. (1993). How much spawning per recruit is enough? In: Smith, S. J., Hunt,
J. J. and Revered, D. (Eds.), Risk evaluation and biological reference points for fisheries
management. Canadian Special Publication of Fisheries and Aquatic Sciences, National Research
Council of Canada, p 101–118.
Manaşırh, M.; Avşar, D.; Yeldan, H. and Çiçek, E. (2008). Population dynamical parameters of the
Atlantic lizardfish (Synodus saurus) from The babadillimani bight (silifke-mersin) in Turkey. Journal
of FisheriesSciences.com, 2 (4): 645-652.
Mehanna, S. F. (2007a). Stock assessment and management of the Egyptian sole Solea aegyptiaca
Chabanaud, 1927 (Osteichthyes: Soleidae), in the Southeastern Mediterranean, Egypt in the Eastern
Mediterranean (Port Said region), Egypt. Turk. J. Zool., 31: 379-388.
Mehanna, S. F. (2007b). A preliminary assessment and management of gilthead bream Sparus aurata in Port
Said fishery, Southeastern Mediterranean, Egypt. Tur. J. Fish. & Aquat. Sci., 7 (2): 123-130.
Mehanna, S. F. (2009a). Growth, Mortality and Spawning Stock Biomass of striped red mullet Mullus
surmuletus, in the Egyptian Mediterranean waters. Med. Mar. Sci., 10 (2): 5-17.
Mehanna, S. F. (2009b). Growth, Mortality and Spawning Stock Biomass of red mullet Mullus barbatus, in
the Egyptian Mediterranean waters. Tropentag 2009, Hamburg University, Germany, 6 – 8 October,
2009.
Mehanna, S. F.; Haggag, H. M. and Sallam, N. A. (2008). Population dynamics and management of
Sardinella aurita (Osteichthyes: Clupeidae), in the Southeastern Mediterranean, Egypt. . J. Egyp.
Acad. Soc. Environ. Develop., 9(1): 65-75.
Mehanna, S. F. and Fattouh, S. A. (2009). Fisheries management of the common pandora Pagellus erythrinus
in the Egyptian Mediterranean waters. 3rd International Conference on aquatic resources “Integrated
Coastal Zone Management and Sustainable Development”, NIOF, 17-20 November, 2009, Alex.,
Egypt.
Mehanna, S. F. and Haggag, H. M. (2010). Port Said Fisheries: current status, assessment and management.
3rd International conference on Fisheries and Aquaculture, 29 November-1December, Cairo, Egypt.
www.cabdirect.com.
Merella, P.; Quetglas, A.; Alemany, F. and Carbonell, A. (1997). Length-weight relationship of fishes and
cephalopods from the Balearic Islands (western Mediterranean). Naga ICLARM Q. 20(3/4):66-68.
Pauly, D. (1983). Some simple methods for the assessment of tropical fish stocks. FAO Fish. Tech. Pap., 243:
52p.
Pauly, D. (1984). Fish population dynamics in tropical waters: a manual for use with programmable
calculators. ICLARM Studies and Reviews, Vol. 8, 325p.
Pauly, D. (1987). A preliminary compilation of fish length growth parameters. Berichte des Instituts fur
Meereskunde an der Christian-Albrechts Universtat Kiel, 55: 200p.
Ricker, W.E. (1975). Computation and Interpretation of Biological Statistics of Fish Population. Bull. Fish.
Res. Board Can. 191: 382.
Rosenberg, A. A. and Repestro, V. R. (1996). Precautionary management reference points and management
strategies, Precautionary approach to fisheries-Part 2. FAO Fisheries Technical Paper, 350 (2): 129140.
Royce, W. F. (1972). Introduction to the fishery sciences. Academic Press, New York, 351p.
Santos, R. S.; Porteiro, F. M. and Barreiros, J. P. (1997). Marine fishes of the Azores: annotated checklist and
bibliography. Arquipélago. Life and and Marine Sciences, Supplement 1, 244p.
Soares, M.S.C.; Barreiros, J.P.; Sousa, L. and Santos, R.S. (2002). Agonistic and predatory behaviour of the
lizardfish Synodus saurus (Linnaeus, 1758) (Actinopterygii: Synodontidae) from the Azores. Aqua, J.
Ichthyol. Aquat. Biol., 6(2): 53-60.
Soares, M.S.C.; Sousa, L. and Barreiros, J.P. (2003). Feeding habits of lizardfish Synodus saurus (Linnaeus,
1758) (Actinopterygii: Synodontidae) from the Azores. Aqua, J. Ichthyol. Aquat. Biol, 7(1): 29-38.
Sparre, P. and Venema, S. C. (1998). Introduction to tropical fish stock assessment (Part-1 manual), FAO
Fisheries Technical Paper, 306 (1), Rev. 2: 407p.
Stergiou, K.I. and Moutopoulos, D.K. (2001). A review of length-weight relationships of fishes from Greek
marine waters. Naga ICLARM Q. 24(1&2): 23-39.
Sulak, K. J. (1986). Synodontidae In: Fishes of the north-eastern Atlantic and the Mediterranean, Vol. 1. P. J.
P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen, E. Tortonese (Eds), UNESCO, Paris, France:
405–411.
Sulak, K. J. (1990). Synodontidae.In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.)
Check-list of the Fishes of the Eastern Tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI, Paris;
and UNESCO, Paris. Vol. 1: 365-375.
Evaluation Bioécologique de la Qualité du Milieu à travers la Faune Associée
du Genre Cystoseira
Évaluation bioécologique de la qualité du milieu à travers la faune
associée du genre Cystoseira
1
Sellam L.1; Benali Myriam1, Chafika R. Z.1
Faculté des Sciences Biologiques-Université des Sciences et de la Technologie Houari Boumédiène - Alger,
Algérie - Email : [email protected] - [email protected]
[email protected])
RESUME
Dans la continuité des travaux d’utilisation des Cystoseires comme bioindicateurs de la qualité du milieu
marin, une étude de la faune associée aux Cystoseires a été menée durant l’hiver 2013 à l’Anse de Kouali,
dans la région de Tipaza, elle a concerné deux faciès distincts, l’un de mode calme (Cystoseira barbata),
l’autre de mode battu (C. stricta) et a permis d'identifier un total de 174 espèces, réparties respectivement en
109 et 64 espèces et dominées par le groupe des Crustacés. L’analyse trophique a par ailleurs démontré la
dominance des brouteurs pour les deux modes étudiés. Les variations de la biodiversité peuvent être
principalement expliquées par les variations des conditions de brassage et d’oxygénation.
Mots clés: Cystoseira stricta, Cystoseira barbata, Anse de Kouali, faune associée, bioindicateur
INTRODUCTION
Les espèces du genre Cystoseira forment des écosystèmes méditerranéens emblématiques,
ayant connu des régressions notables dans les zones littorales soumises aux pressions
anthropiques, notamment les rejets urbains et industriels. Dans la région centre algéroise,
seuls quelques patchs subsistent dans des sites relativement peu pollués, avec le
développement préférentiel de l’espèce ubiquiste Cystoseira compressa. Le littoral de
Tipaza, à 80 Km, à l’ouest d’Alger, abrite encore des formations denses et remarquables de
Cystoseires endémiques et/ou de grand intérêt écologique, parallèlement à un accroissement
des activités polluantes, avec des rejets en mer, sans aucun traitement ; l’Anse de Kouali
(carte 1) est le site choisi pour la présente étude, les résultats obtenus constituent une
continuité aux travaux antérieurs sur la faune associée aux Cystoseires [1]. Elle vient
renforcer les objectifs tracés pour l’utilisation d’indicateurs biologiques dans le suivi de
l’état des biocénoses remarquables et de la qualité du milieu via l’analyse des modifications
qui pourraient affecter la structure des peuplements étudiés (biodiversité, régime
alimentaire, écologie).
Carte 1 : Localisation de l’Anse de Kouali
du Genre Cystoseira
Au niveau du même site, deux stations rapprochées, l’une de mode calme (faciès à
Cystoseira barbata), la seconde de mode battu (C. stricta) ont été échantillonnées. Une
surface de 400 cm2 (20X 20 cm), a été considérée comme surface d'échantillonnage
minimale conformément aux travaux de référence sur les communautés de l'infralittoral en
Méditerranée [2] ; [3]. C’est la même surface utilisée par [4] et [5] dans leurs travaux sur la
faune associée aux Cystoseires. Des indices de biodiversité ont été calculés et une approche
comparative a été développée entre les deux faciès et en rapport avec les travaux antérieurs.
RESULTATS ET DISCUSSIONS
Au total, 174 espèces renfermant 7300 individus ont été recensées, 64 espèces représentées
par 305 individus en association au faciès à Cystoseira barbata et 109 espèces représentées
par 6995 individus en association au faciès à Cystoseira stricta. L’analyse des groupes
zoologiques (Diagrammes 1) a révélé la large dominance des crustacés pour les deux
peuplements étudiés. Le décapode Clibanarius erythropus considéré comme une espèce
d’eau plus ou moins pure et eau plus ou moins calme est dominant dans le faciès à
C.barbata. La dominance des amphipodes Hyale camptonyx, Hyale pontica et Hyale
crassipes, indicatrices d’eaux pures pour le faciés à C. stricta traduit l’augmentation du
gradient hydrodynamique allant du premier peuplement vers le second. Les Mollusques
sont le second groupe en terme d’importance de contribution au peuplement à Cystoseira,
13% pour le mode calme, contre 2.5% seulement pour le mode battu, ceci correspond
quasiment aux résultats obtenus par d’autres auteurs [5], cette différence pourrait être liée à
une sédimentation importante, laquelle serait entrainée en partie par un hydrodynamisme
faible [6] Le groupe des Polychètes est par ailleurs mieux représenté au sein du faciès de
mode battu, l’espèce Platynereis dumerillii est la plus dominante ; des paramètres, tels que
le concrétionnement de base, quasi absent chez C. barbata, favorisent la formation
d’anfractuosités pour les polychètes qui se développent dans les crevasses. Ex. Perinereis
cultrifera. De même que le milieu sciaphile créé par les denses ceintures à C. stricta semble
favoriser le développent d’espèces tubicoles telles que celles appartenant à la famille des
Sabellidae des genres Fabricia, Nereidae, Phyllodocidae.
L’analyse des affinités trophiques (Diagramme 2) a permis de relever la nette prédominance
des brouteurs en association aux deux faciès, représentés par Elasmopus brasiliensis, Hyale
camptonyx et Hyale pontica (en association à C. stricta) et Anthura gracilis et Cerithium
vulgatum en association à C. barbata. Elle reflète la forte dépendance fonctionnelle de la
faune à la physionomie algale du peuplement.
Les indices de biodiversité et d’équitabilité, associés aux diagrammes Rangs/fréquences,
reflètent des peuplements relativement riches et équilibrés, avec des stades matures (stade
2) pour les deux stations. (Diagramme 3)
Les différences observées entre les deux peuplements s’expliqueraient donc essentiellement
par les conditions variables de brassage des eaux, d’oxygénation et d’hydrodynamisme
entre les deux stations, en résumé :
- Un hydrodynamisme intense favoriserait le développement d’une faune importante
qui s’abrite au sein du peuplement à Cystoseira stricta [4]
- Les eaux stagnantes, peu oxygénées et un réchauffement intense des eaux de la
station à C. barbata semblent être une contrainte au développement d’une riche
faune, ne favorisant que des espèces hautement adaptées à ces conditions drastiques
- La réduction, voire l’absence d’anfractuosités au sein du concrétionnement de
Cystoseira barbata (établie sur des platiers rocheux ensablée), pourrait selon [5]
du Genre Cystoseira
-
expliquer l’absence de certaines espèces caractéristiques (espèces d’anfractuosité),
plus abondantes au sein du faciès à C. stricta, c’est notamment le cas des
Polychètes.
L’indice de Shannon plus élevé pour le faciès à C. barbata qui compte pourtant une
faible diversité, interpelle sur la représentativité de l’indice pour un échantillon de
moins de 400 individus, la station ayant été considérée comme soumise à des
facteurs de stress naturels (stagnation et faible oxygénation), il a été tenu compte des
recommandations de certains auteurs [7], qui y préconisent une limite de 200
individus.
Dominance des différents groupes
zoologiques associés à Cystoseira stricta
Dominance des différents groupes zoologiques
associés à Cystoseira barbata
Diagramme 2 : Analyse des groupes zoologiques associés aux Cystoseires
Dominance des différents groupes
trophiques associés à Cystoseira
stricta
Dominance des différents groups
trophiques associés à Cystoseira barbata
Diagramme 2 : Analyse des groupes trophiques associés aux Cystoseires
du Genre Cystoseira
Cystoseira stricta (H’=4.85 - E= 0.72)
Cystoseira barbata (H’=5.10 - E= 0.85)
Diagramme 3 : Diagrammes rangs fréquences et indices de biodiversité et d’équitabilité
CONCLUSION
La présente étude a permis de compléter et de conforter les études antérieures relatives aux
peuplements associés aux Cystoseires dans la région de Tipaza, en mettant en exergue leur
richesse faunique et relative intégrité. En comparant les deux principaux faciès, de mode
calme (association à Cystoseira barbata) et de mode battu (Cystoeira stricta), les
variabilités relatives à la biodiversité recensée, semblent étroitement liées au facteur
hydrodynamique, à la sédimentation et à la nature du concrétionnement de base. Cette
approche comparative, constitue un bon outil de caractérisation des biocénoses, utilisées
comme bioindicateurs intéressants des éventuelles modifications dans les structures des
peuplements, notamment par des altérations exogènes. Néanmoins, une étude précise du
volet écologique, qui n’a pas été abordé dans le présent travail, apportera davantage
d’éléments descriptifs des peuplements associés aux Cystoseires et répondra à certaines
questions restées en suspens, notamment celles liées aux affinités des espèces dans leurs
biotopes et celles liées aux affinités biogéographiques. Une cartographie des Cystoseires de
tout le littoral centre, est par ailleurs indispensable pour le suivi effectif de l’évolution des
recouvrements par espèces, coïncidant le plus souvent avec l’évolution des atteintes
anthropiques au littoral.
REFERENCES BIBLIOGRAPHIQUES
[1] Rebzani – Zahaf C., Benali M. 2010. Peuplement associé à Cystoseira amantacea var. stricta dans la
région ouest algéroise (Tipaza). CIESM, Venise (Italie), 10-14 mai 2010. Rapp. Comm. int. Mer
Medit., 39, 450
[2] Coppejans, E.; Dhondt, F. (1977). Végétation marine de l'Ile de Port-Cros (Parc National): 14. Myrionema
liechtensternii Hauck (Phaeophyta-Chordariales), espèce nouvelle pour la flore algologique de
France, in: (1977). IZWO Coll. Rep. 7(1977). IZWO Collected Reprints, 7: pp. chapter 17
[3] Boudouresque C.F., T. Belsher (1979). Le peuplement algal du port de Port-Vendres : recherches sur l'aire
minimale qualitative. Cah. Biol. mar. Fr. 20,259-269
[4] Bellan Santini D., 1969. Contribution à l’étude des peuplemements infralittoraux sur substrat dur rocheux
(Etude qualitative et quantitative de la frange supérieure) Rec. Trav. St. mar. Endoume, fasc.63, Bull.
47 : 5-294.
[5] Benali, M. 2010.Contribution à l’étude de la biodiversité associée aux chromobiontes du genre Cystoseira
dans la région de Tipaza. These de magistère : Oceanographie Biologique et Environnement Marin.
Université des Sciences et de la Technologie Houari Boumediène, 117p.
[6] Desrodiers G., 1977. Contribution à l’étude de la pollution sur les peuplements de substrats durs dans le
golfe de Fos. Thèse de Doctorat. Station Marine d‟Endoume. Université de d’Aix (Marseille II). P92
[7] Rebzani-Zahaf C., 2003. Les peuplements macrobenthiques des milieux portuaires de la côté algérienne :
Alger, Bejaia et Skikda. Thèse Doct. Etat, Sciences de la Nature (Océanologie), Univ. Sc. Tech.
Alger, 239p. + Annexes 63.
Food and Feeding of Scorpaena scrofa Linnaeus, 1758 in the Western Part of Libya
Food and feeding of Scorpaena scrofa Linnaeus, 1758 in the Western part
of Libya
Esmail Shakman*; Salwa Shahrani
*zoology department – Tripoli university, Tripoli - Libya, E. mail: [email protected]
SUMMARY
A total of 394 fish have been Collected from the Red Scorpionfish Scorpaena scrofa monthly, from fishermen
in the Western Region of Libya (Tripoli), in the period, from February 2010 to January 2011, Some
measurements have been taken; to know the feeding and food behavior. The results have showed that, the
bony fish is the most important for this species 48.02%, followed by crustaceans 44.19% and a small
percentage was seaweed 1.38%, algae 0.2% Mollusca 0.07% and worms 0.02% and varied this percentage in
the rest of the seasons, this study has showed some important biological information in Libyan waters for this
species, which will contribute to the achievement of some other studies such as fish stocks and give biological
information for the specialists at the local level, regional and international.
Keywords: Scorpion fish, Libyan coast
INTRODUCTION
The Mediterranean Sea is an almost closed marine basin between Europe, Asia and Africa.
It is connected with the Atlantic Ocean by the strait of Gibraltar, with a width of fifteen
kilometres and an average depth of 290m to a maximum 950m. it is connected to the Red
Sea since 1869 by the Suez Canal, which is one hundred and twenty meters wide and
twelve meters deep (Shakman & kinzelbach 2007). A rough estimate of more than 8.500
species of macroscopic marine organisms should live in the Mediterranean Sea,
corresponding to somewhat between 4% and 18% of the world marine species (Bianchi and
Morri 2000) The biota of the Mediterranean Sea consist primarily of Atlanto-Mediterranean
species (62%) derived from the adjacent Atlantic biogeographic provinces beyond the strait
of Gibraltar. Many Mediterranean species are endemic (20%) while others are
cosmopolitan, circumtropical (13%) or Indo-Pacific (5%). These proportions differ for
different major taxonomic groups and also for different parts of the Mediterranean Sea, but
the pattern remains essentially the same (Ketchum 1983). Scorpaeniformes include almost
1000 teleost species widely distributed in the temperate and tropical seas (Nelson, 1994;
Johnson, 1993; Shinohara, 1994). The Scorpaeniformes fishes are generally represented by
two families in the Mediterranean Sea: Scorpaenidae and Sebastidae. The family
Scorpaenidae is a commercially important demersal fish group distributed throughout the
Mediterranean Sea, including four genera and nine species (Nelson, 1994). Several studies
have brought detailed information on the biology, distribution of Scorpaeniformes species
(Fischer et al., 1987; Hureau & Litvinenko, 1986; Morato et al. 2001, Bradai & Bouain,
1988, 1990, 1991). The knowledge about feeding habits of this commercial species is scarce
in the Libyan coast; therefore, the aim of this study is to provide information on the diet by
examining specimens captured in the western part of the Libyan waters
This study was carried out along the Tripoli coast (Libya) from February 2010 to January
2011 for S. scrofa . Monthly samples were collected by trammel nets (inner mesh 26 mm,
outer mesh 120 mm). A total of 394 specimens of S. scrofa were collected from the
western region Tripoli coast. The samples were stored cool and were transported
immediately to the laboratory for analysis. The total weight (W T) was measured to the
nearest 0.1g and total length (LT) to the nearest mm, and gut (WG) were removed and
weighted to the nearest 0.01g. Stomach samples were removed, weighed and preserved in a
4% formaldehyde-seawater solution. The stomachs were opened in a petri dish and food
items were carefully grouped in different categories and identified to the lowest taxonomic
level possible. Several parameters were used in the analysis of feeding behaviour. The
Feeding Index (FI) and Gastro-Somatic index (GSI) were calculated as follows: Feeding
Index (FI): FI = NF / NE  100, where NF is the number of fishes with food in the
stomach, NE is the number of fishes examined (Suresh et al. 2006). Gastro-Somatic Index
(GSI): GSI = (Gut weight (g) / Body weight (g))  100 (Suresh et al. 2006). The
Occurrence Frequency (F%) was calculated as F% = n  100 / N, where n is number of
stomachs in which a particular food item is observed and N is the number of full stomachs
(Hyslop 1980).
RESULTS
The total length (LT) of individuals ranged from 10.3 to 40.5 cm for S. scrofa. The Feeding
Index (FI) was slightly lower in October and November, but did not change significantly
between months; (Fig. 1).
Figure 1. Feeding index (FI%) for S. scrofa of Libya
The mean GSI-values ranged from 2.24 to 4.52 for S. scrofa, (Fig. 2). The GSI started to
increase in May and June with highest values in summer (August).
Figure 2. Gastro somatic index (GSI) for S. scrofa of Libya
The mean HSI-values ranged from 1.1 to 2.47 for S. scrofa, (Figure 3). The HSI dropped
in Mach with highest values in May, and no deference between the other months.
Figure 3. Hepato somatic index (HSI) for S. scrofa of Libya
This species feeds on animals, most of items are fish and Crustaceans, and the percentage of
items are defferent in the seasons, in the spring most of the food crustaceans (55%) follwed
by fish (28%) (Figure 4)
Figure 4. IRI% for S. scrofa of Libya (Spring season)
the percentages of food have changed in the summer season, most of food was fish (49%),
followed by Crustaceans (46%) (Figure 5).
Figure 5: IRI% for S. scrofa of Libya (Summer season)
In the autumn season, the crustaceans was the highest percentage (53%) followed by fish
(42%). (Fig. 6).
Figure 6. IRI% for S. scrofa of Libya (Autmun season)
In the winter season, the most food for this species was fish (70%), followed by
Crustaceans (18%) (Figure 7).
Figure 7. IRI% for S. scrofa of Libya (Winter season)
In general, this species feed on fish and Crustaceans with variation in the seasons (Fig. 8).
Figure 6. IRI% for S. scrofa of Libya (gathered)
DISCUSSION
There were no studies carried out in order to determine their feeding habits of S. scrofa in
the Libyan coast until that time. Several studies were performed on the feeding habits of
scorpaenid fish in the Mediterranean Sea (Harmelin-Vivien et al., 1989; Pallaoro & Jardas,
1991; Morte et al., 2001; La Mesa et al., 2007). Among coastal species, S. porcus, S. notata
and S. scrofa are described as macrophagic carnivores, due to the large size of preferred
prey compared to their body (La Mesa et al., 2007). All of them are ambush predators,
which have developed a hunting technique typically based on capture of moving prey, such
as crustaceans and teleosts size (Harmelin-Vivien et al., 1989; Morte et al., 2001). in our
results, this species have fed mainly on larvae of osteoichthyes, Crustaceans and a few of
invertebrates at depth 1 to 30m, This diversity in preference to food an important role in the
spread of Scorpaena in the northwest of the Mediterranean Sea (La Mesa et al, 2007), also
there is a positive correlation between the size of individual predators and prey, it was noted
that in different species of Scorpaena S. porcus & S.notate in different areas of the world
(Harmelin-Vivien et al. 1989; Bradai & Bouain 1990; Morte et al. 2001). it has observed in
the S. scrofa which feeds on fish, crustaceans and molluscs (Soljan & Karlavac, 1932) and
this is also agreed with the results of this study. this species feeds on small fish, crustaceans,
molluscs and varied the relative importance of food. A few of studies have done on S.
Scrofa. several studies have been done on another species S. Porcus Pallaoro and Jardas
(1991) verified that S. porcus fed mainly on Crustacean such as decapods, brachyuran and
fish rocky and rocky-sandy, overgrown by algea and marine phanerogams between 1 and 30
m along the Adriatic coast. Feeding habits of S. pocus have been studied also in the Western
Mediterranean Sea. Crustacea Decapoda constituted the preferential prey of both fish
species, whereas Amphipoda were found as the secondary prey. In Spanish Mediterranean
waters, at the Tyrrhenian Sea S. porcus appears to feed mainly on decapods. Similar results
have been reported for other Mediterranean areas. However, the stomach contents of black
scorpionfish from French and Tunisian Mediterranean waters and Adriatic coast more
frequently revealed the existence of teleost (Morte et al., 2001). Taking this data into
account, it could be concluded that S. porcus and S. notata diet also changes according to
the abundance of different prey in the environment, provided that these prey are within the
selected size range and similar ecological characteristics (Morte et al., 2001). we believe
that this study covered a great part of the biological information important in south
Mediterranean (Libyan coast) and help the Scientists and researchers at the local, regional
and international development of programs and laws.
ACKNOWLEDGEMENT
We would like to thank the fishermen in Tripoli port and Ms Manal for her help.
REFERENCES
Bradai M.N. and Bouain, A. 1988 : Croissance lineaire absolue desrascasses (Scorpaena porcus et S.scrofa)
du golfe de Gabes (Tunisie). Rapp. Comm.Int. Mer Méditerr. 31:265.
Bradai M.N. and Bouain A. 1990: Feeding pattern of Scorpaena porcus and S. scrofa (Teleostei,
Scorpaenidae) from Gulf of Gabes, Tunisia. Cybium, 14: 207–216.
Bradai N, Bouain A., 1991: Reproduction de Scorpaena porcus(Linne, 1758) et de Scorpaena scrofa (Linne,
1758) (Pisces,Scorpaenidae) du Golfe de Gabes. Oebalia 17, 167–180.
Fischer W. Schneider M. and Bauchot M.L. 1987: Fiches d’identification des espe`ces pour les besoins de la
peˆche. Me´diterrane é et Mer Noire. Zone de peˆche 37, vol. II. FAO, Rome.
Harmelin-Vivien M.L. Kaim-Malka R.A. Ledoyer M .and Jacob-Abraham S.S. 1989: Food partitioning
among scorpaenid fishes in Mediterranean seagrass beds. Journal of Fish Biology, 34: 715-734.
Hureau J. C. and Litvinenko N.I. 1986: Scorpaenidae :In P.J.P. Whitehead M.-L. Bauchot J.-C. Hureau J.
Nielsen and E. Tortonese (eds.) Fishes of the North-eastern Atlantic and the Mediterranean.
UNESCO, Paris. Vol 3.1211-1229.
Hyslop E. J. 1980: Stomach content analysis: a review of methods and their applications. Journal of fish
biology, Southampton. 17 (4):411-429.
Linnaeus C. 1758: Systema naturae per regna tria naturae, secundum classes, ordinus, genera, species, cum
characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata.Impensis Direct.
Laurentii Salvii, Holmiae. :824.
Morto T. Afonso P. Lourinho P. Barreiros J.P. Santos R.S. and Nash R.D.M .2001: Length–weight
relationships for 21 coastal fishspecies of the Azores, north-eastern Atlantic. Fish Res. 50:297–302.
Nelson J. S. 1994: Fishes of the World. Third ed. John Wiley& Sons, Inc., New York. 600.
Pallaoro A .and Jardas I. 1991: Food and feeding habits of black scorpionfish (Scorpaena porcus L. 1758)
(Pisces,Scorpaenidae) along the Adriatic coast. Acta Adriat 32: 885–898.
Shakman E. A., Kinzelbach R. (2007) Distribution and characterization of lessepsian migrant fish along the
coast of Libya. Acta Ichthyol. Piscat. (37) 1: 7-15
Soljan T. and Karlovac o. 1932: untersuchungcn Überdia Ernährung der adriatischen scorpaena- Arten-Acta
Adriatic 1(1):23.
Suresh V. R. Biswas B. K. Vinci G. K. Mitra .K.and Mukherjee A.2006: Biology and fishery of barred spiny
eel, Macrognathuspancalus Hamilton. Acta. Ichthyologica et Piscatoria, 36 (1):31-37.
Analyse Dynamique de l'Etat du Stock d’un Poisson Centracanthidae
(Spicara maena, Linnaeus, 1758) dans la Région Centre de l’Algérie
Analyse dynamique de l'état du stock d’un poisson Centracanthidae
(Spicara maena, Linnaeus, 1758) dans la région centre de l’Algérie
Harchouche Kamel
Laboratoire Halieutique, USTHB-FSB, N° 32 El-Alia Bab Ezzouar 16111, Alger, Algérie.
Fax: 00213 21247217 - E-mail: [email protected]
RESUME
Le présent travail constitue une application d’un modèle analytique sur le stock des Spicara en particulier
Spicara maena capturée au chalut, le long des côtes de la région centre de l’Algérie et débarquée à la
poissonnerie d’Alger. Il est basé sur une analyse du rendement par recrue (Y/R) en appliquant, sur les
données de capture de l’espèce les logiciels ‘‘FISAT II Win’’ et le ‘‘VIT4 Win’’. Quelques indices
d’exploitation tels que les mortalités, les tailles de recrutement et de sélection sont calculés et intégrés à
d’autres paramètres notamment ceux de la croissance dans un modèle prévisionnel d’évaluation. Le
coefficient de mortalité totale retenu est égal à 0,70 an–1 et la mortalité naturelle, 0,37 an–1. La mortalité par
pêche a été estimée à 0,33 an–1 et le taux d’exploitation de S. maena des côtes algériennes est de l’ordre de
0,47. Le stock semble être légèrement sous-exploité selon la concordance entre les résultats du rendement par
recrue donnés par le ‘‘FISAT II’’ et ceux du ‘‘VIT4’’ (rendement par recrue et APV, Analyse des Populations
Virtuelles). Pour un rendement optimal, l’effort de pêche peut être augmenté sans problème si la pêche était
monospécifique.
Mots clés: Poisson, Croissance, Exploitation, Biomasses, Alger.
ABSTRACT
This work is an application of an analytical model for the stock of Spicara especially Spicara maena caught
by trawling along the coast of the central region of Algeria and landed to the fishstation in Algiers. It is based
on the analysis of yield per recruit (Y / R) by applying the FISAT II and VIT4 softwares on the sampled data.
Some signs of exploitation such as deaths, sizes, recruitment and selection are calculated and integrated with
other parameters including growth for a model forecast evaluation. The coefficient of total mortality used is
equal to 0.70 yr-1 and natural mortality is 0.37 yr-1. Fishing mortality was estimated at 0.33 yr-1 and the
exploitation rate of S. maena along the Algerian coast is around 0.47. The stock appears to be slightly underexploited by the concordance between the results of yield per recruit given by FISAT''II'' and of those VIT
(yield per recruit and VPA, virtual population analysis). For optimum performance, the effort can be
increased easily if fishing were monospecific.
Keywords: Fish, Growth, Exploitation, Biomass, Algiers.
INTRODUCTION
Les apports en produits de la mer, comme le montrent les statistiques officielles de ces
dernières années en Algérie, n’ont cessé de croître grâce aux efforts de développement
fournis en faveur du secteur de la pêche. Mais, pour la seule ville d’Alger, l’importance de
la demande en fruits d’origine marine est telle que cette production est loin de la satisfaire.
Le poisson, dans le sens le plus large, reste cher et demeure inaccessible au consommateur
algérois moyen. Si la majeur partie du littoral national contribue à l’alimentation de la
pêcherie d’Alger, approximativement la moitié des mises à terre provient de la région
algéroise, l’autre partie vient du reste de la côte en particulier celle de l’Ouest du pays
comme l'a déjà signalé [1]. Parmi les familles de poissons qui ont fait le moins l’objet
d’études, on peut citer les Centracanthidés. Les données relatives à la biologie et à
l’écologie de ce groupe d’animaux sont souvent incomplètes et ne portent que sur de faibles
effectifs. Les travaux s’y rapportant restent fragmentaires et anciens ; on peut citer par
exemple, ceux de [2] sur la biologie de Spicara maena en Adriatique. Au niveau du bassin
méditerranéen, quelques informations sont fournies en Espagne par [3] et par [4], en
Tunisie par [5] et par [6]. [7] contribue à la connaissance de la sexualité de Spicara flexuosa
sur les côtes grecques. Ces poissons sont pourtant largement pêchés, malgré leur peu
d’intérêt économique. Il faut signaler cependant que leur chair est peu appréciée par le
consommateur mais elle peut, comme dans certains pays, faire l’objet de transformation en
farine. Une étude approfondie de l’espèce Spicara maena a été réalisée tant sur le plan de
l’écologie, de la biologie que de la dynamique des populations. Spicara maena est un
perciforme appelé communément ‘‘Mendole’’ en France et ‘‘Tchoucla’’ en Algérie, est de
petite taille, à fréquence de pêche généralement commune et formant des bancs importants
au moment du frai printanier selon [8], dans son catalogue sur les poissons et la pêche en
Méditerranée. Les pêches effectuées par le navire océanographique ‘‘Thalassa’’ en 1982,
signale l'espèce tout le long du littoral algérien.
Après une détermination rapide des paramètres de croissance selon une analyse des
structures de taille [9], les paramètres d’exploitation (mortalités et taux d’exploitation) sont
estimés. A l’aide du logiciel ‘‘VIT4 Win’’ [10] [11] une approche analytique de
l’exploitation par le modèle de l’analyse de population virtuelle (APV) et du rendement par
recrue (Y/R) sera entreprise.
Le port d'Alger, situé au cœur de la capitale et au centre d'une zone maritime de 200 km,
abrite la poissonnerie ; les zones de pêche de la région centrale algérienne sont, la pipe
située à l'est d'Alger, le plateau de la baie de Bou Ismail, Fouroumound en face de Tipaza,
Phenyl à l’est du mont Chenoua et les Bouaires à l’ouest de Cherchell (figure, 1).
Figure 1 : Position géographique de la zone d’étude (Bassin algérien ; A: région Ouest ; B: Centre ;
C: Est)
L’échantillonnage que nous avons effectué a été possible grâce aux prises mises à terre
dans le secteur centre par la flottille de pêche chalutière au niveau d’Alger, de Bou Haroun
et de Cherchell. Le poisson est aussitôt acheminés au laboratoire et traités à l’état frais. Au
total, plus de 5000 individus ont été étudiés. Les tailles observées s’échelonnent entre 6 et
27 cm de longueur totale. Les mesures prises au cm près à l’aide d’un ichtyomètre et d’une
balance au centième de g près sont : LT, Longueur totale (cm) ; Lst, Longueur standard
(cm), WT, Poids total (g) et We, poids éviscéré. Durant la période d’échantillonnage, les
statistiques officielles de la production des espèces de Centracanthidés y compris S. maena,
fournies par les services administratifs des ports, ont été notées et analysées.
Les paramètres de croissance caractéristiques de la population sont déterminés par analyse
des structures d’âge et de taille. L’expression résultante de la croissance linéaire après
développement mathématique est de la forme (1) :
L t = L (1 - e - K (t –
to)
)
(1)
où:
L t : longueur du poisson au temps t,
L : longueur asymptotique quand t tend vers l’infini (taille asymptotique du poisson),
t0 : temps (âge théorique du poisson) où la longueur est supposée nulle,
K : coefficient de croissance.
La méthode de [12] est basée sur l’analyse des fréquences de longueur pour l’estimation
de L et Z/K; elle repose sur quelques hypothèses (in [13]):
-
population en équilibre,
croissance en longueur de type Von Bertalanffy,
mortalité naturelle exponentielle négative suivant la loi (2):
Nt = No e –Zt,
courbe de sélection de type chalut (p < 1, pour les petits poissons seulement).
(2)
Les valeurs de Li (taille moyenne) sont reportées sur un graphique en fonction de Li (centre
de classe); le segment linéaire de la courbe résultante est identifié et les points
correspondants décrivent une droite d’équation (3):
Li = a Li + b
(3)
Cette droite coupe la première bissectrice au point d’abscisse L et la pente (a) et
l’ordonnée à l’origine (b), déterminées par une simple régression, permettent la
connaissance de L et Z/K (4):
L = b/(1-a) et Z/K = a/(1 – a)
(4)
La longueur asymptotique L peut être évaluée par la relation empirique de [14]: L =
Lmax/ 0.95 où Lmax représente la taille du plus grand poisson mesuré dans un stock bien
échantillonné. Pour l’estimation de K, [15] présentent une méthode basée sur l’étude
comparative de la croissance des poissons. Elle utilise la vitesse de croissance Ø’ calculée à
partir des valeurs de L et K selon la relation (5): Ø’= Log10 K + 2 Log10 L (5)
Ainsi pour chaque couple de valeurs L et K connues, obtenus à l’aide d’autres méthodes
ou d’autres travaux réalisés dans la région étudiée, on calcule Ø’ à partir de la relation cidessus. Dans le cas où l’on dispose de plusieurs couples (L , K), les résultats permettent de
déterminer une vitesse moyenne Ø’. [16] a démontré l’uniformité de Ø’ à l’intérieur des
groupes taxonomiques ; en effet, pour toutes les années examinées, les valeurs suivent une
distribution normale. L’estimation de K dans un stock de poissons est donnée par (6)
:
Ø’ - 2 Log L
Log10 K = Ø’- 2 Log10 L et K = 10
(6)
10 .
Connaissant L et K, le paramètre to est obtenue à partir de l’expression empirique de [14]
(7):
Log10 (- t0) = - 0,3922 – 0,2752 Log10 L - 1,038 Log10 K
(7)
La relation taille-poids du poisson est donnée par l’expression (8) :
W = a LTb, (8)
où W est le poids, LT la longueur totale, a est une constante fonction des unités utilisées et
b représente le coefficient d’allométrie. Par une transformation logarithmique, l’équation
linéaire se présente sous la forme (9):
Log W = b Log LT + Log a.
(9)
Dans les calculs, nous avons retenu le poids éviscéré (We) pour éliminer les variations dues
à l’état des contenus stomacaux et au degré d’évolution pondérale des gonades. Les
constantes a et b peuvent alors être estimées par un ajustement de type moindres carrés.
Suivant la valeur de b, trois cas se présentent :
 b égale 3, la croissance est dite isométrique ; les deux variables We et LT ont le
même taux de croissance, le poids croit alors comme le cube de la taille du
poisson,
 b est inférieur à 3, l’allométrie est minorante ; le poids croit relativement moins
vite que la longueur,

b est supérieur à 3, l’allométrie est majorante ; le poids croit plus vite que la taille
de l’individu.
A partir de l’équation de croissance linéaire et de la relation taille-poids, on peut établir la
de croissance en poids de Von Bertalanffy ou croissance pondérale. Le modèle descriptif
s’écrit (10)
:
WT = W (1 - e - K (t – to)) b avec
W = a L b
(10)
et
W : poids asymptotique en gramme,
L : longueur asymptotique en centimètre,
a et b : coefficients de la croissance relative entre le poids et la longueur. WT,
représente le poids total du poisson au temps t.
La mortalité est définie généralement comme étant l’effectif d’individus qui disparaît durant
un intervalle de temps dt ; c’est un effet négatif sur le stock qui se traduit par l’équation
différentielle suivante (11):
dNt/dt = - Z * Nt (11)
où
Z : coefficient instantané de mortalité totale exprimé en an -1
Nt : effectif des individus au temps t.
La solution de cette équation est (12):
Nt = No * e – Zt,
(12)
avec No : effectif initial de la population au temps t=to=0. Le coefficient de régression de
l’équation liant le logarithme népérien de Nt au temps t donne cette valeur (13):
Ln Nt = Ln No – Z * t (13)
Le coefficient de mortalité total (Z) est, selon [17] , la somme (Z = F + M) du coefficient
de mortalité naturelle (M en an-1) et du coefficient de mortalité par pêche (F en an -1). Le
premier comprend les mortalités autres que celles qui sont dues à la pêche (maladies,
prédation, sénescence, etc.).
Dans les études de stocks de poisson, la mortalité naturelle (M) est le paramètre le plus
difficile à évaluer [9]. Pour son estimation, différentes méthodes basées sur des équations
empiriques existent : ([9] in FISAT II), [18], (in [19]) et [20]. Nous avons utilisé la
première approximation et les trois dernières qui tiennent compte des paramètres de
croissance de l’espèce étudiée et de la température moyenne des eaux fréquentées par le
poisson au moment de sa capture. Le taux d’exploitation est définit par [21] comme étant la
quantité (14):
E = F/(F + M) = F/Z. (14)
La dynamique de la population est décrite à travers celle de chaque cohorte, en tenant
compte des phénomènes élémentaires de recrutement, de croissance et de mortalité naturelle
ou par pêche (in [22]).
Par ailleurs, selon [23] l’analyse de cohortes, largement utilisée dans le domaine
d’évaluation des stocks d’animaux aquatiques, est considérée comme l’une des méthodes
les plus performantes en matière de modélisation analytique ; elle repose sur l’analyse de la
structure démographique des captures (répartition par âge ou par tailles), en admettant que
le recrutement et les mortalités par pêche aux différents âges et tailles restent constants.
L’estimation de la structure démographique des captures est fondée aussi bien sur les
données collectées lors de l’échantillonnage que sur celles de la production qui sont
extraites des «statistiques des pêches maritimes».
D’après [24], l’objectif principal de l’ APV est la détermination de l’effectif (Nt) d’une
cohorte ainsi que les coefficients de mortalité par pêche (F) pour les différentes classes de
taille ou groupes d’âge, en tenant compte aussi bien des captures par classe que des pertes
d’origine naturelle. Les résultats sont obtenus sur la base de la connaissance des captures
par classe, d’une estimation du taux de mortalité naturelle (M) considéré comme constant et
d’une évaluation de la mortalité par pêche pour la classe finale (Fterm).
A partir du poids moyen (W) des individus à chaque âge selon une fonction de croissance
de [25] et de la relation taille-poids, on peut passer des effectifs aux biomasses (15):
Bi = ∑ Bi, i+1 = ∑ (Ni, i+1 * Wi, i+1)
(15)
Bi : biomasse
Ni et Ni+1: effectif de la classe i et i + 1, sachant que Ni = No * e– Zt
Wi et Wi+1 : poids en grammes de la classe i et i + 1
No : effectif d’une cohorte au temps t = to
De même, on peut passer des captures en nombres (C) aux captures en poids. Il est possible
également d’obtenir les âges et tailles critiques pour lesquelles la cohorte atteint sa
biomasse maximale relativement au niveau actuel d’exploitation du stock.
L’âge critique (tc) est donné par l’équation (16): tc = to + (1/K) Ln [3 (K/M) + 1] (16)
La taille critique du stock est déduite de l’équation de croissance linéaire de Von
Bertalanffy avec t = tc [10].
D'autre part, le traitement fait appel à la production annuelle de S. maena à la pêcherie
d’Alger (moyenne estimée d’après les statistiques officielles) et à des résultats déjà acquis
précédemment comme :
- la distribution des fréquences de taille globale
- les proportions des individus matures par classe de taille.
Comme il n’existe pas de différence significative de croissance entre les mâles et les
femelles, nos estimations ont été effectuées sans distinction de sexe.
L’équation de la croissance linéaire retenue est celle à sexes confondus, obtenue par analyse
des structures de taille :
Lt = 23.68 (1 – e- 0.33 (t + 0.54)).
L’approximation de [14] pour la détermination de L a donné les résultats suivants
(tableau, 1) :
Tableau 1 – Détermination de L de S. maena selon la méthode de [14]
22.10
L (cm)
Lmax. (cm) 21
* Valeurs de L retenues
22.63
21.5
23.68*
22.5
21.58
20.5
L’évaluation du coefficient de catabolisme (K) par la méthode de [15] repose sur les
données fournies par la littérature régionale disponible. Pour l’utilisation de la méthode, le
manque d’information concernant S. maena nous a conduit à utiliser des données
préliminaires antérieures (tableau, 2) :
Tableau 2 – Paramètres régionaux disponibles de S. maena
Données
Thalassa
Antérieures
Année
1982
1989
Région
Alger
Alger
L (cm)
18.82
34.4
K (ans –1) Ø’
0.51
2.26
0.16
2.28
Ces résultats donnent un Ø’=2.27 et une valeur de K de 0.33 ans –1. Le paramètre to=- 0.54
est calculé à partir de l’équation empirique proposée par [14] en remplaçant dans
l’expression, L et K par leur valeur respective.
Concernant la relation taille-poids, les équations établies par sexe et pour l’ensemble des
individus sont :
Pour les femelles,
Pour les mâles,
Pour l’ensemble,
We = 0.0048 LT 3.27
We = 0.0067 LT 3.15
We = 0.0072 LT 3.12
r = 0.98,
r = 0.98,
r = 0.98.
On remarque que les valeurs du paramètre b restent voisines de 3 quel que soit le sexe.
Globalement, la croissance en poids peut être considérée comme isométrique. Le tableau 3
donne la correspondance taille-poids théorique de S. maena par sexe avec un intervalle de
classe de longueur de 2 cm. La figure 2 qui représente le poids éviscéré en fonction de la
longueur totale du poisson, montre que la croissance est presque identique chez les deux
sexes. Mais, entre 10 et 14 cm, le poids paraît croître légèrement plus vite que la taille chez
les mâles. A partir de 18 cm, la situation s’inverse.
Tableau 3 – Correspondance taille-poids (en gramme) de S. maena
LT (cm)
Femelles
Mâles
Ensemble
10
8.94
9.46
9.49
12
16.22
16.81
16.76
14
26.86
27.31
27.12
100
18
61.09
60.28
59.40
20
86.22
84
82.52
Equation d’ensemble
We = 0.0072 LT 3.12
r = 0.98
80
60
Poids (g)
16
41.56
41.60
41.13
40
20
0
10
12
14
16
18
20
Femelles
Mâles
Ensemble
Taille (LT en cm)
Figure 2 : Relation taille-poids de S. maena
Les équations de croissance en poids calculées sont les suivantes :
Pour les femelles,
WT = 79.9 (1 – e – 0.41 (t +0.63)) 3.27,
pour les mâles,
WT = 81.11 (1 – e – 0.46 (t +0.48)) 3.15,
pour l‘ensemble,
WT = 89.28 (1 – e – 0.40 (t +0.59)) 3.12.
Les expressions ci-dessus ont permis de dresser le tableau de correspondance âge-poids par
sexe (tableau 4). La figure 3 représente les courbes de croissance pondérales théoriques. A
âge égal et en particulier à partir de 1.5 ans, les poissons mâles montrent une croissance en
poids, un peu plus rapide que les femelles.
Tableau 4 – Correspondance âge-poids de S. maena
Age
(ans)
0.5
1.5
2.5
3.5
4.5
5.5
6.5
7.5
8.5
Femelles
3.17
13.64
27.65
41.11
52.20
60.62
66.69
70.95
73.88
Poids (g)
Mâles
3.43
16.29
32.52
47.03
58.15
66.01
71.34
74.84
77.11
Ensemble
3.37
14.91
30.28
45.13
57.46
66.91
73.80
78.68
82.08
90
80
W
Equation d’ensemble
WT = 89.28 (1–e – 0.40 (t + 0.59)) 3.12
70
Poids total (g)
60
50
40
30
20
10
0
-10
0.5 1.5 2.5 3.5 4.5 5.5 6.5 7.5 8.5
Femelles
Mâles
Ensemble
Age (année)
Figure 3 – Courbes de croissance pondérale de S. maena (modèle de Von Bertalanffy)
Les poissons les plus âgés et les plus jeunes individus sont souvent mal représentés dans les
échantillons, ce qui peut influencer les ajustements statistiques. Par exemple, selon [26]
l’insuffisance des poissons de petite taille majore les valeurs du coefficient de décroissance
K. Néanmoins, l’approche dans la connaissance de la croissance de S. maena à partir de
l’analyse des structures de taille, a révélé de bons ajustements aux données observées et a
permis de retenir les meilleures équations de croissance. Aussi bien pour les sexes séparés
que pour l’ensemble des sexes, il est noté une diminution régulière du taux de croissance
des longueurs moyennes dans les clés âge-longueurs rétro calculées. Ce taux chute
rapidement au cours des premières années de vie du poisson et beaucoup plus lentement
durant les dernières années. Quelque soit le sexe, S. maena présente une longévité observée
de 4.5 années pour une taille moyenne de 17.86 cm, ce qui est relativement court par
rapport à d’autres espèces. C’est le cas des poissons pélagiques, la plupart des espèces
démersales ont une vie beaucoup plus longue.
Pour la croissance pondérale, il ressort des courbes établies le même schéma que pour la
croissance linéaire. Il existe cependant, au delà de la première année de vie, une petite
différence d’accroissement en poids en faveur des mâles pour un même âge.
La comparaison de nos résultats avec ceux des autres auteurs, obtenues dans diverses
régions méditerranéennes, s'avère difficile. En effet, les données disponibles concernent
seulement S. smaris (in [27]) et ‘‘S. flexuosa’’ [6] dans les eaux Tunisiennes. De plus, les
méthodes d’étude diffèrent et les intervalles de validité des équations obtenues n’ont pas été
mentionnés.
Notre choix s’est porté sur Z=0.70 an –1, valeur maximale obtenue pour la mortalité totale.
Pour la mortalité naturelle, nous avons retenu M=0.37 an –1, donnée par la méthode de [20],
qui a été établie sur la base des paramètres de croissance et de mortalité de 56 stocks de
poissons vivant en Méditerranée parmi lesquels se trouvent S. maena et S. smaris. Par
ailleurs, [18] estime la mortalité naturelle de 175 stocks de poissons et montre que la valeur
modale de celle-ci se situe entre 0.2 et 0.3. Il a remarqué qu’une mortalité naturelle de 0.42
était déjà relativement élevée. Ce qui indique que l’espèce est soumise probablement à une
forte prédation. Il s’agit là d’une caractéristique des petits pélagiques qui présentent, comme
S. maena, une croissance rapide à longévité courte et une mortalité naturelle forte. La
mortalité par pêche (F) a été estimée dans ce travail à 0.33 an –1; elle reste toujours
inférieure à la mortalité naturelle et le taux d’exploitation (E) de S. maena des côtes
algériennes est de l’ordre de 0,47. Cette valeur reflète, à priori, une situation d’exploitation
équilibrée de sa pêche.
Les valeurs des indices, récapitulées dans le tableau 5, sont les paramètres requis d’entrée
pour le programme VIT.
Tableau 5 – Paramètres retenus pour S. maena dans le traitement de l’APV
Paramètres L∞
K
to
a
b
M
Fterm
-1
-1
(cm) (an ) (an)
(an ) (an-1)
Valeurs
23.68 0.33 - 0.54 0.0072 3.12 0.37 0.33
L’analyse du rendement par recrue, traité à l’aide du logiciel VIT, donne une estimation de
la biomasse du stock vierge de S. maena (facteur effort = 0) de 383 tonnes.
Les résultats des différents rendements en fonction du facteur effort sont résumés dans le
tableau 6 et représentés sur la figure 4. On peut faire les remarques suivantes :
- selon le ‘‘VIT4 Win’’, le facteur effort (1) correspond au niveau actuel ( ) d’exploitation ;
le rendement par recrue est de 14.4g pour une biomasse par recrue de 76g et une biomasse
par recrue du stock reproducteur de 71.8g,
- le facteur effort 2 représente le dédoublement de l’effort de pêche et le maximum de
rendement possible ou soutenable (MSY, production maximale équilibrée) est atteint à 4.5
avec une valeur maximale de Y/R = 20.213g. Au delà, le rendement reste constant pour
chuter ensuite.
Tableau 6 – Rendement par recrue (Y/R), biomasse par recrue (B/R) et biomasse du stock
reproducteur par recrue (SSB/R) en fonction du facteur effort pour S. maena (VIT4 Win)
Slope at origin Virgin biomass Method Num_points
25.6387
383036088.10
Calc. Mean wt. 20
Factor
Y/R
B/R
SSB/R
* Factor
0.000
0.000
111.56
106.94
* 2.750
0.250
5.472
99.823 95.324
* 3.000
0.500
9.436
90.287 85.905
* 3.250
0.750
12.320
82.471 78.201
* 3.500
1.000
14.427
76.001 71.836
* 3.750
1.250
15.973
70.590 66.526
* 4.000
1.500
17.111
66.020 62.053
* 4.250
1.750
17.953
62.123 58.249
* 4.500
2.000
18.578
58.767 54.981
* 4.750
2.250
19.041
55.850 52.149
* 5.000
2.500
19.386
53.292 49.674
*


Resolution
0.250
Y/R
19.641
19.829
19.965
20.063
20.131
20.175
20.201
20.213
20.213
20.204


Max factor of effort
5.000
B/R
SSB/R
51.030
47.491
49.015
45.551
47.205
43.814
45.569
42.248
44.081
40.828
42.719
39.532
41.466
38.343
40.309
37.246
39.234
36.231
38.232
35.286




Y/R en grammes
Y/R
MSY
Niveau actuel
d’exploitation
Facteur effort
Figure 4 : Rendement par recrue (Y/R) en fonction du facteur effort pour S. maena (‘‘VIT4 Win’’)
Les tableaux 7 et 8 présentent les principales caractéristiques des captures subies par le
stock moyen annuel de S. maena débarquée à la pêcherie d’Alger.
Tableau 7– Données générales de l’APV par classe de taille pour S. maena (VIT4 Win)
Centre de Limite
classe (cm) inférieure
de
l’âge
(ans)
11
1.123
13
1.602
15
2.171
17
2.872
19
3.786
21
5.102
+
7.478
Age
moyen
(ans)
Limite
Taille
inférieure de moyenne
la taille
(cm)
(cm)
10
10.996
12
12.991
14
14.987
16
16.975
18
18.913
20
20.861
22
----
1.355
1.875
2.503
3.295
4.340
5.975
----
Limite
inférieure
du poids
(g)
9.491
16.764
27.118
41.133
59.399
82.518
111.094
Poids
moyen
(g)
Maturité
sexuelle
(fréquence)
12.880
21.611
33.704
49.657
69.525
94.344
----
0.96
0.92
0.89
0.91
0.99
1
----
Tableau 8– Captures en nombre et en poids par classe de taille pour S. maena (VIT4 Win)
Centre de 11
13
15
17
classe
Capt. en 14580. 85399. 97876.7 15205
nombre
3
3
2.4
Capt. en
18780 18456 329948 75505
poids (g) 1.8
06.3
6.6
09
Capt. : Capture ; moy. : moyen/moyenne
19
21
Total
Age moy.
(an)
320768. 152052.4 822749 3.92
1
.4
223014 1434517 495300 ---22.7
3.2
00
Taille moy.
(cm)
17.69
----
Les données générales de captures du stock de S. maena dans le traitement de l’APV au
‘‘VIT4 Win’’ montrent que :
- l’âge moyen des individus capturés varie de 1.35 à 5.97 ans pour des centres de
classe allant de 11 à 21 cm et l’âge moyen global est de 3.92 ans,
- la taille moyenne des poissons pêchés va de 10.99 à 20.86 cm avec une longueur
moyenne globale de 17.69 cm,
- le poids moyen se situe entre 12.88 et 94.34 g pour les individus les plus grands.
3.5e5
2.4e7
e=10
3e5
Captures en nombre
1.6e7
2e5
1.2e7
1.5e5
1e5
8e6
50000
4e6
Captures en poids (g)
2e7
2.5e5
Nombre total :
822749.48
Poids total :
49530000 g
Captures en nombre
0
0
11
13
15
17
19
21
Captures en poids
Centre de classe (cm)
Figure 5 – Evolution des captures en nombre et en poids en fonction des centres de classe de taille de S.
maena (VIT4 Win)
La figure 5 montre, globalement, une allure identique des deux types de courbe, avec une
capture en nombre et en poids modales à 19 cm de taille centrale. La figure 6 donnent les
effectifs initiaux et moyens du stock actuel des survivants de S. maena ainsi que la masse
moyenne et initiale par classe de longueur ; il s’agit du nombre et du poids du stock des
4e6
7.5e7
7e7
6.5e7
6e7
5.5e7
5e7
4.5e7
4e7
3.5e7
3e7
2.5e7
2e7
1.5e7
1e7
5e6
0
Bmax
3.5e6
3e6
Ninitial
2.5e6
2e6
1.5e6
1e6
R
5e5
0
11
13
15
17
19
21
Winitial
poissons qui ont échappés à la mortalité naturelle et par pêche. Ainsi la masse du stock croît
progressivement pour atteindre une valeur maximale à 17 cm de longueur totale et diminuer
ensuite. Concernant l’effectif initial (stock des survivants), il diminue avec l’augmentation
de la taille des individus. La biomasse maximale (Bmax) correspond donc aux effectifs de
la classe de taille de 17 cm et le recrutement (R) se situe autour de 11 cm.
Ninitial
Winitial
Centre de classe (cm)
Figure 6 – Evolution des effectifs et des poids initiaux en fonction des centres de classe de taille du stock
de S. maena (VIT4 Win)
Le taux moyen d’exploitation du stock de S. maena est de : E = F / Z = 0.384, cette valeur
indique une exploitation modérée de l’espèce. Par ailleurs, le traitement des données de
l’APV fournit l’âge critique et la longueur critique du stock actuel et du stock vierge : les
valeurs sont identiques pour les deux types de stock, 2.87 ans et 16 cm et sont inférieures
aux indices moyens de capture (âge et taille moyens de capture du stock : 3.92 ans et 17.69
cm). D’après [28], si l’on veut tirer d’un stock d’une espèce donnée une production élevée,
il est souhaitable que l’âge moyen des captures ne soit pas trop inférieur à l’âge critique.
L’âge critique et la taille critique du stock indiquent le moment où la biomasse du stock
d’une cohorte est maximale et donc le temps t pour lequel l’exploitation peut être optimale.
Le diagramme ci-dessous présente les différentes biomasses (tableau 9). La biomasse totale
équilibrée notée D (balance de biomasse renouvelée durant une année) est égale à 146
tonnes environ ; cette valeur correspond à l’hypothèse d’équilibre du stock, elle est
constituée de 22.31% de biomasse relative aux recrues mais surtout d’une plus grande
proportion (77.69%) due au facteur croissance. Ce sont les deux composantes d’entrée dans
le stock de S. maena. Concernant les sorties, la mortalité naturelle (66.09%) représente le
paramètre le plus important, il est deux fois plus grand que le paramètre mortalité par pêche
(33.91%). Ainsi, si le taux de croissance de S. maena est le facteur dominant dans le gain en
biomasse du stock de l’espèce, la mortalité naturelle est la cause essentielle dans la perte en
poids.
D’autre part, la capture totale moyenne annuelle de l’espèce débarquée à la pêcherie
d’Alger s’est élevée à 49.53 tonnes ; elle constitue un rapport exprimé en pourcentage de
33.90% avec la biomasse totale équilibrée (D) et 18.98% avec la biomasse moyenne du
stock des survivants (Bmoy.). Le rapport de la biomasse des recrues avec celle de la
biomasse moyenne du stock actuel paraît assez faible (12.49%). La quantité D/Bmoy. =
55.98%, dite ‘‘turnover’’ dans l’APV, indique que la biomasse moyenne du stock des
survivants ou stock actuel (261 tonnes, environ) représente le double de la biomasse totale
équilibrée (D). Il traduit l’importance du renouvellement annuel de la biomasse du stock.
Cette situation incite à l’augmentation de l’effort de pêche pour la capture supplémentaire
de la moitié de la biomasse du stock de S. maena, sans porter atteinte au renouvellement et
à la reconstitution annuelle de celui-ci au moins durant la période d’échantillonnage. Le
pourcentage Bmax./Bmoy.= 25.92, reflète la contribution relativement importante de la
biomasse produite par la classe de taille et âge critique du stock actuel (16 cm et 2.87 ans
environ) par rapport aux autres classes de longueur. La proportion Bmax./D = 46.29, proche
de la moitié, représente la biomasse maximale exploitée (67.62 tonnes) par rapport à la
biomasse totale équilibrée. Ce qui confirme l’importance de l’exploitation de la classe de
taille 16-17 cm. La biomasse moyenne par recrue (Bmoy./R) est estimée à 76 g pour une
valeur de 71.84 g de la biomasse du stock reproducteur par recrue (SSB/R) et un rendement
par recrue (Y/R) égale à 14.43 g sont les autres informations fournies par l’APV traitée au
programme‘‘VIT4 Win’’.
Ce stock est pêché modérément selon les résultats de l’APV et l’effort pourrait être
augmenté sans problème si la pêche était monospécifique.
Tableau 9 – Biomasses de S. maena, traitement de l’APV (VIT4 Win)
Stock de S. maena
Biomasse totale équilibrée (D) en grammes (bilan à l’équilibre)
146072289.65
Biomasse
Pourcentage
Recrutement (R) 32585936.27
Croissance
113486353.39
96542289.65
49530000.00
Entrée
22.31
77.69
66.09
33.91
Sorties
Mortalité naturelle
Mortalité par pêche
s
Rapports (%)
R / Bmoy. = 12.49
D / Bmoy. = 55.98
Bmax. / Bmoy. = 25.92
Bmax. / D = 46.29
Bmoy. = 260925107.17 g (biomasse moyenne du stock des survivants ou stock actuel)
Bmax. = 67622524.09 g biomasse maximale
CONCLUSION
Malgré l’importance économique que représentent certaines espèces, les études
d’évaluation de leur stock restent rares en Algérie. L’application de la dynamique des
populations aux stocks exploités a été mise au point pour les zones tempérées de
l’Atlantique Nord en vue de modéliser la pêche industrielle exploitant une seule espèce avec
un seul engin pour une meilleure gestion des pêcheries. De petits changements dans les
paramètres de croissance utilisés risquent d’affecter grandement et d’une manière cumulée
les résultats dans les expressions empiriques et donc l’estimation des mortalités. Mais au
delà de ces résultats préliminaires sur ces quelques indices et en l’absence de données
similaires émanant d’autres auteurs en Méditerranée, il est indispensable de noter qu’ils
méritent amplement d’être confirmés avant de les intégrer définitivement avec les autres
paramètres dans un modèle d’exploitation du stock de l’espèce.
Nos conclusions ne sont à considérer que dans la mesure où les hypothèses sur les modèles
analytiques sont satisfaites. Si les techniques employées sont performantes pour estimer les
états des stocks, les évaluations qu’elles fournissent sont sensibles à ces hypothèses, sachant
que c’est surtout la fiabilité des prévisions qui intéresse les pêcheurs et les gestionnaires.
Les études de sensibilité des résultats en fonction des différents paramètres introduits dans
le modèle sont donc intéressantes à mener. Les techniques utilisées ainsi que le logiciel
récent, méritent de donner lieu à des recherches similaires et d’être étalés à d’autres
espèces, plus importantes économiquement et qui n’ont pas été étudiées à ce jour. Ils
devraient permettre, en tout les cas, dans un second temps, de conduire à des études
comparatives suivant les engins de capture, les secteurs de pêche et ainsi de mieux gérer les
stocks plurispécifiques en prenant les mesures d’aménagement qui s’imposent.
Les résultats de l’analyse des populations virtuelles obtenus, nous ont permis d’établir une
première estimation de la biomasse exploitée de S. maena débarquée à la pêcherie d’Alger.
Le nombre total moyen d’individus a été estimé à environ 685*10 4 spécimens. En poids, la
biomasse totale moyenne est évaluée à environ 261 tonnes réparties suivant 6 classes de
tailles. Le taux moyen d’exploitation du stock de S. maena est de 0.384 indiquant une
exploitation modérée de l’espèce. L’âge critique et la longueur critique du stock actuel et du
stock vierge sont identiques pour les deux types de stock, 2.872 ans et 16 cm et sont
inférieures aux indices moyens de capture. Ces paramètres du stock indiquent le moment où
la biomasse du stock est maximale et donc le temps t pour lequel l’exploitation peut être
optimale. Le taux de croissance de S. maena est le facteur dominant dans le gain en
biomasse du stock de l’espèce, la mortalité naturelle est la cause essentielle dans la perte en
poids.
REFERENCES
[1] Lalami Y., 1970. - Contribution à l’étude systématique, biologique, écologique et statistique des poissons
de la pêcherie d’Alger. Thèse Doct. 3e cycle. Pelagos, 3 (4) : 150p.
[2] Zei M., 1941. - Studies on the morphology and taxonomy of Adratic species of Maenidae. Acta
Adriatica Split. 2: 134-191.
[3] Lozano Cabo F., 1951. - Nota preliminare Sull identificazion di ‘‘Spicara smaris (Linné, 1758)’’ e
‘‘Spicara alcedo (Facciola, 1918)’’, come-sessi differenti di una medisima specie, con processo
d’inversione sessuale. Atti. Accad. Lincei, 11 (1-2): 127-132.
[4] Lamas C., 1979. - Estudio de la biologia de la xucla (Spicara chryselis) del ne Espana. Inv. pesq. 43 (3) :
581-590.
[5] Sellami A. & Bruslé J., 1979. - Contribution à l’étude de la pêche, de la sexualité et de la
reproduction de la mendole Maena maena (Linné, 1758), Téléostéen, Maenidé des côtes
tunisiennes. Mém. Biol. Mar. Océan. 9 (4) : 91-109.
[6] Hattour A., Turki B. & Zammouri N., 1985. - Quelques aspects de la biologie de l’espèce Spicara flexuosa
(Rafinesque, 1810) des eaux tunisiennes. Bull. Inst. Natio. Scient. Tech. Océanogr. Pêche,
Salammbô, 12 :143-162.
[7] Mytilineou C., 1988. - L’hermaphrodisme et le cycle sexuel de la gerle, Spicara flexuosa (Rafinesque,
1810), Centracanthidae, dans le golfe de Patraikos, Grèce. Rapp.C.I.M.M., 31 (2): 272 p.
[8] Miniconi R., 1994. - Les poissons et la pêche en Méditerranée. La Corse. Ed. Alain Piazzola et la Marge.
2: 309-312.
[9] Gayanilo F.C. Jr., Sparre P. & Pauly D., 2002. - The FAO-ICLARM Fish Stock Assessment Tools (FISAT
II, user’s guide) 2000-2004 FAO, Rome, Italie. Version 1.1.2. 173p.
[10] Lleonart J. & Salat J., 1992. - VIT, un programa para analisis de pesquerias. Inf. Tech. Sci. Mar., 116p.
[11] Maynou F., 1999. - ‘‘VIT 4 Win’’. Windows version 1999-2000. Software for fisheries analysis. Institut
de Ciències Del mar (CSIC). Barcelona, Spain. User’s manual, version 1.1, FAO : 21p.
[12] Wetherall J.A., 1986. - A new methods for estimating growth and mortality parameters from length
frequency data. Fishbyte, 4(1): 12-14.
[13] C.G.P.M., 1985. - Rapport de la quatrième consultation technique sur l'évaluation des stocks dans les
divisions statistiques Baléares et Golfe de Lion. Alger, 16-21 Novembre 1985. FILP R 347: 231p.
[14] Pauly D., 1985. - Quelques méthodes simples pour l’estimation des stocks de poissons tropicaux. FAO
Doc. Tech. Pêches, (234): 56p.
[15] Pauly D., & Munro J. L., 1984. - Once more on the comparison of growth in fish and invertebrates.
ICLARM Fishbyte, 2 (1) : 21.
[16] Munro J.L., 1983. - Caribbean coral reef fishery resources. ICLARM Stud. Rev. (7): 276p.
[17] Laurec A. & Leguen J.C., 1981. - Dynamique des populations exploitées. Concept et modèles. Rapp. Sci.
Tech., CNEXO, 1 (45) : 118p.
[18] Pauly D., 1980. - On the interrelation ships between natural mortality, growth parameters and mean
environmental temperature in 175 fish stocks. J. Cons. C.I.E.M., 39 (2): 175-192.
[19] Stergiou K.I. & Papaconstantinou C., 1993. - Natural mortality of red bandfish, Cepola macrophtalma
(L.), in the Aegean Sea (Greece): comparison of direct and indirect estimation methods. Fisheries
Research, 16: 347-361.
[20] Djabali F., Brahmi B. & Mammasse M., 1993. - Poissons des côtes Algériennes. Pelagos ; Bull. Inst. Des
Sciences de la mer et de l’aménagement du littoral. 215p.
[21] Pauly D., 1984. - Length converted catch curves: a powerfull tool for fisheries research in the tropics
(part II), Fishbyte, 2 (1): 9-17.
[22] Sparre P. & Venema S. C., 1996. - Introduction à l’évaluation des stocks de poissons tropicaux. Prem.
Part. Manuel. FAO Doc. Tech. Pêches, Rome 306 (1): 401p.
[23] Ghorbel M., Jarbaoui O. & Bouan A., 1997. - Evaluation du stock de pageot (Pagellus erythrinus,
Sparidae) dans le Golfe de Gabès (Tunisie) par analyse de pseudo- cohorte. Cybium, 21 (1): 55-65.
[24] Jones R., 1984. - Assessing the effects of changes in exploitation pattern using length composition data
(with notes on VPA and cohort analysis). FAO. Fish. Tech. Pap. (256): 118p.
[25] Bertalanffy L. V., 1938. - A quantitative theory of organic growth. (Inquiries on growth laws II). Hum.
Biol. 10 : 181- 213.
[26] Daget J., 1972. - Lois de croissance linéaire et pondérale. Mortalités, structures démographiques.
Modèles linéaires de Schaefer et modèles exponentiels de Fox. Doc. Sc. Centre de Pointe Noire,
ORSTOM, (28) : 58p.
[27] C.G.P.M., 1980. - Captures nominales 1968-1978. Bulletin statistiques. Conseil général des pêches pour
la Méditerranée, FAO, Rome : (3) 1-124.
[28] Dardignac J., 1989.-La pêche des juvéniles, ses effets sur la ressource et son renouvellement. Mag. des
ressources vivantes de la mer. IFREMER., Equinoxe. (26): 11- 18.
Reproductive Cycle of the Sea Cucumber Holothuria tubulosa
(Holothuroidea: Echinodermata) in the Southwestern Mediterranean Sea
Reproductive cycle of the sea cucumber Holothuria tubulosa
1
Mezali K.1* ; Soualili D. L.1,2
Departement des Sciences de la Mer et d’Aquaculture, Faculté des Sciences de la Nature et de la Vie, UMAB,
Université de Mostaganem, Mostaganem, Algeria - Email: [email protected]
2
CNRDPA, Bou Ismaïl, Algeria
SUMMARY
Aspidochirotid holothurians, commonly known as "sea cucumbers", are conspicuous component of Posidonia
oceanica meadows of the Mediterranean Sea, where they are reported as generally large sized and rather
abundant. They actively contribute to the functioning of the Posidonia meadow by recycling dead organic
matter in the sediments layer, which confers them a major ecological role. This study is a first contribution on
the reproductive biology of Holothuria tubulosa (Gmelin, 1790) collected from the South-Western
Mediterranean, especially from the Algiers coastal area. The sampling was conducted in Ain Taggourait
station (w. Tipasa) which is an unpolluted area under little anthropogenic influence. The temporal evolution
of the gonad index (GI) and the sexual maturity stages suggest that the reproductive cycle of H. tubulosa is
annual and marked by a main spawning taking place from June to august. We also show the synchronization
of the maturation of gonads in both sexes of this species. The influence of temperature is the most likely factor
influencing its reproductive cycle and the spawning of H. tubulosa. The general outline of the gametogenesis
of H. tubulosa shows a winter sexual resting phase, followed by maturation in spring and spawning at the end
of summer until a middle of autumn.
Keywords: Holothurians, Aspidochirotida, H. tubulosa, reproduction, spawning, maturity, gonad index,
Posidonia oceanica, Algerian basin.
INTRODUCTION
Aspidochirotid holothurians, commonly known as “sea cucumbers”, are major
representatives of the benthic macrofauna of the Posidonia oceanica habitat of the
Mediterranean Sea ([1]; [2]). Within this habitat, holothurians contribute to the recycling of
organic matter ([3]; [4]; [5]; [6]). Few studies were devoted to their life cycle ([7]; [8]; [9];
[10]). Holothuria tubulosa the most common species, and the "best known" species in the
Mediterranean Sea, is not one species, but two cryptic species that have not been previously
recognized or even suspected ([11]). Studies on the reproduction of H. tubulosa are
anecdotic. The study carried out by [8] in the Adriatic Sea was limited to observation of the
external appearance of the oocytes. [12] discovered a new and highly effective oocyte
maturation inducer for in vitro fertilization of the oocytes of H. tubulosa collected from
Banyuls-sur-Mer (France). In Algeria, aspects of the reproductive cycle have been studied
only for Holothuria (Platyperona) sanctori ([10]). The interest in H. tubulosa comes from
the abundance of this species in Algerian shallow waters, especially in unpolluted areas
such as Ain Taggourait.
The present study examines the macroscopic and microscopic aspects of gonad maturation
of H. tubulosa to determine its reproductive cycle at Ain Taggourait site.
Sampling sites
Ain Taggourait site (36°36.608′N, 002°36.995′E) was selected as a reference site for the
study of the reproduction of H. tubulosa. This site is located at Bou Ismail Bay (Figure 1). It
is more open bay, and is much more exposed to the winds coming from the northeast and
northwest sector, which generate swells of high amplitudes ([13]). It is more distant from
the industrialized area, which reduces the impact of industrial and domestic pollution.
Underwater observations revealed that at Ain Taggourait site the algal coverage and the P.
oceanica meadow are dense ([10]).
Figure 1. Location of the sampling site (© 2012 Google earth)
The biological material was sampled using scuba diving at depths ranging from -3 to -10 m.
For each monthly sample, the sea water temperature was recorded using a SUNTO GEKKO
dive type computer (precision 0.5 °C). Individuals of H. tubulosa collected in the field were
kept in a tank filled with sea water until processing in the laboratory.
Reproductive parameters
The sampled holothurians were measured (+/−0.5 cm) dorsally from the mouth to the cloaca
using a Ribbon meter. Subsequently, specimens were dissected by longitudinal incision on
their ventral side along the interradial. When possible, sex determination was done
macroscopically, the ovary was usually yellow or orange red, and the testes whitish. The
gonad was weighted (drained weight, Wg ± 0.01 g) and then fixed in aqueous Bouin’s
solution for 24–48 h. Subsequently, the samples were rinsed in successive baths of ethanol
and preserved in ethanol (70%) for histology according to the protocols of [14] and [15].
All the internal organs of an individual were removed to obtain the eviscerated body weight
(eBW ± 0.01 g). Therefore, the eBW included the weight of the body wall, the longitudinal
muscles, and the buccal bulb ([16]; [17]). Approximately, 15 adult individuals were
sampled each month during two years (from march 2010 to march 2012). Two approaches
were used to determine the reproductive cycle of H. tubulosa: (1) gonad index (GI) survey
and (2) histological study to allow the temporal monitoring of the microscopic stages of
gonad maturity. The GI was calculated by the following formula ([18]; [19]; [20]; [21];
[22]:
IG =
= weight of the gonad ; GBW= Gutted body wall.
For the microscopic analysis, the conventional topographic dyes Mann-Dominici (1894–
1905 in [15] and Trichrome on one time ([23]) were used for the determination of the
microscopic stages of maturity. They were based on histology and on those of ([24]; [25];
[16]) and [9]: Stage I: sexual resting (resting or indeterminate tubules); Stage II: recovery
and maturing (increasing tubules); Stage III: mature (ripe tubules); Stage IV: spawning
(partly emptied tubules); Stage V: spent (empty tubules).
Once the homogeneity of variances had been verified, differences in the values of the GI by
seasons and years were conducted using a two-factor ANOVA (p < 0.05). The average
values of the GI were analyzed by a Mann and Whitney test. A Spearman test was used to
analyze the existing correlation between the GI and temperature. All statistical analyses
were performed using STATGRAPHICS and STATISTICA 7.
RESULTS
Reproductive biology
A total of 367 individuals of H. tubulosa were sampled in Ain Taggourait site. During our
sampling, 18 individuals lacking gonads were found in the fall and spring. To understand
the variability of the reproductive cycle of H. tubulosa at the studied site, the gonad index
data of males and females were pooled and the percentages of individuals at stage V
examined (Figure 2).
Figure 2. Monthly gonad index means of H. tubulosa (pooled sex), monthly mean temperature, and the
percentage of individuals observed at stage V (post-spawning) at the site of Ain Taggourait. GI: Gonad
Index; M: Male; F: Female; T: Temperature.
At the studied site, the reproductive cycle was marked by a period of gonad growth in early
spring, followed by two gamete emissions, the first in the spring and the second massive in
summer. Both marked by the fall in the gonad index (Figure 2). Moreover, the spawning
spread till the end of fall. The period of sexual resting in the winter was marked by the low
GI values. Furthermore, the main and massive spawning of H. tubulosa was confirmed by
the presence of individuals in stage V (post-spawning) (Figure 3) and the low GI values in
the fall.
However, we noted that a period of a high temperature rise during the two years at the site
of Ain Taggourait (22–24.5 °C in 2010 and 20–23 °C in 2011) coincides with the period
where the GI of H. tubulosa decreases (Fig. 2). The correlation between the evolution of the
GI and the temperature is significantly confirmed for Ain Taggourait site (p > 0.01).
Figure 3. Maturity stages of the tubules of H. tubulosa gonads (sexes pooled) at the site of Ain
Taggourait from March 2010 to March 2012. Histograms show percentages of individuals in one of the
four gametogenic stages.
DISCUSSION
Holothuria tubulosa is a gonochoric species without external sexual dimorphism. The sex
can be determined macroscopically by the appearance and color of the gonads ([8]; [9]). In
this study, the gonad index of H. tubulosa shows that the reproductive cycle of this species
is annual, with spawning starting in the spring, peaking in the summer, and ending in the
fall, marked by maximum values of the GI in early summer and the minimum values at the
end of the autumn. The maximum values of the GI were obtained in summer (June to July)
(Figure 2). The mean GI obtained at Ain Taggourait is higher than that obtained for other
species like H. sanctori in the Canary Islands where the individuals were smaller ([9]). A
good similarity of the temporal change of the GI and the stages of maturation of the gonads
has been reported for various aspidochirotid holothurians ([18]; [26]; [17]). Therefore, a GI
survey is a reliable method for describing the reproductive cycle. In general, holothurians
have an annual reproductive cycle ([24]; [27]; [28]; [29]; [30]; [31]; [18]; [32]; [33]; [34]);
although semi-annual cycles have been described by some authors ([27]; [18]) or even the
presence of a continuous reproduction throughout the year ([27]) which can occur
especially in the tropical regions. In the studied site the changes in the GI coincided with
that of the sea water temperature and/or photoperiod (Spearman test, p > 0.01) and the
gonad development seemed to be induced by the gradual warming of the water. This
suggests that if temperature and/or photoperiod are important factors in reproductive timing,
they work in an absolute (threshold) pattern rather than in a relative one ([35]; [36]).
Moreover, the presence of stage II throughout the sampling period, with the exception of
the summer-autumn (July to October), suggests that gonad maturation occurs throughout
the year with a slowdown during the winter (figure 3). The main spawning is massive in the
summer–autumn and coincides with the elevation of the sea water temperature (Spearman
test, p < 0.05); an average temperature rise of 2 °C between June and July was observed
during the two years (22–24.5 °C in 2010 and 20–23 °C in 2011) and coincides with the
decrease of the GI and the presence of a high percentage of individuals of H. tubulosa with
partially spawned gonads. However, during the two years (27 and 28 °C, respectively, in
August 2010 and 2011), a high temperature rise coincided with the period where individuals
of H. tubulosa had a minimum GI value and were in the post-spawning stage (figure 3). The
slight decline of the GI in the spring could be explained by a partial spawning by
precociously mature individuals due to temperature values which seem to favor a rapid
maturation of the gonads.
Our results match those obtained for H. (P.) sanctori on the same site ([10]) and of the
Canary Islands by [9] where maximum reproductive activity was observed during the warm
months and the minimum activity (resting) during the cold months. The absence of gonads
in the winter (cold season) in some specimens is explained by the tubular resorption after
spawning ([18]). This is the case for H. tubulosa of the Ain Taggourait site with a few
individuals having gonads completely resorbed after the spawning observed in 2010.
Similar observations were made by [8] for H. tubulosa from the Adriatic Sea and by [19]
for H. fuscogilva and Actinopyga mauritiana. However, the presence of a few mature H.
tubulosa at the end of the spring at Ain Taggourait site seems to confirm the start of an
early spawning in spring for some individuals.
There are still few data on the reproductive cycle of H. tubulosa or the other aspidochirotid
holothurians. [7] presented the reproductive cycle of H. tubulosa off Ischia Island (Italy)
and [17] in the Aegean Sea. Moreover, the effect of temperature on gametogenesis has been
well studied in holothurians where it was reported that the sea water temperature could
influence gonad growth by acting directly on food availability (appearance of the
phytoplankton bloom) ([36]; [37]; [9]). The data collected for H. tubulosa do not allow
testing this hypothesis. However, this species displays an annual reproductive cycle with
spawning of high intensity in the Bay of Bou Ismail (Ain Taggourait).
However, from the study of the reproductive cycle of H. tubulosa from the Mediterranean
southwestern basin (Algerian coast), it appears that spawning begins in June and ends
around October. Considering that holothurians larvae settle in the benthos after about one
month [12–17 days for Holothuria scabra ([38]); 22–27 days for Isostichopus fuscus ([39])
and 20 days for Apostichopus japonicus ([40]], we can assume that the recruitment of
juveniles of H. tubulosa occurs from the end of the summer (August) as reported by [41].
The collected data suggest that temperature is the most likely factor in the onset of
spawning of H. tubulosa and the determination of its reproductive cycle, as is the case for
other aspidochirotid holothurians species ([25]; [31]; [8]).:
REFERENCES
[1] Harmelin, JG, Bouchon, C, Hong, JS. 1981. Impact de la pollution sur la distribution des échinodermes des
substrats durs en Provence. Téthys. 10:13–36.
[2] Coulon, P, Jangoux, M. 1993. Feeding rate and sediment reworking by the holothuroid Holothuria
tubulosa (Echinodermata) in a Mediterranean seagrass bed off Ischia Island, Italy. Marine Ecology
Progress Series. 92:201–204.
[3] Cherbonnier, G. 1958. Faune marine des Pyrénées orientales Echinodermes. Vol. 2. France: Université
Paris. Laboratoire Arago. University Paris VI; p. 1–17.
[4] Francour, P. 1990. Dynamique de l’écosystème à Posidonia oceanica dans le parc national de Port Cros:
Analyse des compartiments matte, litière, faune vagile, échinodermes et poissons. Thèse de doctorat.
Paris: Université Pierre et Marie Curie; p. 373.
[5] Mezali, K. 1998. Contribution à la systématique, la biologie, l’écologie et la dynamique de cinq espèces
d’holothuries aspidochirotes (Holothuria (H.) tubulosa, H. (L.) polii, H. (H.) stellati, H. (P.) forskali
et H (P.) sanctori) de l’herbier à Posidonia oceanica (L.) Delille de la Presqu’île de Sidi-Fredj. Thèse
de Magister. Institut des sciences de la mer et de l’aménagement du littoral. p. 192 [in French].
[6] Mezali, K. 2008. Phylogénie, systématique, dynamique des populations et nutrition de quelques espèces
d’holothuries aspidochirotes (Holothuridea: Echinodermata) inféodées aux herbiers de Posidonies de
la côte Algéroise. Thèse de doctorat d’état. Université des Sciences et de la Technologie Houari
Boumediene. 228 p.
[7] Bulteel, P., Jangoux, M., Coulon, P. 1992. Biometry, bathymetric distribution, and reproductive cycle of
the holothuroid Holothuria tubulosa (Echinodermata) from Mediterranean Sea grass beds. Marine
Ecology. 13:53–62.
[8] Despalatovic, M, Grubeli, I, Šimunovic, A, Antoli, B, Žuljevic, A. 2004. Reproductive biology of the
holothurian Holothuria tubulosa (Echinodermata) in the Adriatic Sea. Journal of the Marine
Biological Association of the UK. 84:409–414.
[9] Navarro, PG, García-Sanz, S, Tuya, F. 2012. Reproductive biology of the sea cucumber Holothuria
sanctori (Echinodermata: Holothuroidea). Scientia Marina. 76:741–752.
[10] MezalI, K., Soualili, D. L., Neghli, L., Conand, C., 2014. Reproductive cycle of the sea cucumber
Holothuria (Platyperona) sanctori (Holothuroidea: Echinodermata) in the southwestern
Mediterranean Sea: Interpopulation variability. Invertebrate reproduction and development. Vol.
58(3): 179-189.
[11] Mezali, K., Francour, P., 2012. Les holothuries aspidochirotes de quelques sites des côtes algériennes:
révision systématique et relations phylogénétiques. Bulletin de la Société Zoologique de France,
137(1-4): 177-192.
[12] Léonet, A, Rasolofonirina, R, Wattiez, R, Jangoux, M, Eeckhaut, I. 2009. A new method to induce oocyte
maturation in holothuroids (Echinodermata). Invertebrate Reproduction & Development. 53:13–21.
[13] Braik, D. 1989. Etude de la dynamique sédimentaire devant Bou Ismail: sédimentologie, morphologie,
problème d’érosion du littoral et aménagement. Thèse de Magister. Institut des sciences de la terre; p.
174.
[14] Martoja, R, Martoja-Pierson, M. 1967. Initiation aux techniques de l’histologie animale. Paris: Masson;
p. 1–345.
[15] Bensalem-Bendjelloul, M. 1998. Techniques histologiques: théorie et pratique. Office des Publications
Universitaires, Alger, p. 1–109.
[16] Conand, C. 1990. The fishery resources of Pacific island countries Part 2: Holothurians. FAO Fisheries
Technical Paper no. 272. Rome: FAO; p. 1–143.
[17] Kazanidis, G, Antoniadou, C, Lolas, AP, Neofitou, N, Vafidis, D, Chintiroglou, C, Neofitou, C. 2010.
Population dynamics and reproduction of Holothuria tubulosa (Holothuroidea: Echinodermata) in the
Aegean Sea. Journal of the Marine Biological Association of the United Kingdom. 90: 895–901.
[18] Conand, C. 1993. Reproductive biology of the holothurians from the major communities of the New
Caledonian Lagoon. Marine Biology. 116:439–450.
[19] Ramofafia, C, Byrne, M. 2001. Assessment of the “tubule recruitment model” in three tropical
aspidochirote holothurians. S.P.C. Bêche-de-mer Information Bulletin. 15:13–16.
[20] Asha, PS, Muthiah, P. 2008. Reproductive biology of the commercial sea cucumber Holothuria spinifera
(Echinodermata: Holothuroidea) from Tuticorin, Tamil Nadu, India. Aquaculture International.
16:231–242.
[21] Gaudron, S, Kohler S, Conand, C. 2008. Reproduction of the sea cucumber Holothuria leucospilota in
the Western Indian Ocean: biological and ecological aspects. Invertebrate Reproduction &
Development. 51:19–31.
[22] Kohler, S, Gaudron, S, Conand, C. 2009. Reproductive biology of Actinopyga echinites and other sea
cucumbers from Reunion Island (Western Indian Ocean): a contribution for a regional management
of the fishery. WIOJMS. 8:97–111.
[23] Gabe, M, Martoja, M. 1957. Une coloration trichrome en un temps sans différenciation. Bulletin
Microbiolgie Appliquée. 7:60–63.
[24] Tanaka, Y. 1958. Seasonal changes occurring in the gonad of Stichopus japonicus. Bulletin of the Faculty
of Fisheries Hokkaido University. 1:29–36.
[25] Conand, C. 1981. Sexual cycle of three commercially important holothurian species (Echinodermata)
from the lagoon of New Caledonia. Bulletin of Marine Science. 31:523–543.
[26] Shiell, G, Uthicke, S. 2005. Reproduction of the commercial sea cucumber Holothuria whitmaei
(Holothuroidea: Aspidochirotida) in the Indian and Pacific Ocean regions of Australia. Marine
Biology. 148:973–986.
[27] Harriott, VJ. 1985. Reproductive biology of three congeneric sea cucumber species, Holothuria atra, H.
impatiens and H. edulis, at Heron Reef, Great Barrier Reef. Marine and Freshwater Research.
36:51–57.
[28] Cameron, JL, Fankboner, PV. 1986. Reproductive biology of the commercial sea cucumber
Parastichopus californicus (Stimpson) (Echinodermata: Holothuroidea). I. Reproductive periodicity
and spawning behavior. Canadian Journal of Zoology. 64:168–175.
[29] Ong-Che, RS. 1990. Reproductive cycle of Holothuria leucospilota Brandt (Echinodermata:
Holothuroidea) in Hong Kong and the role of body tissues in reproduction. Asian Marine Biology.
7:115–132.
[30] Smiley, S, McEuen, FS, Chaffee, C, Krishnan, S. 1991. Echinodermata: Holothuroidea. In: Giese A,
Pearse J, Pearse VB, editors. Reproduction of marine invertebrates echinoderms and lophophorates.
Vol. 6. Pacific Grove (CA): Boxwood Press; p. 663–750.
[31] Tuwo, A, Conand, C. 1992. Reproductive biology of the holothurians Holothuria forskali
(Echinodermata). Journal of the Marine Biological Association of the United Kingdom. 72:745–758.
[32] Chao, S.M., Chen, C.P, Alexander, PS. 1993. Reproductive periodicity of a tropical dendrochirote
holothurian Phyrella fragilis (Echinodermata: Holothuroidea) in Taiwan. Bulletin of the Institute of
Zoology, Academia Sinica. 32:111–119.
[33] Chao, SM, Chen, CP, Alexander, PS. 1995. Reproductive cycles of tropical sea cucumbers
(Echinodermata: Holothuroidea) in southern Taiwan. Marine Biology. 122:289–295.
[34] Foster, GG, Hodgson, AN. 1995. Annual reproductive cycles of three sympatric species of intertidal
holothurians (Echinodermata) from the coast of the Eastern Cape Province of South Africa.
Invertebrate Reproduction & Development. 27:49–59.
[35] Pearse, JS, Pearse, VB. 1986. Photoperiodic regulation of gametogenesis and growth in the sea urchin
Strongylocentrotus purpuratus. Journal of Experimental Zoology. 237:107–118.
[36] Hopper, DR, Hunter, CL, Richmond, RH. 1998. Sexual reproduction of the sea cucumber Actinopyga
mauritiana in Guam. Bulletin of Marine Science. 63:1–9.
[37] Conand, C, Uthicke, S, Hoareau, T. 2002. Sexual and asexual reproduction of the holothurian Stichopus
chloronotus (Echinodermata): a comparison between La Réunion (Indian Ocean) and east Australia
(Pacific Ocean). Invertebrate Reproduction & Development. 41:235–242.
[38] Mercier, A, Battaglene, SC, Hamel, JF. 2000. Settlement preferences and early migration of the tropical
sea cucumber Holothuria scabra. Journal of Experimental Marine Biology and Ecology. 249:89–
110.
[39] Hamel, JF, Ycaza-Hidalgo, R, Mercier, A. 2003. Développement larvaire et croissance des juvéniles de
l’holothurie des Galapagos, Isostichopus fuscus. S.P.C. Bêche-de-mer Information Bulletin. 18:3–8.
[40] Matsuura, H, Yazaki, I, Okino, T. 2009. Induction of larval metamorphosis in the sea cucumber
Apostichopus japonicus by neurotransmitters. Fisheries Science. 75:777–783.
[41] Mezali, K, Semroud, R. 1998. Analyses modales et essai d’estimation des paramètres de croissance, de
l’âge et du mois de recrutement de trois espèces d’holothuries aspidochirotes (Holothuroidea:
Echinodermata) de la région de Sidi-Fredj (Algérie). Rapport et PV de la Commission international
pour l’Exploration Scientifique de la Mer Méditerranée. Dubrovnik (Croatia) 35; p. 466–467.
Identification and Illustration of macrobentic Crabs in the intertidal zone of Khark
Island (Persian Gulf)
Identification and Illustration of macrobentic Crabs in the intertidal zone
of Khark Island (Persian Gulf)
Y. Parsa1, S. M. B. Nabavi2, M. A. Salari-Aliabadi2*, A. Savari2, A. Vazirizade3
1
Msc student of Marine Biology, Faculty of Marine Science and oceanography, Khorramshahr University of
Marine Science and Technology, Khorramshahr, Iran.
2
Department of Marine Biology, Faculty of Marine Science, Khorramshahr University of Marine Science and
Technology, Khorramshahr, Iran.
3
Department of Marine Biology, Persian Gulf Research and Studies Center (PGRSC), Boushehr, Iran.
*Corresponding author: [email protected]
SUMMARY
The goals of this study are identification and ecological survey on macrobenthic crabs in the Khark Island.
This study has been done during four seasons through 2010-2011 in five sites around the Khark Island. In
each five sites, three separated transects including supralittoral, eulittoral and sublittoral zones have been
selected. At each sampling time and site environmental factors such as temperature, salinity and dissolve
oxygen (DO) have been measured. Collected samples were analyzed and according to the results, maximum
and minimum water temperatures have recorded in summer (35.94±0.28) and in winter (18.34±0.39) and the
maximum and minimum rates of salinity have recorded in winter (44.6±0.14) and spring (37±0.18)
respectively. Maximum and minimum percentages dissolve oxygen recorded in fall (7.26±0.08) and in summer
(5.24±0.05) respectively. Twenty two species were edification. Maximum and minimum frequency and
diversity percentages observed in spring and summer. In this study the most frequent Crab’s species in all
seasons was Diogenes avarus.
Keywords: Crab, Khark Island, Persian Gulf, Crustacean, Diogenes avarus.
INTRODUCTION
The Persian Gulf is a body of water in the Middle East between the Arabian Peninsula and
Iran. This inland sea is connected to the Gulf of Oman by the Strait of Hormuz. The Persian
Gulf is one of the unique ecosystems due to its geographic distribution and its isolation
from the international water and has unique specifications such as ecological, biological
specifications and different varieties. It has a great biological diversity in the form of
various marine flora and fauna. It includes marine sensitive ecological zones such as
estuary, rivers, coral reef, mangrove forest, marsh and stone and mud coasts [1].
Crustaceans are important members of tropical benthic communities. In addition to the
value of the larger and more abundant species for human consumption, a tremendous
variety of small species contribute to the complexity and functioning of tropical
ecosystems. Macro benthic crabs in marine sediment plays an important role in ecosystem
processes such as nutrient cycling, pollutant metabolism, dispersion and in secondary
production [1, 2]. Any fluctuation in their quality and quantity will directly affect the
abundance of demersal fishes that are important fishery resources in the sea. Therefore, a
benthic study may be used as baseline information to evaluate the existing demersal stocks
and may serve as a baseline study of future investigations on environmental changes in this
area [2, 3]. The objective of the present study is to determine the seasonal abundance of
macro benthic composition and diversity in relation to environmental factors. Decapoda are
an important part of the food chain, especially for fish. Many decapoda crabs feed on algae
and bacteria, which are on the lower end of the food chain. Some shred and eat leaves and
other organic matter that enters the water. Because of their abundance and position as
middlemen in the aquatic food chain, benthos plays a critical role in the natural flow of
energy and nutrients. However, no study
has been carried out to determine seasonal variation of benthic infauna in Iran up to now.
The purpose of this study is to examine the seasonal variation of macro benthic crabs in
order to provide the baseline information for the environmental assessment and
management in Khark Island, south Iran.
The role of decapoda in marine ecosystems has been emphasized in recent years, especially
in view of commercially valuable species found there and others which affect the overall
mangrove ecology [2, 3]. Degradation of mangrove leaf litter by crabs, sesarmids in
particular, plays a major link between primary and secondary producers (Ajmal Khan et al.,
2005). Their burrowing habit assists in oxidizing the sulphide that builds up due to high rate
of organic decomposition in mangrove swamps [5]. Crabs are good source of food to
marine life as well as to man as a good protein source [4, 5]. They form food for many
birds, snakes and predatory fishes and their larvae are also consumed by many carnivores;
thus crabs play a significant role in the food chain. In a way, the saying ‘no mangroves, no
prawns’ is more applicable to the crabs. Recent investigations have shown that loss of
diversity can have a significant effect on ecosystem functioning in experimental systems
[6]. However, current understanding cannot predict how natural ecosystems respond to
increasing losses of species. Anthropogenic disturbances to natural ecosystems often result
in simplification of the ecosystem and diversity loss, but the consequences on ecosystem
functioning are often unrecorded due to a lack of baseline studies and monitoring of natural
ecosystems. Environmental parameters also play a role in the biodiversity and ecological
function of mangrove ecosystems. The objective of this study was to describe and compare
the biodiversity and community structure of decapoda at Khark Island sites and to use the
data sets of the study as a baseline data to monitor the marine ecosystem of Iran.
The study was carried out in the Persian Gulf coasts (Khark Island) in south Iran (Fig. 1).
The Persian Gulf lies on the South Iran, between longitudes 48°25' and 56°25" East, and
latitudes 24°30" and 30°30' North. It has an estimated area of 260 km2 and extends 600 km
offshore to a depth average of about 30-40 m [1]. Specifically, the Khark Island lies
between Longitudes 50°6' and 52°58'East and Latitudes 27°14' and 30°16' North and it is
about 21 km long. The sediment samples were collected in two times for every season. A
hand corer with 4.5 cm inner diameter was used to collect samples, sieved and retained
through 0.5mm screen and preserved in 5% formalin. The animals were separated, counted,
identified up to species level using standard references and expressed in No/m. Dominant
species in each sampling were identified by rank-score analysis [4, 5].
Figure 1: Map of Persian Gulf and study area
In general, the distribution of decapoda is influenced by physicochemical, biological
characteristics prevailing in the environment. In the present study Petrolisthes rufescence is
dominated followed by Pagurus sp. and Diogeness avarus.
Table 1. Water quality parameters in all the season
Parameters Spring Summer Autumn Winter
33
39
42
42.1
Salinity (ppt)
26
35
22
18
Temp (°C)
6
7
8
8
pH
Table 2. Total dacapoda recorded during four seasons along Khark Island
Species
Etisus splendidus
Nanosesarma minutes
Actaea sp.
Sesarma plicatum
Petrolisthes armatus
Clibanarius virescense
Epxanthus frantalis
Pilumnus vespertilio
Paractea sp.
Clibanarius signatus
Medaeus sp.
Pilumnus sp.
pachycheles natalenisis
Euxanthus sp.
Portunus pelagicus
Charybids helleri
Neoepisesarma sp.
Portunus sp.
Petrolisthes rufescence
Pagurus sp.
Diogenes avarus
Spring
20
3
2
1
1
1
16
2
1
1
20
1
21
3
2
3
21
1
81
154
129
Summer
6
0
0
1
2
0
1
2
2
0
2
1
0
10
1
3
1
3
135
122
212
Autumn
8
1
2
2
0
0
1
0
4
0
0
2
2
3
0
1
3
1
164
182
158
Winter
8
1
0
3
0
0
0
0
4
1
3
1
0
0
0
0
1
0
174
101
227
In general the distribution of decapoda is influenced by physicochemical, biological
characteristics prevailing in the environment. In the present study polychaetes are
dominated followed by decapods, bivalves, gastropods, amphipods and Isopods the similar
species were reported by Paesa et al. 2011 [4] in Bushehr and Khuzestan [5] by Nabavi et al
2008. Most of the benthic studies explored that Portunus is the dominant species in
Portunus pelagicus might be due to firm substrate provided by seaweed deposition. Crabs
have a mucus secreting device, which is used to protect themselves in adverse conditions in
estuarine habitat [6]. Temperature is an important ecological factor, which influence the
distribution of benthic organisms. High temperature 35.9 (°C), recorded in summer season
influence the distribution of macrobenthic organisms Low temperature recorded in
December and that influence higher faunal density. Low density recorded in November due
to heavy downpour, which caused drastic fluctuations in the sampling stations. Positive
relationship between the abundance of benthic fauna and concentration of organic carbon in
sediments had been documented by many workers [9, 10]. The salinity also considered to
be a dominant limiting factor, in the distribution of benthic fauna of the present study. The
salinity determines the distribution of benthic fauna in Damman cornice and half moon Bay
of Persian Gulf by Parsa et al [11]. pH and DO didn’t play any considerable role in benthic
faunal assemblage of present study. Similar finding’s was also projected by Prabha Devi
and Ayyakannu [5].
ACKNOWLEDGEMENTS
Financial support was carried out by Khoramshahr University of Marine Science and
Technology, Iran.
REFERENCES
1-Dahanayakar, D.D.G.L. and M.J.S. Wijeyaratne, 2006. Diversity of macrobenthic community in the
Negombo estuary, Srilanka, with special reference to environmental conditions. Srilanka, J. Aguat.
Sci., 11: 43-61
2-Ng PKL, SH Tan. 1999. The Hawaiian parthenopid crabs of the genera Garthambrus and Dairoides
(Crustacea: Decapoda: Brachyura). Proc. Biol. Soc. Wash. (in press).
3-Ortmann A. 1893. Die Decapoden-Krebse des Strassburger Museums, mit besonderer Berüc ksichtigung der
von Herrn Dr. Doerlein bei Japan und bei den Liu-Kiu-Inseln
gesammelten und zur Zeit im Strassburger Museum aufbewahrten Formen. VII. Theil. Abtheilung: Brachyura
(Brachyura genuina Boas) II. Unterabtheilung: Cancroidea, 2. Section: Cancrinea, 1. Gruppe:
Cyclometopa. Zoologische Jahrbüchner 7: 411-495, pl. 17.
4-Paulson O. 1875. Studies on Crustacea of the Red Sea with notes regarding other areas. Part 1.
Podophthalmata and Edriophthalmata (Cumacea) Israel program for scientific translation, Jerusalom.
pp. 1-64, pls. 1-21.
5-Rathbun MJ. 1906. The Brachyura and Macrura of the Hawaiian Islands. U.S. Fish Commision Bull.
3[1903]: 827-930, pls. 1-24.
6-Stebbing TRR. 1920. South African Crustacea, Part X. Annals of the South African Museum 17: 231-272,
pl. 1.
7- Stevcic Z, P Castro, RH Gore. 1988. Re-establishment of the family Eumedonidae Dana, 1853 (Crustacea:
Brachyura). J. Nat. Hist. 22: 1301-1324.
8-Stimpson W. 1857. Prodromus descriptionis animalium evertebratorum quoe in Expeditione ad Oceanum
Pacificum eptentrionalem a Republica Federata Missa, Cadwaladaro Ringgold et Johann Rodgers
Ducibus, observavit et descripsit, 3. Crustacea Maioidea. Proc. Acad. Nat. Sci.,
9-Philadelphia 9: 216-221. Stimpson W. 1907. Report on the Crustacea (Brachyura and Anomura) collected
by the North Pacific Exploring Expedition 1853-1856. Smithson. Misc. Collns., part of 49 (1717): 1240, 26 pls.
10-Weber F. 1795. Nomenclator entomologicus secundum Entomologiam Systematicam ill. Fabricii adjectis
speciebus recens detectis et varietatibus: i-viii, 171. Chilonii and Hamburgi.
11-Sakai T. 1976. Crabs of Japan and the Adjacent Seas. Tokyo: Kodansha Ltd. pp. i-xxix, 1-773, 3 maps
(English volume); pp. 1-16, pls. 1-251 (Plates volume); pp. 461 (Japanese volume).
12-Shen CJ, AY Dai, HL Chen. 1982. New and rare species of Parthenopidae (Crustaea: Brachyura) from
China seas. Acta Zootaxonomica Sinica 7: 139-149, pls. 1-2.
13-Smith SI. 1869. Descriptions of a new genus and two new species of Scyllaridae and a new species of
Aethra from North America. Am. J. Sci., (2)48: 118-121.
14-Stebbing TRR. 1920. South African Crustacea, Part X. Annals of the South African Museum 17: 231-272,
pl. 1.
15-Stevcic Z, P Castro, RH Gore. 1988. Re-establishment of the family Eumedonidae Dana, 1853 (Crustacea:
Brachyura). J. Nat. Hist. 22: 1301-1324.
Macrozooplanktonic Fauna in the Algerian Coast
Macrozooplanktonic fauna in the Algerian coast
Hafferssas A and Kherchouche A.
USTHB – Faculté des Sciences Biologiques – BP 32 El Alia – Alger – Algérie
SUMMARY
The macrozooplanctonic fauna the Algerian coast was studied during several periods: i) Summer season’s
2010. About 40 stations were sampled at the epipelagic layer) (0 - 200m), byWP2's net. ii) spring, summer
and autumnal’s seasons 2012 and 2013 where 9 stations were sampled between 0 and 50 m of depth. The
community were represented by 22 species.
Keywords: Jellyfishes, Algerian Coast species, abundances, Interaction jellyfishes – copepods
INTRODUCTION
The jellyfish populations, due to their effects on the public health, represent the most known
group. These predators occupy the summit of the food web. This position gives them
effective competitors of pelagic fishes. So, their proliferations have impacts on the
functioning of the pelagic ecosystems, particularly on the ichtyologic fauna (1, 2) Lynam
and al ., 2005; 2 Purcell and al ., 2007. For the last decades, the jellyfishes registered
important proliferations within the world ocean (3) Graham and al ., 2003). In the
Mediterranean Sea, as an example, the massive appearances of Pelagia noctiluca become
more frequent (4) Daly Yahia and al ., on 2003). Consequently, several hypotheses were
emitted: climate change; anthropological actions; overfishing; pollution (5, 6) Umani, 1991;
6Richardson and al ., 2009).
In this present contribution, biodiversity and distribution of jellyfishes species were studied
along the three sectors of Algerian coasts (western, central and oriental). This work,
represents one of the first contributions in the qualitative, quantitative and structural study
of the jellyfishes fauna in these regions.
MATERIAL AND METHODS
The samplings come from three sectors of the Algerian coast: eastern, centre and western
(Fig. 1) Three years were covered:
• summer 2010 in whole regions (41 stations) were called POEC,
• those realized in 2012 (POC1) at the level of 9 stations at the level of two regions
(Habibas islands and Algiers coast) in summerand spring periods;
• Those realized in 2013 (POC2) at Algiers bay during summer and autumn seasons.
A Working Party II standard net was used by vertical hauls at the epipelagic layer (between
0 and 100 m depth).
ALGERIA
Figure 1. Samplings at the 3 sectors off Algerian coasts
Biodiversity
During the various samplings, we have collected 22 species (Tab. 1). There were distributed
into two classes and six orders (Tab. 2). The classification of Daly and al. (2007) were used.
Phylum
Class
Hydrozoa
Infra
Class
Trachylina
e
Order
Infra
order
Limnomedusae
Family
Olindiidae
Trachymedusae
Rhopalone
matidae
Geryoniida
e
Narcomedusae
Cnidaria
Hydroidoli
na
Leptothecata
Aeginidae
Proboscoi
da
Solmarisida
e
Campanula
riidae
Species and
Genders
Olindias phosphorica
Delle Chiaje, 1841
Rhopalonema funerarium
Vanhöffen, 1902
Rhopalonema velatum
Gegenbaur, 1857
Sminthea eurygaster
Gegenbaur, 1856
Aglaura hemistoma
Péron & Le Sueur, 1810
Liriope tetraphylla
Chamisso &
Eysenhardt,1821
Solmundella bitentaculata
Quoy & Gaimard, 1833
Solmarissp.
Clytia hemisphaerica
Gronovius, 1760
Clytia sp.
Lamouroux, 1812
Obelia spp.
Péron & Lesueur, 1810
Conica
Malagazzii
dae
Lovenellida
e
Phialellidae
Anthoathecata
Filifera
Hydractinii
dae
Rathkeidae
Aplanulat
a
Capitata
Scyphozoa
Discomedus
ae
Proboscida
ctylidae
Corymorph
idae
Tubulariida
e
Zancleidae
Semaeostomeae
Pelagiidae
Octophialucium
funerarium
Quoy & Gaimard, 1827
Eucheilota paradoxica
Mayer, 1900
Mitrocomium cirratum
Haeckel, 1879
Phialella quadrata Forbes,
1848
Hydractinia sp.
van Beneden, 1841
Lizzia blondina
Forbes, 1848
Proboscidactyla ornata
McCrady, 1859
Corymorpha nutans
M. Sars, 1835
Ectopleura dumortierii
Van Beneden, 1844
Zanclea sp.
Gegenbaur, 1856
Pelagia noctiluca
Forsskål, 1775
Ecological affinity
The species have various biogeographical affinities: circumtropicals (R. funerarium, R.
velatum, A. hemistoma, L. tetraphylla, S. bitetaculata); Atlanto-tropicals (M. cirratum);
Atlanto–Mediterraneans (O. funerarium, Zanclea sp.) and boreals (L. blondina and C.
nutans). Indeed, almost 50 % of the populations have an affinity circumtropical origins.
(Tab. 2, Figs. 2 to 6 and Photos 4 to 14). In our findings, we have recorded cosmopolitan
species such as Obelia sp. and C. hemisphaerica. Few endemic forms were indicated
(Solmaris sp.).
Species
Rhopalonema funerarium
Rhopalonema velatum
Sminthea eurygaster
Aglaura hemistoma
Liriope tetraphylla
Solmundella bitentaculata
Obelia sp.
Ectopleura dumortierii
Zanclea sp.
Octophialucium funerarium (Octocanna funeraria)
Hydractinia sp.
Mitrocomium cirratum (Lovenella cirrata )
Olindias phosphorica
Phialidium sp.
Cylia hemisphaerica ( Phialidium hemisphaericum)
Eucheilota paradoxica,
Solmaris sp.
Phialella quadrata
Lizzia blondina,Proboscidactyla ornata
Corymorpha nutans
Pelagia noctiluca
Biogeographical affinities
Circumtropicals
Circumtropical, Atlanto - Mediterranean
Atlanto–Mediterraneans
Atlanto-tropicals
Boréals
-
Figure 2. R. funerarium (Bouillon & al., 2004)
Photo 1. R. velatum (Personnal photo)
1 mm
Figure 3. S. eurygaster (Bouillon & al., 2004)
1 mm
Photo 3. L. tetraphylla (Personnal photo)
1 mm
Figure 5. Obelia sp. (Personnal photo)
Photo 2. A. hemistoma (Personnal photo)
1 mm
Photo 4. S. bitentaculata (Personnal photo)
1 mm
Photo 6. E. dumortierii (Personnal photo)
1 mm
Figure 4. O. funerarium (Bouillon & al., 2004)
Photo 7. Hydractinia sp. (Personnal photo)
0,5mm
1 mm
0.5mm
Photo 8. Zanclea sp. (Personnal photo)
Photo 9. Mitrocomium cirratum (Pers. photo)
1mm
Figure 5. O. phosphorica (Bouillon & al., 2004)
0.5mm
Photo 11. C. nutans (Personnal photo)
Photo 10. L. blondina (Personnal photo)
1 mm
Photo 12. C. hemisphaerica (Pers. photo)
1mm
Figure 6. P. quadrata (Bouillon & al., 2004)
Photo 13. E. paradoxica (Personnal photo)
0.5mm
1mm
Photo 14. P. noctiluca (Personnal photo)
DISCUSSION
Twenty two species of jellyfish were recorded at three sectors of the Algerian coasts. They
were divided in: hydromedusae (21 species) and scyphomedusae (1 population). The
previous works within the Algerian basin mentioned a clearly lower biodiversity. Indeed,
six species (5 hydromedusae and 1 scyphomedusae) were recorded in the bay of Algiers (7).
10 species of jellyfish were described between 1° and 4°E (8). Three populations
(Bougainvillea muscus, Koellikerina fasciculata, Nausithoe punctata) do not appear in our
present inventory. Nevertheless, during Mediprod V campaign twenty populations were
counted on the Algerian coast (9). Certain forms Euphysora sp., Paratiara digitalis,
Leuckariara octana, Pandea conina, Eutima gegembauri, Tetraplatia volitans, Solmissus
albescens, Periphylla periphylla, Nausithoe punctata do not appear in our recent inventory.
In the western south Mediterranean Sea, 22 species) (20 hydrojmedusae and 2
scyphomedusae) was inventoried (10). At the level Alboran sea, 18 species were counted
(11). On the Tunisian coast, 20 species were taken (12). In the Mediterranean Sea, 346
populations were described (13). Consequently, 6 % of this biodiversity was accommodated
by the pelagic ecosystems of the Algerian coast. This rate confirms the low faunistic
biodiversity within the south coast of the Mediterranean sea. Thirty species were
inventoried at the French coasts (14,15). Within the oriental Mediterranean Sea, 71
populations were taken at the level of the Lebanese coast (16). During POEC samples
(2010), six populations were inventoried. A biodiversity was clearly important (16 species)
to those observed during the POC1 (2012) and POC2 (2013) samples. The central sector
registers a relatively high biodiversity (6 to 16 species), with regard to that recorded within
the western region (4 to 12 species),. However, the difference remains not significant.
Also, the study of the spatial distribution of the various populations, showed, for certain
species, a restricted geographical distribution:
 E. paradoxica, P. ornata, Hydractina sp. and S. nutans were especially localized in
the central sector;
 the populations of Zanclea sp. and M. cirratum were only observed in samples
linked to the western region (Habibas islands).
The fauna of the Algerian coast was strongly represented by leptomedusae (O. funeraria, P.
hemisphaericum, Clytia sp., Obelia sp., E. paradoxica, M. cirratum et P. quadrata) and
anthomedusae (Hydractinia sp., L. blondina, P. ornata, C. nutans, E. dumontierii and
Zanclea sp). These two orders remain the most represented in the Mediterranean Sea (17).
The orders of limnomedusae ((O. phosphorica) and nacromrcomedusae (S. bitentaculata,
Solmaris sp.) were less represented (12,17). In term of biogeographical affinity, almost 50
% of species were circumtropicals. These affinity characterize the majority of species
recorded in the Mediterranean Sea .
The presence of the populations such as O. Funeraria, Hydractinia sp ., cirratum Mr. and
O. Phosphorica were the sign of the Atlantic influence on the community (13). This
influence was widely commented on the copepods (18). Few endemic populations were
listed (Solmaris sp.) on the Algerian coasts. Indeed, this was explained by the closeness of
the study zone with the other regions.
CONCLUSION
Twenty two species of jellyfish were recorded at three sectors of the Algerian coasts. In the
Mediterranean Sea, 346 populations were described. Consequently, 6 % of this biodiversity
was accommodated by the pelagic ecosystems of the Algerian coast. Here, few endemic
populations were listed (Solmaris sp.).
REFERENCES
[1], Lynam C.P., Heath M.R., Hay S.J. & Brierley A.S., 2005. Evidence for impacts by jellyfish on North Sea
herring recruitment. Mar Ecol Prog Ser, 298:157–167.
[2], Purcell J.E., Uye S. & Lo W.T., 2007. Anthropogenic causes of jellyfish blooms and their direct
consequences for humans: a review. Marine ecology progress series, 350: 153–1, 74.
[3]. Graham W.M., Martin D.L, Felder D.L., Asper V.L., Perry H.M., 2003. Ecological and economic
implications of a tropical jellyfish invader in the Gulf of Mexico. Biological Invasions 5: 53-69
[4]. Daly Yahia M., Goy J. & Daly Yahia - Kéfi O., 2003. Distribution et écologie des Méduses (Cnidaria) du
golfe de Tunis (Méditerranée sud occidentale). Oceanologica. Acta. 26: 645-655.
[5], Umani S., 1991. General features of the planktonic system in the gulf of Trieste and their variations in the
last decade. Proceedings of the II nd Workshop on Jellyfish in the Mediterranean, Trieste. UNEP
edition: 82-101.
[6]. Richardson A. J., Bakun A., Hays G. C. & Gibbons M. J., 2009. The jellyfish joyride: causes,
consequences and management responses to a more gelatinous future. Trends in Ecology and
Evolution, 24 (6): 312-323
[7] Seguin G., 1973. Cycles comparés du zooplancton dans l’Ouest Africain et la Méditerranée sud
occidentale. Thèse de Doctorat En Sciences Naturelles. Université des Sciences et Techniques de
Lille, 120 p.
[8], Hafferssas A., 2004. Peuplements zooplanctoniques du basin Algérien. In: Biodiversité marine et littorale,
Ediwan Edition, 113-141.
[9], Kerzabi F., 2004. Contribution à l’étude des peuplements mésozooplanctonique (> 500 µm) du bassin
algérien –Campagne MEDIPROD V-. Thèse de Magistère en écologie marine. Institut des Sciences
de la Mer et de l’Aménagement du Littoral, Alger, 107pp.
[10], Soenen M., 1969. Contribution à l’étude du Zooplancton superficiel et profond du bassin sud-occidental
méditerranéen. Faculté des Sciences de l’Université d’Aix-Marseille. Thèse de Doctorat de 3ecycle
en Océanographie Biologique; 234
[11]. Mills C.E., Pugh P.R., Harbison G.R. & Haddock S.H.D., 1996. Medusae, siphonophores and
ctenophores of the Alboran Sea, south western Mediterranean. Sci. Mar, 60 (1): 145–163
[12], Daly Yahia M.N., Daly Yahia-Kéfi O., Souissi S. & Romdhane M.S., 2001.Variations spatiotemporelles
du zooplancton de la baie de Tunis : composition numérique et biomasse. Rapp. Comm. int. Mer
Médit. 36.
[13] Boero F. & Bouillon J., 1993. Zoogeography and life cycle patterns of Mediterranean hydromedusae
(Cnidaria). Biological Journal of Linnean Society, 48: 239-266.
[14 ], Berhaut J., 1969. Etude qualitative, quantitative et écologique des Hydroméduses du golfe de Marseille.
Tethys, 1: 667 – 708.
[15]. Goy J. 1972. Les hydroméduses de la mer Ligure. Bulletin du Museum National d’Histoire Naturelle,
62: 965-1009.
[16] Goy J., Lakkis & S., Zeidane R., 1991. Les Méduses (Cnidaria) des eaux Libanaises. Ann. Inst.
océanogr., Paris 67 (2), 99–128.
[17], Touzri C., Daly Yahia-Kefi O., Hamdi H., Goy J., Daly Yahia M.N., 2010. Spatio-temporal distribution
of medusa (Cnidaria) in the Bay of Bizerte (South Western Mediterranean Sea). Cahiers de Biologie
Marine, 51: 167- 176.
[18] Hafferssas A., 2010. Contribution à l’étude des communautés zooplanctoniques des cotes algériennes :
biodiversité, biomass et comportement trophique. Thèse de doctorat, ISN/ USTHB, Alger: 153p.
Etude de la Reproduction de l’Anchois Européen Engraulis encrasicolus dans le
Golfe de Béjaïa
Etude de la reproduction de l’Anchois européen Engraulis encrasicolus
dans le golfe de Béjaïa
Rahmani Amina1, Kadji-Djoudad Hafsa1, Iguerouada Mokrane2
Université Abderrahmane Mira - [email protected] - [email protected]
2
Université Abderrahmane Mira - [email protected] / [email protected])
1
RESUME
La présente étude se veut une étude préliminaire visant à caractériser la période de reproduction de
l’anchois européen (Engraulis encrasicolus) du golfe de Béjaïa. Les données recueillies serviront de base à
l'élaboration d'une étude plus vaste portant sur l'évaluation de la période de reproduction de l’anchois à
différents sites de Béjaïa. L'objectif premier de l'étude est d'identifier la période pendant laquelle les anchois
se reproduisent. Pour ce faire, il faut décrire la période de reproduction en mesurant les changements au
niveau du rapport gonadosomatique et du stade de maturité des gonades.
Mots clés : Anchois européen, Engraulis encrasicolus, stades de maturité sexuelle, RGS, période de
reproduction, golfe de Béjaïa, Algerie
INTRODUCTION
Engraulis encrasicolus, l’anchois européen, a un potentiel halieutique important tant à
l’échelle économique, en raison da sa valeur marchande, qu’à l’échelle écologique, en étant
parmi les premiers maillons de la chaine alimentaire [1]. En Algérie, la production de ce
petit pélagique connait des fluctuations de stock avec comme conséquence une raréfaction
sur le marché. Une meilleure compréhension de ses mécanismes reproducteurs permettra
peut-être une valorisation optimale de ce produit. Tandis que la reproduction de cette espèce
est extensivement étudiée dans le Nord méditerranéen, les informations restent très
insuffisantes dans la rive Sud et encore plus sur les côtes algériennes comparativement à ce
que s’est fait sur les côtes marocaines et tunisiennes. Les travaux antérieurement menés en
Algérie se limitent à ceux de [2] et de ceux de [3].
Le présent travail a pour objet d’étudier quelques aspects de la reproduction des mâles
d’Engraulis encrasicolus, obtenus des pêcheries commerciales au golfe de Béjaïa (Algérie),
à travers l’étude de l’évolution de la maturité des gonades (observation macroscopique) et
rapport gonado-somatique (RGS).
Les spécimens des mâles d’anchois étudiés proviennent des débarquements commerciaux
effectués au port de Béjaïa durant la période allant d’octobre 2007 à mai 2008. La fréquence
d’échantillonnage est hebdomadaire et fonction de la disponibilité en poissons. Une fois au
laboratoire les variables suivantes ont été collectées sur chaque poisson: la longueur totale
(Lt), le poids total (Pt) et le poids des gonades (Pg). Les mesures ont été prélevées au
millimètre et au gramme près respectivement. Deux approches ont permis de déterminer la
période de reproduction: une approche quantitative basée sur le suivi mensuel du rapport
gonado-somatique (RGS) : RGS = (Pg / Pt) * 100 [4]; et une approche qualitative qui
consiste à suivre mensuellement les stades de maturité sexuelle des mâles suivant l'échelle
développée par [5] (Tableau I).
Golfe de Béjaïa
Tableau 1 : Stades de maturité sexuelle des gonades chez les mâles de l’Anchois européen
Stades
I et II (immature ou en
repos sexuel)
II(début de maturation)
III (pré-émission)
IV (émission)
V (post-émission)
Aspect morphologique des testicules
Gonade petite, blanche et en lame de couteau.
Gonade plus grosse, blanchâtre et plus ou moins molle.
Gonade molle, occupant 2/3 de la cavité abdominale. Un
liquide blanchâtre s’écoule dés la moindre incision.
Gonade très grosse et molle, occupant quasiment la totalité de
la cavité abdominale. Le liquide blanchâtre s’écoule à la
moindre pression exercée sur l’abdomen.
Gonade flasque présentant une vascularisation.
Ces deux paramètres ont été représentés par mois afin de mettre en évidence l’état
physiologique des poissons et la saisonnalité de la reproduction. Des analyses statistiques
sont exécutées par le logiciel Statview 4.5 software, (Abacus Concept Inc., Berkeley, CA,
USA), pour comprendre la relation entre les différentes variables.
En analysant l’évolution du RGS en fonction des stades de maturité sexuelle (Figure 1), des
différences significatives (p<0.05) sont observées pour tous les stades à l’exception entre
les stades I et V. Les valeurs les plus élevées sont observées entre le stade II et IV, avec un
léger pic au stade III. Cette augmentation est caractéristique du début de la maturation
gonadique et de la période de pré-émission. Les stades I et V sont ceux qui présentent les
valeurs les plus basses, le I est correspond au repos sexuel alors que le V à la post-émission.
En analysant la distribution des stades de maturité sexuelle en fonction des mois de l’année,
nous pouvons voir que le stade d’émission est localisé entre les mois de mai et octobre,
avec un pourcentage faible au mois d’octobre. Ces données sont en concordance avec les
travaux de [6] et [7] réalisés sur les côtes italiennes et tunisiennes avec là aussi des faibles
taux en mois d’octobre. Cependant, dans les deux études, le stade d’émission est observé
dès le mois de mars, alors que dans notre cas ce n’est qu’au mois de mai que cela est
possible. Il est à signaler, toutefois, que le profil de notre étude pour la période de
reproduction est tout à fait similaire à ceux décrits par [8].
6
RGS (%)
5
4
3
2
1
0
I
II
III
Stades de maturité sexuelle
IV
V
Figure 1 : Courbe d’évolution du RGS (en %) en fonction des stades de la maturité sexuelle
(Moyenne± Ecart-type)
Golfe de Béjaïa
6
5
RGS (%)
4
3
2
1
0
1
2
3
4
5
10
11
12
Figure 2 : Courbe d’évolution du RGS (en %) enMois
fonction des mois de l’année (Moyenne± Ecart-type)
En analysant l’évolution du RGS en fonction des mois de l’année (Figure 2), les valeurs
restent significativement différentes (p<0.05) à l’exception entre les mois de février et
octobre et entre janvier et décembre. Les valeurs de RGS augmentent d’une manière
régulière à partir du mois de janvier pour atteindre les valeurs maximales en avril, pour
ensuite décroître et atteindre les plus basses valeurs le mois de décembre. Nous pouvons
voir que le maximum de RGS est atteint au mois d’avril caractérisant le stade de préémission. Le stade émission est situé après le pic du RGS, alors que le stade du repos sexuel
est entre les mois de novembre et janvier.
19
18
17
LT(cm)
16
15
14
13
12
11
I
II
III
IV
V
Stades de maturité sexuelle
Figure 3 : Graphe en boites représentent la variation de la longueur totale Lt (cm) en fonction des
stades de maturité sexuelle (la ligne au milieu de la boite représente la médiane)
8
7
6
RGS (%)
5
4
3
2
1
-1
11.8
12.0
12.1
12.5
12.7
13.0
13.3
13.4
13.5
13.6
13.7
13.8
14.0
14.1
14.2
14.3
14.4
14.5
14.6
14.7
14.8
14.9
15.1
15.2
15.3
15.4
15.5
15.7
15.9
16.4
16.5
16.7
17.3
18.3
0
LT ( cm)
Figure 4 : Graphe en boites représentent la variation du RGS en fonction de la longueur totale Lt (cm)
des poissons (la ligne au milieu de la boite représente la médiane)
Golfe de Béjaïa
Ce qui est de l’analyse des longueurs des poissons en fonction des stades de maturité
sexuelle (Figure 3), nous pouvons avons déduit que des individus ayant 12 cm sont présents
dans le stade IV. C’est à cette dimension que ces poissons sont complètement matures. Il est
à noter que les dimensions de la première maturité sexuelle publiées chez l’anchois sont de
7,3 cm [7] à 12,6 cm [9]. En analysant le RGS en fonction de la longueur totale (Figures 3
et 4), il est possible de constater une dynamique de reproduction à partir là aussi de 12 cm,
où des individus présentent un RGS en moyenne de 2,65 %. Cela confirme encore qu’à
cette dimension les mâles de l’anchois sont tout à fait matures.
CONCLUSION
L’évolution du RGS et la distribution des stades de la maturité sexuelle en fonction des
mois de l’année ont démontré que la période de reproduction de l’anchois européen du golfe
de Béjaïa se situe entre le mois d’avril et le mois d’octobre. En analysant les longueurs des
poissons en fonction des stades de maturité sexuelle et le RGS, les individus ayant 12 cm
sont tout à fait matures.
REFERENCES
[1] Palomera I.et Rubiés P.: “The European anchovy and its environment”. International Centre for Coastal
Resources Research. Scientia Marina, 6O Suppl.2, 1996.
[2] Djabali F. et Hemida, F.: “ Reproduction de l’anchois (Engraulis encrasicolus. Linné) de la région
d’Alger”. Pelagos VII(1) :14-22, 1989.
[3] Mezedjri L., Kerfouf A., et Tahar A.: “Reproductive cycle of the European anchovy Engraulis
encrasicolus (Linnaeus, 1758)(Clupeiformes Engraulidae) in the gulf of Skikda (Algerian East
coasts) ”. Biodiversity Journal 4 (2): 269-274, 2013.
[4] Lahaye, J.: “ Les cycles sexuels chez les poissons marins”. Oceanis, 6(7): 637-654, 1980.
[5] Gaamour A., 1999 : “La sardinelle ronde (Sardinella aurita Valenciennes, 1847) dans les eaux tunisiennes:
Reproduction, Croissance et pêche dans la région du Cap Bon”. Thèse de Doctorat de l'Université de
Bretagne Occidentale. 246p, 1999.
[6] Basilone G., Patti B., Bonanno A., Cuttitta A., Vergara A. R., Garcia A., Mazzola S. et Buscaino G.:
“Reproductive aspects of the European anchovy (Engraulis encrasicolus): six years of observations
in the Strait of Sicily”. MedSudMed Technical Documents (FAO/MedSudMed).5(12): 67-78, 2004.
[7] Gaamour A., Khemiri S., Mili S., Ben Abdallah L.: “ L’anchois (Engraulis encrasicolus) des côtes nord de
la Tunisie: reproduction et exploitation”. Bulletin de l’Institut National Scientifique et Technique
d’Océanographie et de Pèche de Salammbô (31) : 17 - 24, 2004.
[8] SINOVČIĆ G. et ZORICA B.: “Reproductive cycle and minimal length at sexual maturity of” Engraulis
encrasicolus”(L.) in the Zrmanja River estuary (Adriatic Sea, Croatia) ”. Estuarine, Coastal and
Shelf Science. 69(3): 439-448, 2006.
[9] Pertierra J.P. : “Biologıa pesquera de la anchoa, Engraulis encrasicolus, del litoral Catalan ”.Thèse de
Doctorat, Université de Barcelone. Espagne. 281 p., 1992.
Suivi de l’Activité de la Pêche Hauturière de la Sole Solea aegyptiaca dans le
Gouvernorat de Sfax
Suivi de l’activité de la pêche hauturière de la sole Solea aegyptiaca dans
le gouvernorat de Sfax
Khalifa Faten1, Hajji Ferid2, Ghorbel Mohamed3, Jarboui Othman3
Institut National des Sciences et Technologies de la Mer (Centre de Sfax)
E-mail : [email protected]
2
Institut Supérieur de Biotechnologie- BiotechPôlet - [email protected]
3
Institut National des Sciences et Technologies de la Mer - [email protected]
- [email protected]
1
SUMMARY
Tunisia occupies a strategic position in the sector of the fishing in Mediterranean. Certainly, the region of
Sfax is considered among the most productive zone in Tunisia. The port of Sfax was a site of fishing offshore
units that attracts a number important of benthic trawl. This work represents a contribution to the study of the
offshore fishing activity of the Solea aegyptiaca in the governorate of Sfax during the four seasons. It consist
to realize, through surveys conducted at the port, two types of analyzes: a quantitative analysis to determine
the average seasonal landings of the Solea aegyptiaca by fishing offshore units and qualitative analysis to
determine the demographic structure of this species in this region. The quantitative analysis showed that the
production was balanced during winter and spring seasons and decreased in summer. The qualitative analysis
established during the three seasons proved that most individuals disembarked are mature and that the
presence of immature individuals is weak.
Keywords: benthic, fishing, Solea aegyptiaca, disembarked, mature
RESUME
La Tunisie occupe une position stratégique dans le secteur de la pêche en méditerranée. En effet, la région de
Sfax est considérée comme une zone parmi les plus productives en Tunisie. Le port hauturier de Sfax est un
site d’activité de la pêche hauturière qui attire un nombre important des chalutiers benthiques. Ce travail
représente une contribution à l'étude de l'activité de pêche hauturière de la sole Solea aegyptiaca dans le
gouvernorat de Sfax durant quatre saisons successives. Il consiste à réaliser, grâce à des enquêtes menées au
port, deux types d'analyses: une analyse quantitative afin de déterminer les débarquements saisonniers
moyens de la Sole débarquée par la pêche hauturière et une analyse qualitative pour établir la structure
démographique de cette espèce dans la région. L’analyse quantitative montre que la production est presque
stable durant la saison d’hiver et de printemps puis elle diminue en été. L’analyse qualitative établis pendant
les trois saisons montre que la plupart des individus débarqués sont matures et que la présence des individus
immatures est faible.
Mots clés : Benthiques, pêche, Solea aegyptiaca, embarquement, mature.
INTRODUCTION
Le chalutage a été utilisé, depuis longtemps, dans l’opération de pêche des organismes
marins. Il est scindé généralement en trois types : Le chalutage pélagique qui cible les
espèces pélagiques, le chalutage semi pélagique et le chalutage benthique qui s’intéresse
plutôt aux espèces démersales benthiques [1]. En Tunisie, ce dernier type de chalutage est
de loin le plus utilisé dans la région sud de pays. La région de Sfax représente l’une des
ressources de production halieutique dans le golfe de Gabès et en Tunisie [2]. En effet, le
port hauturier de Sfax constitue un site d’activité de la pêche hauturière qui attire un
nombre important des chalutiers benthiques du golfe de Gabès. La région de Sfax occupe
une place de choix dans les pêcheries tunisiennes caractérisées par la pêche des espèces
benthiques à haute valeur commerciale telles que la Sole Solea aegyptiaca, le poulpe
commun Octopus vulgaris, la Seiche Sepia officinalis, les deux espèces de Rouget Mullus
barbatus et Mullus surmeletus, le Pageot commun Pagellus erythrinus, la Marbré
Lithognathus mormyrus et la Crevette royale Melicertus kerathurus [3]. Toutes ces espèces
sont ciblées par le chalutage benthique. Dans ce travail, on s’intéresse seulement à la Sole
Gouvernorat de Sfax
Solea aegyptiaca dont on va étudier, la production mensuelle moyenne par sortie et par
chalutier chaque saison ainsi qu’on va établir les structures démographiques de cette espèce.
MATERIELS ET METHODES
Ce travail a demandé notre présence dans le port hauturier de Sfax lors de débarquements
de la production, de bonne heure juste avant les ventes enchères, en menant des enquêtes
bien appropriées. Cette méthode nous a permis de collecter beaucoup d’informations
valables et utiles pour des analyses statistiques. Il est important de signaler que les enquêtes
avec les patrons ont été effectuées durant une période de 9 mois (du novembre 2004 jusqu'à
juillet 2005).
Dans le présent travail, nous avons commencé par la saisie et l’archivage des données
issues des enquêtes. C’est ainsi que nous avons suivi la production moyenne par sortie et
par chalutier qui a été calculée selon la procédure suivante :

Pmoy=


Pmoy : Production mensuelle moyenne par sortie et par
chalutier.
P(i,j) : La production durant la sortie (i) débarquée par le
chalutier (j).
nj : Nombre de sorties pour le chalutier j.
Pour étudier qualitativement la production de Solea aegypatiaca et établir la structure
démographique en taille, nous avons effectué des opérations d’échantillonnage biométrique
à l’aide d’un ichtyomètre graduée à 0,5 mm près dans le marché de gros de Sfax. Nous
identifions d’abord l’espèce, puis nous mesurons la longueur totale de chaque échantillon
prélevé. Dans le présent travail, nous nous sommes basés sur un protocole
d’échantillonnage assez bien approprié aux débarquements de la production par les
chalutiers dans le port de Sfax dont la stratification temporelle choisie était le trimestre.
Dans la pratique, l’opération consiste, selon la stratification choisie, à regrouper les
différentes distributions de fréquences de tailles obtenues au niveau de la zone d’étude. Les
élévations au niveau des captures totales se font par le calcul d’un facteur d’extrapolation
pour chaque strate. La structure démographique finale des captures serait alors la somme
des structures démographiques des captures obtenues au niveau de chacune des strates
temporelles. Ceci se traduit mathématiquement comme suit :
Pour une strate temporelle choisie, en considérant les annotations suivantes :
Dj : Distribution de fréquence de taille durant le jour (j)
Cij : Nombre d’individus de la classe de taille (i) de la distribution Dj
n : Nombre d’opérations d’échantillonnage
Le nombre d’individus mesurés de la classe de taille (i) durant la strate temporelle choisie
serait alors :
N e = C ij1+ + C ij2 + .... + C ijn
Le facteur d’extrapolation (Fex) utilisé lors des élévations au niveau des captures totales
s’écrit de la manière suivante :
Fextr =
PQd
PQe


PQd: Poids des quantités débarquées.
PQe: Poids des quantités échantillonnées.
Le nombre d’individus capturés correspondant à la classe de taille (i) pendant la strate
spatio-temporelle (ST) est : C iST = N e × Fextr
Le nombre total des individus de la classe de taille (i) capturés durant toute l’année dans la
zone d’étude serait égale à la somme des individus capturés pendant les quatre trimestres de
l’année. Définitivement, on aura donc : Ci = CST1 + CST 2 + CST 3 + CST 4
Gouvernorat de Sfax
Production mensuelle moyenne par sortie et par chalutier de Solea aegyptiaca dans le
port de Sfax
Dans le port de Sfax, et durant la période d'étude (novembre 2004 – juillet 2005), l'apport
mensuel moyen par sortie et par unité de pêche est assez régulier (Figure 1). Ainsi, durant
les mois d’hiver, cet apport tend à augmenter jusqu'au début de la saison printanière avec 53
kg en mars alors que l'apport atteint 36 kg par sortie en novembre. Au cours des 3 mois du
printemps, les fluctuations sont très faibles. Par contre, nous enregistrons une chute
remarquable au mois de juin jusqu'à 30 kg par sortie et par unité et une augmentation
considérable en juillet (39,5 kg).
Figure 1: Variation de la production mensuelle moyenne par sortie et par chalutier de Solea aegyptiaca
dans le port de Sfax (novembre 2004-juillet 2005)
Il est à noter que l’apport mensuel moyen par sortie et par chalutier est faible pendant la
période de ponte de la sole qui s'étend de mois de novembre jusqu'a février. Ceci est dû à la
migration de cette espèce aux zones côtières pour la ponte.
Structures démographiques de Solea aegyptiaca
Dans cette étude qualitative, nous élaborons la structure démographique chez Solea
aegyptiaca débarquée par les chalutiers dans le port de Sfax durant quatre strates
temporelles (chaque strate correspond à une saison).
Figure 2: Structure démographique de Solea
aegyptiaca débarqué dans le port de Sfax par
la pêche au chalut en automne 2004
aegyptiaca débarquée dans le port de Sfax
par la pêche au chalut en hiver 2004
Gouvernorat de Sfax
La structure démographique de Solea aegypatiaca en automne 2004 est irrégulière. Les 300
individus constituants les captures présentent des tailles comprises entre 12,5 et 23 cm. Les
tailles les plus représentées s’étendent entre 14 et 21 cm (Figure 2). 70 % des individus
capturés par le chalut benthique sont matures sachant que la taille de maturité sexuelle
(TMS) est de 15,5 cm [4]. Toute fois, il est à noter que les fréquences de tailles entre 20 et
23 cm sont faibles sachant que la période de ponte de cette espèce commence en automne
(mois de novembre) ce qui explique la diminution des grands individus qui occupent les
zones côtières pour la ponte.
L'histogramme des fréquences de tailles chez cette espèce durant la période hivernale
montre une structure polymodale, l’hiver est la période caractéristique de la ponte de la Sole
(décembre – janvier et février). La taille minimale observée au sein des échantillons
prélevés est de 14 cm et la taille maximale est de 23,5 cm (Figure 3). La taille la plus
fréquente est 17,5 cm et les tailles les plus touchées sont celle comprises entre 16,5 et 22
cm. La majorité des individus ont déjà atteint la maturité sexuelle.
Les 311 individus échantillonnés pendant la période printanière présentent des tailles
comprises entre 13,5 et 29 cm (Figure 4).
aegyptiaca débarquée dans le port de Sfax par
la pêche au chalut au printemps 2005
Figure 5: Structure démographique de
Solea aegyptiaca débarquée dans le port
de Sfax par la pêche au chalut en été 2005
Le nombre des individus immatures n'est pas très important et la majorité des individus
sont matures, dans cette saison Solea aegyptiaca a achevé sa ponte. En été, Les tailles de
393 individus de sole débarqués sont comprises entre 13 et 24 cm. Les individus les plus
fréquents ont une longueur comprise entre 16,5 et 20 cm. Au-delà de ces longueurs,
l’effectif des individus diminue énormément (Figure 5). Pendant les mois de juin et juillet,
la majorité des individus capturés par le chalutage benthique ont déjà atteint leur maturité
sexuelle, sauf quelques individus qui sont immatures. Pendant le mois d’août, les chalutiers
sont en période de repos biologique.
CONCLUSION
D’après notre étude quantitative de Solea aegyptiaca débarqué par les chalutiers accostés au
port hauturier de Sfax, nous remarquons que la production mensuelle moyenne par sortie et
par chalutier de cette espèce est variable d’une saison à une autre. Ceci peut être dû à
plusieurs facteurs, tel que les conditions climatiques, le lieu de pêche, les caractéristiques
techniques des chalutiers et l’effort déployé. En effet, cette espèce considérée parmi les
espèces benthiques les plus exploitées durant les dernières années dans le golfe de Gabès
Gouvernorat de Sfax
[3]. La distribution des tailles chez la sole Solea aegyptiaca établis pendant les quatre
saisons montre que la plupart des individus débarqués par les chalutiers accostés au port de
Sfax ont déjà atteint la taille de maturité sexuelle et que l’effectif des spécimens immatures
n’est pas important. La présence des individus immatures montre bien que la sélectivité du
chalut est assez faible. De plus, les dernières études d’évaluation des stocks menées par
l’INSTM [5] ont montré que la majorité des espèces benthiques exploitées dans la région de
golfe de Gabès sont surexploitées.
BIBLIOGRAPHIE
[1] M’helti M., 1984. Le chalut à grande ouverture verticale (GOV) du laboratoire des techniques de pêche de
l’INSTOP Essais dans la mer tunisienne et comparaison avec le chalut méditerranéen et crevettier.
Rapp. Doc.Inst.Natn.Scient. Tech.Océanogr. Pêches Salammbô.1 : 1-25.
[2] Bradai M. N., Quignard J. P., Bouain A., Jarboui O., Ouannes-Ghorbel A., Ben Abdallah L., Zaouali J. &
Ben Salem S. 2004. Ichtyofaune autochtone et exotique des côtes tunisiennes: recensement et
biogéographie. Cybium, 28 (4): 315-328.
[3] Khalifa, F. 2006. Contribution à l’étude de la pêche hauturière dans la région de Sfax. 107p.
[4] Jarboui O., Ghorbel M., Bradai. M.N, Bouain A. & A. Elabed, 1999 - La sole Solea aegyptiaca
CHABANAUD, 1927 : Distribution géographique et reproduction dans la région du golfe de Gabès.
Bull. I.N.S.T.M., N.S. (4) : 24 –27.
[5] Anonyme, 2002. Projet National de Recherche de l’INSTM : Evaluation des Ressources Halieutiques
Tunisiennes (1996- 2002) : volume 2 : rapport final : espèces démersales, espèces pélagiques et
indicateurs socio-économiques.2.246p.INSTM.
Performance Reproductive des Femelles de la Daurade royale (Téléostéen, Sparidae) des
Côtes Sud de la Tunisie (Golfe de Gabes) selon les Critères Anatomiques et Histologiques
Performance reproductive des femelles de la daurade royale (Téléostéen,
Sparidae) des côtes sud de la Tunisie (Golfe de Gabes) selon les critères
anatomiques et histologiques
A. Hadj Taieb, M. Ghorbel & O. Jarboui
Institut National des Sciences et Technologies de la Mer (Centre de Sfax) BP 1035 – 3018 Sfax
E-mail : [email protected]
RESUME
La daurade royale Sparus aurata représente une espèce marine à une valeur économique importante pour la
région. Les données sur la production locale montrent une augmentation durant les dernières années.
Cependant, les études biologiques sur cette espèce sont encore rares. La présente étude a donc pour but
d’examiner la performance reproductive du poisson en analysant les critères morpho-anatomiques (rapport
gonado-somatique RGS), la taille à la première maturité, et puis l’histologie des gonades. Deux années
d’échantillonnage ont été effectuées durant mars 2008-février 2010, s’étalant sur les côtes sud de la Tunisie.
Les données obtenues ont été analysées statistiquement. Les gonades ont été traitées histologiquement puis
analysés pour leur ovogenèse. Durant les cycles, 442 femelles et 520 mâles ont été examiné. La taille des
poissons ont varié entre 10,1-35 cm pesant 11-350 g. RGS chez les femelles varie de 0,19 à 7,07%.
L’histologie des ovaires a montré des ovogonies qui ont dominés les ovaires au repos, les vitéllogenèses
endogènes à la prématuration, et les vitéllogenèses exogènes à la maturation. Les femelles peuvent atteindre
leur première maturité à la taille de 19,1 ± 0,21 cm.
Mots clés : Daurade royale, performance, reproduction, côtes sud de la Tunisie.
INTRODUCTION
La daurade royale Sparus aurata est un poisson osseux appartenant à la famille des
Sparidae, l’une des principales familles à grande diversité spécifique et à haute valeur
commerciale. Sparus aurata est un poisson téléostéen qui habite sur les fonds durs (rochers
et conglomérats) ou sableux, les jeunes sur herbiers, sur le plateau et la pente continentale
jusqu’à 250 m, surtout jusqu’à 100 m. (FISHER et al, 1987). Etant donné que Sparus
aurata existe à des profondeurs variables, sa capture est réalisée par multitude engins de
pêche tel que le chalut, le trémail, les ‘charfias’, les nasses et les sennes de plages. Le
présent travail vise l’étude de la biologie de la reproduction de la daurade royale Sparus
aurata Linnaeus, 1758 sur les côtes sud de la Tunisie, appuyée par une description
histologique des gonades femelles au cours des principales étapes de l’ovogenèse.
Au cours de ce travail, nous avons examiné 1065 individus de Sparus auratus, pêchés dans
le golfe de Gabès (Carte 1) entre mars 2008 et février 2009, ayant des longueurs totales
(LT) comprises entre 10,1 et 39 cm et réparties en 520 mâles, 442 femelles, 76
hermaphrodites et 27 indéterminés. Le matériel biologique, ayant servi à réaliser cette
étude, provient de l’échantillonnage régulier aux principaux points de débarquement du Sud
tunisien (Port de Sfax, Sidi Mansour, Kerkennah, Mahrès, Gabès et Zarrat).
Détermination de la Période de ponte
Après prélèvement des gonades et la distinction entre les deux sexes, la détermination de la
période de ponte est basée sur le suivi des variations mensuelles du Rapport GonadoSomatique (RGS). Le RGS traduit l’évolution en masse des gonades par rapport à la masse
du poisson éviscéré. Il est calculé en utilisant la formule suivante :
RGS 
Mg
 100
Mév
Avec Mg : masse des gonades en grammes et Mév: masse du poisson éviscéré en grammes.
Etude de la maturité sexuelle
Pour l’étude de la taille de maturité sexuelle, nous avons pu calculer pendant la période de
reproduction pour chaque classe de taille de 1 cm, les proportions des individus matures.
La taille de première maturité sexuelle qui correspond à la longueur pour laquelle 50% des
individus sont matures a été déterminée en utilisant une fonction logistique qui relie les
proportions d’individus matures à la longueur totale du poisson (PAULY, 1980 ;
GHORBEL et al., 1996). Cette fonction permet de suivre le degré de maturité sexuelle
selon la taille et d’estimer avec précision les longueurs (L25), (L50) et (L75) souvent
utilisées par les modèles d’évaluation des stocks.
Cette fonction est de la forme :

P  1 / 1  e  r ( LL5 0 )

Avec : P : proportion des individus matures et L : longueur du poisson en cm ;
Cette équation peut être ajustée par la méthode itérative à partir du logiciel ‘FSAS’.
L’application du test statistique 2 nous a permis de vérifier le degré de fiabilité des
résultats obtenus. Ce test s’écrit de la façon suivante :
r
 cal 2  
i 1
 f i obs 
f i th 
2
f i th
fiobs: Nombre de matures observés ; fith: Nombre théorique de matures estimés à partir de
la fonction logistique et r : Nombre de classes de tailles observées.
La valeur de χ2 cal est comparée à χ2 th à (r-1) degré de liberté à un seuil de sécurité α =
0,05.
Etude histologique des ovaires
L’étude microscopique a nécessité le suivi des étapes suivantes :
- Fixation: bouin alcoolique et inclusion à la paraffine
- Coupe: à 5 μm
- Coloration: hématoxyline (pour la coloration du noyau) / fuchsine et acide acétique
(pour la coloration du cytoplasme
RESULTATS ET DISCUSSION
Période de ponte
L’évolution mensuelle du rapport gonado-somatique (RGS) montre que ce dernier
augmente rapidement (surtout chez les mâles) et atteint une valeur maximale de 7,072 en
novembre pour les femelles et 4,638 en novembre pour les mâles. Ensuite, le RGS diminue
jusqu’au février traduisant ainsi le phénomène de ponte (Fig. 1). Donc la période de ponte
chez les deux sexes de S. aurata du golfe de Gabès se situerait entre novembre et février.
Figure 1: Variations mensuelles du RGS chez S. aurata du golfe de Gabès
Pour confirmer les résultats que nous avons eu avec l’évolution du rapport gonadosomatique, nous avons fait une étude microscopique de la gamétogenèse (ovogénétique).
L’analyse du cycle sexuel chez S. aurata du golfe de Gabès montre que la ponte dure
environ quatre mois (novembre, décembre, janvier et février). La période de ponte de S.
aurata du golfe de Gabès est hivernale, elle concorde avec celles obtenues dans d’autres
secteurs de la Méditerranée (Hadj Taieb et al., 2013).
Maturité sexuelle
En appliquant la fonction logistique sur ces données, nous avons pu déterminer la taille de
première maturité sexuelle L50, chez les femelles. Les femelles deviennent matures pour la
première fois lorsqu’elles atteignent une longueur totale de 19,1 ± 0,21 cm soit 14,93 cm de
longueur standard (figure 2). L’application du test ² confirme bien ces résultats : pour les
femelles, ² = 0,146. En effet, ces valeurs sont inférieures à la valeur théorique qui est de
26,296 pour un degré de liberté de 16 et un risque α= 0,05.
Figure 2 : Représentation graphique de la maturité sexuelle chez les femelles de Sparus aurata du golfe
de Gabès
Histologie
L’étude histologique nous a permis de distinguer des gonades hermaphrodites et de dégager
cinq stades différents (figure 3).
NU
CYT
N
NU
N
F
M
CYT
Gonade Hermaphrodite
Stade I (Ovocyte primaire)
Stade II (Pré-vitellogenèse)
E
ZR
NU
ST III
ST III
IV
N
CYT H
ZR
N
IL
V
CYT
Stade III (Vitellogenèse primaire)
Stade IV (Vitellogenèse secondaire) Stade V (Vitellogenèse avancée)
Figure 3 : Histologie des Ovaires de Sparus aurata du golfe de Gabès; M: Partie mâle, F: Partie femelle,
N: Noyau, NU: Nucléoles, CYT: Cytoplasme, CYT H: Cytoplasme hétérogène, V: Vacuole , ZR: Zona
Radiata, IL: Inclusion Lipidique, IV: Inclusion Vitelline, E: Enveloppe


Stratégie reproductive: l’hermaphrodisme est protandrique.
Développement Ovarien : au cours de l’ovogenèse nous avons pu distinguer la prévitellogenèse ou croissance cytoplasmique de l’ovogonie et la vitellogenèse qui
inclut toutes les étapes de formation des globules lipoprotéiques depuis l’étape de
l’ovocyte primaire jusqu’à la maturation.
CONCLUSION GENERALE
L’analyse du cycle sexuel et l’étude microscopique des ovaires chez Sparus aurata du golfe
de Gabès montre que la ponte est étalée de novembre jusqu’au février.
Pour la détermination de la taille de la première maturité sexuelle, nous avons trouvé que
50% sont matures à 19,1 ± 0,21 de longueur totale pour les femelles.
[1] Fischer W., Schneider M. & Bauchot M. L., 1987. - Fiches F.A.O d’identification des espèces pour les
besoins de la pêche. (Révision I). Méditerranée et Mer noire, Zone de pêche 37, II. Vertébrés.7611530. Rome: FAO.
[2] Pauly D., 1980. - A selection of simple methods of assessment of tropical fish stocks. FAO. Fisheries
Circular, FIRM/C, 727: 1-54.
[3] Ghorbel M., Jarboui O., Bradai M. N., A. Bouain, 1996. - Détermination de la taille de première maturité
sexuelle par une fonction logistique chez Limanda limanda, Pagellus erythrinus et Scorpaeana
porcus. Bull. INSTM, N.S, 3 : 24 - 27.
[4] Hadj Taieb A., Ghorbel M., Ben Hadj Hamida N., O. Jarboui, 2013. – Sex ratio, reproduction and growth
of gilthead sebream Sparus aurata in the Gulf of Gabes, Tunisia. Ciencias Marinas 39(1): 101-112.
Assessment of Diversity and Distribution of Macro Benthic Invertebrates in Anzali
Lagoon- Iran
Assessment of Diversity and Distribution of Macro benthic invertebrates
in Anzali Lagoon- Iran
1,2
Mahshid Jalili11, Fatemeh Amini Yekta2
Iranian National Institute for Oceanography and Atmospheric Science (INIOAS)
1
Corresponding Author: [email protected]
SUMMARY
Macrobenthic invertebrates of the Anzali lagoon were studied in order to investigate their population density,
distribution and abundance. Anzali lagoon with an area of 200 km² is located in the south-west of the Caspian
Sea. Samples were obtained in 4 stations seasonally and taken with a 250 Cm² Van Veen grab from spring to
winter with 3 replicates. Environmental factors such as temperature, grain size, TOM, salinity, pH and
dissolved oxygen were also considered. 36 species were identified. The most abundant species were
Chironomus sp., Scirtes tibiolis, Ambrysus mormon of insecta, and Tubifex sp. of Oligochaeta, which were
present in samples. But Valvata cristata of Gastropoda was observed only in summer. The Shannon-wiener
index fluctuated 0- 2.64. Abundance and diversity of macroinvertebrates was maximum in spring and autumn.
In spring it can be related to spawning and recruitment of the macrobenthos in Siah Keshim Wetland. In
autumn greater amount of invertebrates in the environment can be as a result of reduction in water
temperature which reduces the feeding rate of predatory fishes. Summer and winter benthic invertebrates
were smaller in number and diversity. Most fishes of Anzali Lagoon are benthic feeders, so in summer when
water temperature rises, they become more active in feeding macrobenthos. As a result their frequency and
diversity reduces in summer. Winter in Siah Kashim coincides with death of many macrophytes, which provide
space for aggregation of insect larvae as benthic animals. This may cause a reduction in benthos of Siah
Kashim in winter.
Key words: Distribution, Anzali lagoon, Macro benthos, Invertebrates, Shannon index, Abundance, Iran
INTRODUCTION
Anzali lagoon is a coastal liman, or lagoon, in the Caspian Sea near Bandar-e Anzali, in the
northern Iranian province of Gilan. The lagoon divides Bandar-e Anzali into two parts, and
is home to both the Selke Wildlife Refuge and the Siahkeshim Marsh [3]. The lagoon's
water ranges from fresh near the tributary streams to brackish near the mouth into the
harbor and the sea. Macrobenthos are defined as invertebrates living in or on the sediments
or close to hard substrates. Macro benthos play an important role in aquatic ecosystems [5].
They are as bio indicators of environment and ecosystems. They are often a major
component the diet of many fish species [1]. Abundance and diversity of benthic organisms
are controlled by various environmental parameters such as temperature, salinity, dissolved
oxygen (DO), organic meter (OM) and sediment texture [2]. Among studies done on
macrobenthos of Anzali wetland, Mirzajani [4] did comprehensive study on the relation
between fish catches values and macrobenthic biomass in Caspian sea. Although excellent
works have been done by National Inland water Aquaculture Institute, few studies are
published internationally on macrobenthos of the Anzali lagoon.
Samples were obtained in 4 stations seasonally and taken with a 250 Cm² Van Veen grab
from spring to winter with 3 replicates (Figure 1, Table 1). Environmental factors such as
temperature, grain size, TOM, salinity, pH and dissolved oxygen were also considered.
Samples were sieved in 1 mm mesh and preserved in ethanol 96%. After sorting sample to
main benthic groups, species were identified up to possible levels and were counted for
more analyses.
International Congress on "Estuaries and Coastal Marine Protected Areas" ECPA 2014 (Izmir - Turkey) Page 120
Lagoon- Iran
Table 1: Geographical coordinates of
Sites
1
2
3
4
Geographical coordinates
N3725251 E04920758
N3725372 E04921446
N3725356 E04921659
N3724591 E04923070
sampling sites
Species diversity in sampling sites was
evaluated
with
Shannon–Wiener,
Environmental factors including pH (NBS),
temperature and salinity in each site were
measured in situ by Hach HQ40d portable
meter and a WTW 315i salinometer.
Figure 1: Sampling locations in Anzali lagoon
and surrounding waters
CONCLUSION
36 species were identified. The most abundant species were Chironomus sp., Scirtes
tibiolis, Ambrysus mormon of insecta, and Tubifex sp. of Oligochaeta, which were present
in samples. But Valvata cristata of Gastropoda was observed only in summer (table2).
Table 2: Presence and absence of identified macro benthos in sampling sites
Taxon
St 1
Scirtes tibiolis
Chironomus
Ambrysus mormon
Drenectes depressus
Coonagrion angulatum
Ischnura verticalis
Bezzia glabra
Hydropsyche instabilis
Dytiscidae
Laccobius
Rhithrogena semicolorata
plea leachi
Hydroporus
Spaniotoma
Helochares maculicollis
Pelocoris shoshone
Hesperocorixa
Lispocephala koalae
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
St
2
*
*
*
*
*
*
*
*
St
3
*
*
*
*
*
*
St
4
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
Taxon
St 1
Omophrom tanneri
Coenagrion mercuriale
Ptecticus
Caenis ordella
Dromogomphus
Basiaeschna
Zaniagrion exclamation
Helobdella stagnalis
Glossiphonia heteroclita
Phagocata vitta
Tubifex
Lumbriculus variegatus
Limnaea auriculata
Valvata cristata
Radix lagotis
Gyralus gredleri
Theodoxus pallasilindh
Gamarus pulex
*
*
*
The Shannon-wiener index fluctuated 0- 2.64. Abundance
macroinvertebrates was maximum in spring and autumn (table3).
*
*
*
*
*
*
*
St
2
*
St
3
*
St
4
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
and
*
*
*
*
diversity
*
*
*
*
of
Table3: Shannon-wiener values in each stations
Seasons
Spring
summer
Autumn
Winter
St1
2.06
1.095
2.124
0.758
St2
1.31
1.1436
2.297
0.44
St3
1.01
0.86
2.118
0.02
St4
1.23
1.273
2.52
0.81
In spring it can be related to spawning and recruitment of the macrobenthos in Siah Keshim
Wetland. In autumn greater amount of invertebrates in the environment can be as a result of
Lagoon- Iran
reduction in water temperature which reduces the feeding rate of predatory fishes. Summer
and winter benthic invertebrates were smaller in number and diversity. Most fishes of
Anzali Lagoon are benthic feeders, so in summer when water temperature rises, they
become more active in feeding macrobenthos. As a result their frequency and diversity
reduces in summer. Winter in Siah Kashim coincides with death of many macrophytes,
which provide space for aggregation of insect larvae as benthic animals. This may cause a
reduction in benthos of Siah Kashim in winter.
REFERENCES
[1] Bedulli, D., Bassignani, F. and Bruschi, A., 2002. Use of biodiversity hotspots for conservation of Marine
Molluscs: a regional approach. Mediterranean Marine Science, 3/2: 113-121.
[2] Hawksworth, F.G. and Wiens, D., 1996. Dwarf Mistletoes: Biology, Pathology, and Systematics, Chapter
7: Ecological relationships. Agriculture Handbook 709, United States Department of Agriculture
Forest Service, Washington, DC.
[3] Holcik, Juraj and Oláh, János ., 2008. Introduction Fish, Fisheries and Water Quality in Anzali Lagoon and
Its Watershed Food and Agriculture Organization, Rome.
[4] Mirzajani, A.R., Ghaninezhad, D., Ghanesasan Saraei, A., 2005. The relation between fish catches values
and macrobenthic biomass in Caspian Sea of Guilan Province. Pajouhesh- VA- Sazandegi. Fall, 18:3
(68 IN ANIMAL AND FISHERIES SCIENCES). 2- 9.
[5] Williams, K. A., Green, D. W. J. and Pascoe, D., 1984. Toxicity testing with freshwater
macroinvertebrates: methods and application in environmental management. In: Freshwater
Biological: Advances in Water pollution Control, eds. Pascoe, D & Edwards, R. W. Pergamon Press,
UK.
Structure and Diversity of Macrobenthic Communities along the Northwestern Coasts
of the Gulf of Tunis
Structure and diversity of macrobenthic communities’ along the
northwestern coasts of the Gulf of Tunis
Wafa B.1, Dorsaf C.1, Dorsaf B. I.1, Oum Kalthoum B. H.1 and Tlig - Zouari Sabiha1*
Research Unit of Integrative Biology and Functional and Evolutionary Ecology of aquatic environments Faculty of Sciences of Tunis - University of Tunis El Manar - academic campus 2092 El Manar II - Tunis /
Tunisia - +216 71 872 600 - [email protected]*
1
SUMMARY
The aim of the present work is to follow the benthic macrofauna diversity in the sandy and rocky coastal zone
of the northwestern part of the Gulf of Tunis. Although this basin has been the subject of several studies on the
diversity of benthic fauna, data on benthic macro-invertebrates remain limited to deep areas. Therefore, it
was necessary to undertake a study of the current benthic macrofauna at the sandy and rocky coastline (0 to
3m depth) of the northwestern part of the Gulf of Tunis. The main objectives of this study are to characterize
the environment by the study of abiotic factors (granulometry and organic matter content), to analyze the
benthic macrofauna of soft and rocky substratum and to study the impact of sedimentological factors on the
assemblages’ structure of benthic communities.
Key words: diversity, structure, macrofauna, coastline, Gulf of Tunis.
INTRODUCTION
The Gulf of Tunis is a relatively rich and diversified area. However, it is affected by a high
level of pollution because of the growing pressure of human activities namely industry,
urbanization, tourism, overfishing and chemical fertilizers use [1]. This sector has been the
subject of several studies about benthic fauna diversity ([2]; [3]; [4]; [5]). However, these
studies are limited to separated examinations of some aspects without evoking the general
state of ecosystems and the relationships between their different compartments [6]. For
those reasons, a study of the current benthic macrofauna at the sandy and rocky coastline of
the northwestern part of the Gulf of Tunis was undertaken. This work aims mainly to an
edaphic characterization of the environment, an analysis of the benthic macro fauna in soft
and rocky substratum and a study of the impact of sedimentological factors on the
assemblages’ structure of benthic communities.
To do this, 15 stations were selected. Stations selection was based on the presence / absence
of nuisance, accessibility, bottom’s depth and type. Thus nine stations with soft sediment
(S2, G3, K4, K5, RO6, ro7, GA8, M9, Si10) and six bedrock stations (Ile1, S2, G3, GA8,
M9, Si10) have been prospected at the northwestern part of the Gulf of Tunis (Fig. 1). A
total of 75 samples were performed during the spring 2012, using quadrate of 0.25m² of
surface at the rate of 5 replicates in each station at a depth of 0 to 3 meters.
Figure 1: Distribution of prospected stations along the northwestern part of the Gulf of Tunis
(Google Earth, 2012)
The analysis of sedimentological parameters (granulometry and total organic matter
content) at the sandy stations ([7]; [8]) revealed that the superficial sediments are mainly
composed of fine and coarse sand except that of Sidi Bou Said station which is a mixture of
sand and gravel. The estimated total organic matter content showed a relatively low rate
(<5%) and normal sediments. The macro invertebrates’ inventory on the prospected
coastline along the north-western part of the Gulf of Tunis led to the identification of 54
species (36 in soft sediment and 19 on bedrock substrate) divided into four zoological
groups namely the mollusks, the annelids, the arthropods and the echinoderms. The soft
substratum is marked by the dominance of mollusks while the rocky bottom is dominated
by arthropods (Fig. 2).
Figure 2: Percentages of zoological groups collected from the coastal zone of the northwestern part of the Gulf of
Tunis, according to the total abundance (Spring, 2012)
The total abundance value estimated in the sandy and rocky bottoms along the northwestern part of
the Gulf of Tunis is about 1481.80 ind/m². Arthropods represent the dominant taxon with 837.89
ind/m² namely 56.54% then mollusks with 583.66 ind /m² namely 39.39%. Annelids reached 58.65
ind / m² or 3.95% and finally echinoderms with 1.6 ind/m² or 0.10%. The estimated values of
Shannon-Weaver index (H') showed that prospected stations are moderately disturbed except those
of Raoued (Ro6) and of Ghar El Melh (G3) which are disrupted. The Equitability index (E) also
revealed that the majority of the populations are slightly unbalanced (Tab. 1). In addition, the
estimation of AMBI and BENTIX indexes explained that most surveyed stations along the study
area are marked by a normal state.
Table 1: Intersection of recorded biotic indices along the Northwestern part of the Gulf of
Tunis
The check of the trophic structure showed the presence of seven trophic groups’ in the soft
sediment (Fig. 3). Surface deposit feeders recorded the most important percentages for the
majority of stations (49.54%). As for the rocky substratum, it was marked by the dominance
of suspensivores (65.31%) mainly represented by the crustacean Balanus amphitrite.
Figure 3: Global composition percentages’ of the
trophic groups in the intertidal zone of the
northwestern part of the Gulf of Tunis according
to the abundance (Spring, 2012)
Figure 4: Global composition percentages’ of
ecological groups in the coastal zone along the
northwestern part of the Gulf of Tunis according
to the abundance (spring, 2012)
Over the four enumerated ecological groups, sensitive species (GI) remain the most
common in both types of substratum (Fig. 4). The analysis of the structure of benthic macro
invertebrates’ communities (dendrogram of Bray Curtis and nmMDS analysis) led to
identify two groups of stations in the two types of substratum (Fig. 5). The mostly
contributing species to the dissimilarity (Simper test) are Cerithium vulgatum (25.14%) and
Bittium reticulatum (23.88%) at the soft bottom and Balanus amphitrite (52.16%) and
Littorina neritoides (19.00%) on the rocky bottom (Tab. 2).
Table 2: Simper test
Figure 5: Multivariate non-parametric analyses
CONCLUSION
The present work is a study of the benthic macrofauna in the sandy and rocky coastal zone
of the northwestern part of the Gulf of Tunis. The granulometric analysis of the collected
sediments showed semi logarithmic curves with a parabolic shape reflecting the
heterogeneity of the analyzed coarse fraction. This parabolic profile indicates a
heterogeneous coarse sedimentary fraction. That seems to explain that the sediments of
continental origin are deposited by charge excess after being transported in a high energized
environment. The type of the superficial sediments (mainly fine and coarse sands) confirms
the results reported by Addad et al. [9] during their work on the geochemical
characterization of the superficial sediments of the Gulf of Tunis. As for the low organic
matter levels obtained in this work, they seem to indicate that the surface sediments are
normal. This result suggests a lack of correlation between grain size and organic matter
content. The study of the benthic communities’ dynamics along the north-western part of
the Gulf of Tunis revealed the presence of 54 species belonging to 4 zoological groups:
mollusks, arthropods, annelids and echinoderms. This area is mainly dominated by
arthropods in bedrock while the soft substrate is characterized by the dominance of
mollusks. The species richness value is unevenly distributed according to the substratum
nature. The highest value was recorded at the soft substrate (36 species), while at the level
of the bedrock, only 19 species have been inventoried.
In quantitative terms, the abundance of benthic macro fauna in bedrock (1160 ind / m²) is
higher than that of the soft substrate (321ind / m²). This abundance difference could be
attributed to the existence of numerous epibiontic organisms [11] in particulary the
crustacean Balanus amphitrite. Indeed, this species is characterized by its tolerance to large
changes in physicochemical factors and by its resistance to pollution and hydrodynamism
([12]; [10]). The abundance value estimated in this study is lower than that evaluated by
Tilg-Zouari et al. [10] on the Gulf of Tunis (Kourbous, Haouaria and Zembra) and in the
Gulf of Hammamet (9784 individuals). This could be related to the physicochemical
variations and to the anthropogenic stresses. The majority of the stations with soft substrate
are marked by the predominance of the both Gastropods Bittium reticulatum and Cerithium
vulgatum. The clear dominance of the polychaete Scolelepis foliosa at Raoued stations’
(Ro6 and Ro7) could be attributed to its high tolerance to environmental variations. The
amphipod Talitrus saltator dominates in Sidi Ali El Mekki and Ghar El Melh (G3) stations.
This crustacean is a good indicator of environmental stress [13] and the variation of its
density appears to be related to anthropogenic impacts. The domination of accidental
species could be attributed to their high tolerance to the environmental variations ([14];
[15]).
The low values of Shannon-Wiener (H ') and Equitability (E) indices, for the majority of
prospected stations (both substrates) could be in relationship with the dominance of one
species at the expense of the others. This phenomenon is widespread in intertidal
populations’ ([16]; [17]). Our results seem to be consistent with those of Tlig- Zouari et al.
[10] in the Gulf of Tunis (Kourbous, Haouaria and Zembra) and int the Gulf of Hammamet
(Kelibia). These authors explained this disequilibrium by the overwhelming dominance of
Chthamalus stellatus. The intersection of the various calculated biotic indices (H ', E, ITI,
AMBI and BENTIX) revealed slithly umbalanced populations in the majority of prospected
stations.
Benthic communities, epifauna as well as endofauna, were regarded as natural monitoring
tools and anthropogenic long term changes indicators in marine ecosystems [4]. These
organizations are able to ensure their trophic needs from the sediment, the sediment-water
interface and from the water column [18]. The great diversity of trophic groups obtained in
this work (Carnivores, Herbivores, Suspensivores, Necrophages, Omnivores, Micro grazers
and Surface deposit feeders) suggests that the populations of these stations are not disturbed
and stressed. The dominance of surface deposit feeders in soft substrates may be related to
continental sediments’ inputs which are rich in nutrients. Our results are in disagreement
with those of Tlig-Zouari et al. [19] which revealed the dominance of Suspensivores in the
majority of Tunis Bay and Monastir Bay stations. However, the preponderance of
suspensivores (mostly the crustacean Balanus amphitrite) in rocky substratum could be
attributed to the significance of the hydrodynamism favoring nutrient inputs [20] and to the
absence of predation and competition between species.
Furthermore, the dominance of sensitive species (GI) at both types of substrate (soft and
rocky) seems to be related to the absence of organic pollution [21]. Our results are in
agreement with those obtained by Ayari and Afli [22] at the Bay of Tunis.
The analysis of the assemblages’ structure by Bray-Curtis dendrogram and the
Multidimensional nonparametric analysis (MDS), at both types of substrate, revealed two
main clusters. At the stations with soft sediments, the isolation of Raoued (Ro6, Ro7) and
Gammarth (Ga8) of the other stations seems to be attributed to their geographical proximity
reflecting the homogeneity of their environmental factors. While in rocky substratum
stations, the isolation of Sidi Ali el Mekki (S2) and Sidi Bou Said (Si10) may be related to
the low recorded density of the crustacean Balanus amphitrite compared to other stations.
The ANOSIM test showed that the sedimentary factors (granulometry and organic matter
content) may have no effect on the organization of benthic macrofauna assemblages’ at the
stations with sandy bottom. This could be related to the variations of physico-chemical
parameters, the hydro dynamism and the availability of resources. Our results are in
discordance with those reported by Diawara et al. [4] and Tlig- Zouari and Maamouri [23]
who studied the diversity of the benthic macrofauna of the northern lagoon of Tunis. These
authors noted the importance of edaphic factors in the structuring of benthic communities
assemblages’.
In conclusion, the state of the surveyed coastline seems to be unperturbed sheltering
balanced populations except those of some stations (Raoued Ro6 and Ro7 and Gammarth
Ga8) which are unbalanced. The study of the benthic fauna diversity may be of a great
importance for assessing the ecological status of the Gulf of Tunis ecosystem. It would be
interesting to purchase this study with a spatio-temporal monitoring of the benthic
ecosystem in order to better evaluate its ecological status.
ACKNOWLEDGEMENTS
The authors are grateful to the Unit members for their help during the sampling period and
in the different analyzes realization. We also wish to acknowledge the referees, and the
scientific committee for the organization of the international congress “Estuaires and
Costal Protected Areas” (ECPA 2014).
REFERENCES
[1] Oueslati, A : (“Littoral et aménagement en Tunisie’’) (Ronéo) (2004)
[2] Ben Alaya, H : (“Répartition et condition d’installation de Posidonia oceanica Delile et Cymodocea
nodosa Asheron dans le golfe de Tunis’’) (Bulletin de l’Institut National Scientifique et Technique
d’Océanographie Mer de Salammbô) (1972)
[3] Zaabi, S - Afli, A : (“Structure générale des peuplements d’annélides polychètes dans le secteur nord-est
du golfe de Tunis’’) (Bulletin de l’Institut Nationale des Sciences et Technologies de la Mer,
Salammbô) (2005)
[4] Diawara, M - Tlig-Zouari, S - Rabaoui, L - Ben Hassine, OK: (“Impact of management on the diversity of
macrobenthic communities in Tunis north lagoon: systematic’’) (Cah. Biol. Mar.) (2008)
[5] Tlig-zouari, S - Mami, TH - Maamouri, F: (“Dynamics and structure of Benthic Macroinvertebrate
Communitys in the Northern lagoon of Tunis (Tunisia)’’) (Journal of the Marine Biological
Association of the United Kingdom) (2009)
[6] Ben Mustapha, A - Afli, A: (“Quelques traits de la biodiversité en Tunisie’’) (Proposition d’aires de
conservation et de gestion) (2005)
[7] Rivière, A : (“Méthodes Granulométriques (Techniques et Interprétations)’’) (Edit. Masson, Paris) (1977)
[8] Moreno, MT - Audesse, P - Giroux, M - Frenette, N - Cescas, M : (“Compraison entre la détermination de
la matière organique des sols par la méthode de Walkley black et la méthode de perte au feu’’)
(Agrosol) (2001)
[9] Addad, A - Ben Mammaou, A - Abdeljaoued, S - Essonni, N - Fernex, F: (“Caractérisation géochimique
des sédiments de surface du golfe de Tunis’’) (Bull. Inst. Natn.Scien. Tech. Mer de Salammbô)
(2003)
[10] Tlig-Zouari, S - Rabaoui, L - Fguiri, H - Diawara, M - Ben Hassine, OK: (“Spatial diversity of Rocky
midlittoral macro-invertebrates associated with the endangered species Patella ferruginea (Mollusca:
Gastropoda) of Tunisian coastaline’’) (Estuarine, Coastal and Shelf Science) (2010)
[11] Ponsero, A - Sturbois, A : (“Les invertébrés des estrans meubles et rocheux’’) (Manuel d’étude et de
gestion des oiseaux et de leurs habitats en zones côtières) (2012)
[12] Werner, WE: (“The distribution and ecology of the barnacle Balanus trigonus’’) (Bull. Mar. Sci.) (1967)
[13] Fanini, L - Contarino, CM - Scapini, F: (“Relationships between the dynamics of two Talitrus saltator
populations and the impacts of activities linked to tourism’’) (OCEANOLOGIA) (2005)
[14] Rilov, G - Benayahu, Y - Gasith, A: (“Life on the edge: do biomechanical and behavioral adaptations to
wave-exposure correlate with habitat partitioning in predatory whelks’’) (Mar Ecol Prog Ser) (2004)
[15] Nakhlé, KF - Cossa, D - Kalaf, G - Beliaeff, B: (“Brachidontes variabilis and Patella sp. as quantitative
biological indicators for cadmium, lead and mercury in the Lebanese coastal waters’’)
(Environmental Pollution July) (2006)
[16] Hawkins, SJ - Hartnoll, RG: (“Settlement patterns of Semibalanus balanoides’’) (Journal of Experimental
Marine Biology and Ecology) (1982)
[17] Dye, AH: (“Community-level analyses of long-term changes in rocky littoral fauna from South Africa’’)
(Marine Ecology Progress Series) (1998)
[18] Grall, J - Hily, C : (“Traitement des données stationnelles (faune)’’) (Rebent) (2003)
[19] Tlig-Zouari, S - Rabaoui, L - Cosentino, A - Irathni, I - Ghrairi, H - Ben Hassine OK: (“Macrofauna
associated with an introduced oyster, Pinctada radiata: Spatial scale implications of community
differences’’) (Journal of Sea Research) (2011)
[20] Qui, JW - Quian, PY: (“Effects of food availability, larval source and culture methodon larval
development of Balanus amphitrite Amphitrite Darwin: implications for experimental design’’)
(Journal of Experimental Marine Biology and Ecology) (1997)
[21] Rosenberg, R: (“Benthic marine fauna structured by hydrodynamic processes and food availability’’)
(Netherland Journal of Sea Research) (1995)
[22] Ayari, R - Afli, A: (“Functional groups to establish the ecological quality of soft benthic fauna within
Tunis Bay (Western Mediterranean)’’) (Vie et Milieu) (2008)
[23] Tlig-Zouari, S - Maamouri, F: (“Macrozoobenthic species composition and distribution in the Northern
lagoon of Tunis’’) (Transitional Water Buletin) (2008).
Otolith Morphology Description of some Sparidae in the Central Coasts of Algeria
Otolith morphology description of some Sparidae in the central coasts of
Algeria (South Mediterranean Sea)
Boufersaoui Samira1, Bakiri Nesrine, Souidi Nassima, Harchouche Kamel
1
University of sciences and technologies Houari Boumedienne, laboratory of Halieutic-(n°32 El-Alia Bab
Ezzouar 16111)-(Algiers, Algeria)-([email protected]).
SUMMARY
The morphology of the sagittal otoliths of three species belonging to the Sparidae family were studied: the
axillary (Pagellus acarne), the striped (Lithognathus mormyrus) seabreams and the red porgy (Pagrus
pagrus). Otolith morphometric observations included, weight, width, and dimensions of rostrum. Regression
models relating each otolith morphometric parameter to fish length are provided. Statistical tests to examine
correlation between left and right otolith dimensions and weight were carried out, correlation in otolith
morphology between sexes was also analysed. As a result of this analysis, it is possible to identify the species
from the Sparidae family by the otoliths characters. Otolith length and weight appeared to have the best
discrimination for estimating fish length.
Keywords: Otolith, morphology, Seabreams, Sparidae.
INTRODUCTION
In Osteichthyan, species there are three such otic sacs in the inner ear, each containing a
calcareous structure, an otolith that acts as a mechanoreceptor stimulating the kinocilia (hair
cells) of the macula. The three otic sacs are the sacculus, utriculus and lagena, which
contain three otoliths: the sagitta, lapillus and asteriscus respectively [1]. Differences in
otolith shape tend to reflect phylogeny and development, although there is considerable
inter- and intra-specific variation. Inter-specific differences in shape appear to be due to
both genetic and environmental influences [2]. Due to their inter-specific variation in shape,
otoliths have been found to be useful in taxonomy [3], as well as permitting the study of
food webs from partially digested remains [4]. Otoliths have been extensively used in the
understanding of marine food webs, particularly at the upper trophic levels [5]. The
adequate identification of fish prey from otoliths is essential in feeding studies, where the
relationship between otolith length and fish size or weight given by specific regression can
also be used to estimate the size and/or mass of prey [6]. Furthermore, fishery biologists
have been using this information as an indirect indicator of fish distribution and also for
quantifying the potential effects of natural predation [7].
The aim of the present study was to provide new information regarding otolith morphology
and body size relationships of three of the more abundant Sparids in the Central coastal
waters of Algeria (South Mediterranean sea). Also to determine whether there are
differences in the morphology of the left and right Sagittae. Although marine fish otoliths
have been studied to a greater extent, Shepherd (1914)[8] was the first freshwater fish
biologist to describe otoliths of a few freshwater species, including some Sparid. Kinacigül
(2000)[9] studied a systematic of Sparidae using her otolith characters in Aegean Sea.
513 Fishes of three Sparids (Pagellus acarne, Lithognathus mormyrus and Pagrus pagrus)
were collected from commercial catches landed from central Algerian coastal areas, by
Algiers fleets (90% bottom trawlers and 10% artisanal fleet, both gillnets and handline). For
each fish, the total length (TL, 0.1 cm), was measured. The number of observations on each
species and range in fish lengths is given in Table 1. The fish lengths available for each
species were those observed in commercial fisheries. The red porgy length (P. pagrus)
ranged from 109 to 400 mm, in the axillary seabream (P. acarne) from 102 and 264 mmm,
the last specie; the stripped seabream (L. mormyrus) the total length fluctuated from 115 to
352 mm. The otoliths were removed from the frontal side of the exposed neurocranium
(Mahé et al., 2009). They were cleaned in distilled water, dried at room temperature. The
otoliths are weighed on precision balance (to 0.001 g). Morphological characteristics of the
otoliths were studied under a stereomicroscope. They were measured for length using an
image analysis. Several images from left and right otoliths are saved and then later
measured, using TsView software. The otolith length (OL) was recorded as the greatest
distance measured from the anterior rostrum to the posterior edge, parallel to the sulcus.
The breadth of otolith (BO) was recorded as the greatest distance measured from the right
to the left edge (Fig. 1). The rostrum is another distinguishing feature of the otolith and is
located at the anterior ventral part of the otolith, it length (RL) was measured from the
notch to the anterior limit.
The OL, OB, RL and RB were measured to the nearest 0.01 mm. The fish length-otolith
dimensions (LO, BO, RL, BL) relationships were examined by using the following
equation: TL = a + bx,
where: TL - fish length, x - otolith length, a - intercept value, b -coefficient value.
Sex-linked changes in fish length and otolith length were examined statistically with the
ANCOVA test.
Figure 1 : The used measurements of an otolith. Otolith length (OL), otolith breadth (OB),
rostrum length (RL), rostrum breadth (RB)
Table 1 : Morphological presentation of the body fish in L. mormyrus, P. acarne and P. pagrus
L. mormyrus
N
307
Mean 206.9
Min. 115
Max. 352
SEM 0.31
P. acarne
111
172.7
1020
264
0.34
P. pagrus
95
216.8
109
400
0.73
RESULTS
Comparison
Similarity of left and right otoliths was assessed using the paired t-test (table 2), and
significant differences were found only for rostrum length (RL) of otolith in L. mormyrus.
These differences were considered as negligible, and all otolith measurements used in the
subsequent analysis were arbitrary from the right otoliths. Regression coefficients of otolith
mensuration’s (OL, BL, RL and BL) to fish length were not significantly different for male
and females specimens (ANCOVA, p>0.05).
Table 2 : Differences between right and left otoliths of three Sparid fish from the central
coasts of Algeria tested by paired t-test
Species
Total length range(mm)
P. acarne
102-264
P. pagrus
109-400
L. mormyrus
115-350
Parameter
OW
OL
OB
RL
RB
OW
OL
OB
RL
RB
OW
OL
OB
RL
RB
N
111
111
111
111
111
95
95
95
95
95
307
307
307
307
307
t-value
0.42
0.31
0.06
1.49
1.33
0.14
0.6
0.28
0.24
0.62
0.19
0.25
0.32
2.33
0.78
P-value
0.855
0.951
0.545
0.263
0.616
0.988
0.479
0.983
0.892
0.976
0.895
0.903
0.859
0.027
0.756
Table 3: Differences between right and left otoliths of three Sparid fish from the central coasts
of Algeria tested by ANCOVA test. Min; minimum; Max: maximum;
SEM: standard error of mean. NS: non-significant
L. mormyrus
P. acarne
P. pagrus
Mensuration OL
F
M
Mean
6.77
6.48
SEM
0.11
0.12
Min. (mm)
3.95
3.96
Max. (mm)
9.00
8.65
ANCOVA
NS
Mean
7.01
6.43
SEM
0.17
0.12
Min. (mm)
4.71
4.83
Max. (mm)
9.95
7.84
ANCOVA
NS
Mean
8.587
8.572
SEM
0.502
0.382
Min. (mm)
5.000
7.549
Max. (mm)
12.1919
11.2157
ANCOVA
NS
OB
F
3.42
0.04
2.15
4.88
M
3.30
0.05
2.15
4.19
RL
F
2.25
0.04
1.09
3.20
NS
3.71
0.08
2.66
4.94
NS
4.948
0.205
3.102
6.44852
3.39
0.08
2.58
4.48
4.519
0.183
3.743
5.42159
NS
1.85
0.07
1.23
3.29
NS
1.462
0.103
0.758
2.5175
M
2.18
0.05
1.21
3.05
NS
1.60
0.04
1.22
1.97
1.355
0.110
0.989
1.87901
NS
RB
F
1.38
0.03
0.78
2.41
M
1.33
0.04
0.64
2.18
NS
2.67
0.05
2.06
3.30
NS
2.744
0.127
1.791
3.81323
2.46
0.06
1.62
3.06
2.662
0.171
1.952
3.29452
NS
Morphometric description
The range in observed values for otolith length, width, rostrum length and breadth for each
of the species considered is given in Table 4. Because the difference between left and right
pairs were non-significant, arbitrary we used the right otolith. Table 4 shows also mean
values, and standard error of mean, for all dimensions of otolith. P. acarne Otoliths is oval
with a round rostrum; the antirostrum is very small, sharp or round. Wide dorsal area lies
across the sulcus (Figure 2). The Otolith of L. mormyrus and P. pagrus area in the form of
cubiceps, oval, slightly elongated in stripped seabream, and irregularly pentagonal in a red
porgy. Rostrum of L. mormyrus otolith is protruded and rounded; antirostrum is flat or very
slightly round. It is protruded in P. pagrus. The values of individual maximum otolith
length (OL) were between 3.68 mm (L. mormyrus) and 12.99 mm (P. pagrus). Otoliths of
red porgy were the largest, reaching up to 12.99 mm, starting from 4.46 mm.
Based on changes observed in morphology, we separated otoliths in three categories
according fish growth: Category I includes specimens from 110 to 160 mm (TL), category
II includes those from 170 to 220 mm TL, and those from 230 and more were included in
category III.
For average (category II) sizes in Lithognathus mormyrus otolith’s, the general shape was
slightly elongated at the rostrum, the borders are toothed. Unlike the Pagellus acarne and
Pagrus pagrus.
For large size, it is observed that the otoliths of three species are morphologically different.
The otolith of L. mormyrus is significantly extended in the rostrum, these peaks are well
defined with a lobed dissimilar that of P. acarne, in which edges were sculpted and less
elongated. P. pagrus shows otolith regularly with curved edges.
Table 4 : Morphological presentation of the sagittal otolith taken from three Sparid of central
coast of Algeria. N: number, Min; minimum; Max: maximum;
SEM: standard error of mean. CI: confident interval
Otolith length
Pa
Pp
N
111 95
Mean
6.461 7.524
Min.
4.058 4.463
Max.
9.945 12.988
SEM
0.105 0.204
95% C.I. 0.411 0.800
Lm
307
6.415
3.678
9.471
0.069
0.270
Otolith breadth
Pa
Pp
Lm
111 95
307
3.455 4.917 3.299
2.265 3.074 2.099
4.942 7.535 4.884
0.051 0.101 0.026
0.200 0.396 0.102
Rostrum length
Pa
Pp
Lm
111 95
307
1.656 1.404 2.160
0.959 0.694 1.083
3.295 2.794 3.198
0.036 0.045 0.024
0.141 0.177 0.093
Rostrum breadth
Pa
Pp
Lm
111 95
307
2.498 2.724 1.316
1.521 1.348 0.595
3.297 4.955 2.562
0.037 0.071 0.020
0.145 0.276 0.078
Figure 2 : Mesial views of the Sagitta of (A) L. mormyrus (B) P. acarne and (C) P. pagrus. Scale bars=1
mm
Otolith mensuration-fish length relationships
Otolith length versus fish length (Table 5) demonstrate a fitted relationship, especially for
P. pagrus, however P. acarne seems to have more dispersion in data. Generally those
relationships between fish length and otolith length was linear, and most of the variability
was explained by the regression (R2>0.700). The equation for red porgy was the highest for
the sampled species. Otolith length versus weight seemed to be non-linear and was
described by a power equation, the coefficient of determination being higher than 0.8 in all
species (Table 5). There was no significant relationship between fish length, breadth otolith
(BL) and rostrum mensurations (RL, RB) for Pagrus pagrus (Table 6). Suggests a nonlinear
relationship that is again difficult to recognize due to lack of juvenile fish.
Table 5: Relationship between the total fish length–otolith length (TL– OL) and total fish
length– otolith weight (TL – OW) and coefficients of determination (R2) for three
Sparid fish species caught in the central coastal waters part of Algeria
Species
P. acarne
P. pagrus
L. mormyrus
TL-OL
TL=2.77 OL - 0.65
TL=3.5 OL - 4.64
TL=4.03 OL-5.18
R2
0.72
0.95
0.78
TL-OW
TL= 78,94 OW0,41
TL =85,61 OW 0,475
TL=141.37 OW0 ,53
R2
0.895
0.960
0.880
Table 6: Relationship between the total fish length–otolith length (TL– OL) and total fish
length– otolith weight (TL – OW) and coefficients of determination (R2) for three Sparid
fish species caught in the central coastal waters part of Algeria
Species
P. acarne
P. pagrus
L. mormyrus
TL-BL
5.09 OB -0.3
0.74 OB + 18.03
8.29 BL + -6.64
R2
0.578
0.011
0.472
TL-RL
6.14 RL + 7.11
2.39 RL + 18.32
8.27 RL + 2.82
R2
0.416
0.022
0.395
TL-RB
5.57 RB + 3.36
0.46 RB + 20.43
8.91 RB + 8.97
R2
0.363
0.002
0.319
CONCLUSION
Generally, there were no statistical differences observed between left and right Sagittae
otoliths for the three Sparids; there was, however, a statistical difference suggested for
rostrum length differences between left versus right otoliths from the striped seabream (L.
mormyrus). All equations relating otolith length and weight to fish total length for all
species studies explained a very large proportion of the variance in the data. Analysing the
morphometric relationships, we concluded that otolith length and otolith mass are good
indicators of fish length. Total fish length can be modelled as a linear function of otolith
length, and total body weight can be predicted using a power function of otolith weight. The
positive correlation between otolith length and fish length and the specific shape of the
otoliths of these three species should enable researches to identify these species from the
stomach contents of predators. The estimate of otolith morphometric and the correlation
with fish size indicates further analysis should be undertaken. The potential application of
this relationship for age validation studies will be examined in a future study after age
determination of samples.
REFERENCES
[1] Panfili, J-De Pontual, H-Troadec, H-Wright, P: "Manual of fish sclerochronology"(Ifremer-ird) (2002).
[2] Torres, G. J-Lombarte, A-Morales-Nin, B: "Variability of the sulcus acusticus in the sagitta otolith of the
genus Merluccius"(Fisheries Research) 46, 5–13(2000).
[3] Hecht, (1979)
[4] Alonso, M.K-Pedraza, S.N-Schiavini, A.C.M-Goodall, R.N.P- Crespo, E.A: "Stomach contents of false
killer whales (Pmldorctlcra.uidem) stranded on the coasts of the Strait of Magellan,Tierra dei
Fuego”( Mtlrine McIlmnal Science 15, 712-724)(1999).
[5] Smale, M. J-Watsong, H: “Otolith atlas of southern African marine fishes” (Ichthyological Monograph
JLB Smith Insti-tute of Ichthyology, 1: 253) (1995).
[6] Waessle et al., 2003
[7] Mauco, L- Favero, M - Bó, M.S: “Food and feeding of the common tern (Sterna hirundo) in
Samborombón Bay, Buenos Aires, Argentina”(Waterbirds , 24: 89-96) (2001).
[8] Shepherd, C.E; “Fossil otoliths” (Knowledge 39:177–184)(1914).
[9] Kinacig L, H.T- Lkyaz, A.T-Met N, G- Ula , A- Soykan, O., Akyol, O -Gurbet, R: “A Systematic Study on
the Otolith Characters of Sparidae (Pisces) in the Bay of Izmir (Aegean Sea)”( Turk J Zool 24 357364) (2000).
[5] Williams, K. A., Green, D. W. J. and Pascoe, D., 1984. Toxicity testing with freshwater
macroinvertebrates: methods and application in environmental management. In: Freshwater
Biological: Advances in Water pollution Control, eds. Pascoe, D & Edwards, R. W. Pergamon Press,
UK.
Gastrocotylidae) Parasitizing Trachurus trachurus (Linnaeus, 1758) from the Gulf of Béjaia
Description of Gastrocotyle trachuri Van Beneden &Hesse, 1863
(Monogenea: Gastrocotylidae) parasitizing Trachurus trachurus
(Linnaeus, 1758) from the gulf of Béjaia
Ichalal Keltoum 1,2, Ider Djamila1,2 and Ramdane Zouhir1,2
Laboratoire Associé en Ecosystèmes Marins et Aquacoles (LAEMA), Université A/Mira - Faculté des
Sciences, Béjaïa (06000), Algérie.
2
Laboratoire de zoologie appliquée et d’écophysiologie animale, Université A/Mira - Faculté des Sciences,
Béjaïa (06000), Algérie. E- mail: [email protected]
1
SUMMARY
The present study was conducted in the gulf of Béjaia (Algerian coast). 888 specimens of Trachurus trachurus
L. were examined for their parasitofauna between February 2013 and February 2014. Among the collected
parasites species, the monogenean Gastrocotyle trachuri Van Beneden & Hesse, 1863 was founded on the gill
of T. trachurus. The morphology of this species has been studied using light microscope. The measurements
and the drawings of the morphological features of G. trachuri have been performed using respectively an
ocular eyepiece and a camera lucida. . The size of G. trachuri varies between 0.5 and 1.4mm. Our specimens
show the same morphological features of those collected in other regions of the Mediterranean Sea. In this
species, the opisthaptor has a particular morphology (contains numerous clamps). The monogenean presents
a low prevalence (P=1.12%). This species parasitized in particular hosts with 18.14cm mean length.
Keywords: trachurus trachurus, Gastrocotyle trachuri, description, gulf of Bejaia.
INTRODUCTION
Monogenean trematodes are Platyhelminthes, mostly ectoparasites on fish (Justine, 2013
and Kearn, 2014). They belong to one of the most species rich classes of fish parasites and
they are commonly found on fish gills and skin (Akmirza, 2013). Gastrocotyle trachuri is a
monogenean species which is known to be very harboured by horse mackerel Trachurus
trachurus (Llewellyn, 1959, 1962). Knowledge on the description of this gill parasite is
very scarce and should be considered.This is why we are interested to study the morphology
of G.trachuri.
888 specimens of T. trachurus were randomly sampled from the Fishing port of Béjaia
(East cost of Algeria) (Fig. 1). Sampling was carried out from February 2013 to March
2014. All were cleaned, photographed under light microscope and drawed with the help of
camera lucida for anatomical studies. Then preserved in 70% ethanol in order to further
studies. Monogenean parasites were collected from gills of Trachurus trachurus.
Figure 1: Localisation of the sampling area
RESULTS
29 species of monogenean were collected throughout the area of study. The majority of this
species were presented by Gastrocotyle trachuri with 14 specimens.
Figure2: Variation of parasitological indices of G. trachuri as a function of months.
P: Prevalence; Mi: Mean intensity
Fish sampled in December, (Fig.2), marked the highest infestation rates by G.trachuri
which was marked by 6.06%. However, the fish sampled in February, April, May and June
was reporting low prevalence and fluctuate between 0.06% and 3.33%.
Figure 3 : Gastrocotyle trachuri. whole animal. Ventral view. (A) drawing with camera lucida. (B) under
light microscope. M :Mouth ; P : Pharynx ; Cot : Cotylophore ; O : Ovary ; Vit : Vitellaria. Scale bar =
0,5mm.
Taxonomic
classification
Gastrocotyle trachuri van Beneden et Hesse, 1863
Order: Gastrocotylinae Sproston, 1946
Family: Gastrocotylidae Price, 1943
Genus: Gastrocotyle van Beneden et Hesse, 1863
Site of infection: Gill filaments
Description
G. trachuri is an elongated worm 1,3 mm. Long (Fig.3), narrow in its anterior third but
considerably broader (1 mm.) in its posterior two-thirds along the left side of which is borne
the cotylophore. The cotylophore bears one series of 30-33 suckers, each sucker measuring
0.08 mm. in diameter.Vitellaria extending throughout length of body.
DISCUSSION
G.trachuri is a monogenic species which is very common in horse mackerel trachurus
trachurs. Gills are the specific binding site of this parasite. The highest parasitic infection
rate was reported in December. This could be explained by the physiological activities of
trachurus trachurus and unfavorable conditions of his environment that promote the
proliferation of parasites. In this study, the number of suckers recorded on specimens of
G.trachuri is located between 30 and 33.This fork was established by (Van Beneden and
Hesse, 1864) by giving the number of suckers as 31-38, and (Paroni and Perugia, 1890) as
about 35. However, a slight difference was observed and this could be explained by the
number of parasite sampled.
CONCLUSION
Specimens of G.trachuri collected on trachurus trachurus from the gulf of Bejaia exhibit
morphological similarity with those reported in the literature. The difference existing
between the numbers of suckers reflects the larval stages of G.trachuri. It is very interesting
to further studies on numerous specimen of this species to show more detail and to facilitate
their identification.
REFERENCES
[1] Justine J-L., Rahmouni C., Gey D., Schoelinck C., Hoberg E.P. : The Monogenean Which Lost Its
Clamps. PLoS ONE 8(11): e79155. doi:10.1371/ journal.pone.0079155 2013.
[2] Kearn G.C. : Some Aspects of the Biology of Monogenean (Platyhelminth) Parasites of Marine and
Freshwater Fishes. Oceanography 2: 117. doi:10.4172/2332-2632.1000117.2014
[3] Akmirza A. : Monogeneans of fish near Gökçeada, Turkey. Turkish Journal of Zoology 37: 441-448
.2013.
[4] Llewellyn J. : The larval development of two species of gastrocotylid trematode parasites from the gills of
Trachurus trachurus.J.mar.biol.Ass.U.K.38 461-467. 1959.
[5] Llewellyn J.D.Sc. : The life histories and population dynamics of monogenean gill parasites of Trachurus
trachurus (L.). J.mar.biol.Ass.U.K.42, 587-600. 1962.
[6] van Beneden, P.J., and Hesse, E. Recherches sur les bdellodes et les trématodes marines.
Mem.acad.Roy.Soc.Belgique, Vol.34, pp.117-118.1864.
[7] Paroni, C. and Perugia, A. Trematodi parassiti delle branchie de i pesci italiana.Atti.Soc.Ligusta, di sc.egeogr., Genova, Vol 1 No. 1, pp.59-70. 1890, a. On Gastrocotyle .Atti.Soc.Ligusta, Vol.1, No.3,
pp.225-242.1890, b.
Diversity and Distribution of Epibiotic Bryozoans of Molluscs of the North and Northeast
Tunisian Coasts
Diversity and distribution of epibiotic bryozoans of molluscs of the north
and northeast Tunisian coasts
Dorsaf B. I.1, Wajdi F.1, Souad B. J.1, Oum Kalthoum B. H.1, Tlig Zouari Sabiha1*
Research Unit of Integrative Biology and Functional and Evolutionary Ecology of aquatic environments Faculty of Sciences of Tunis - University of Tunis El Manar - academic campus 2092 El Manar II - Tunis /
Tunisia - +216 71 872 600 - [email protected]*
1
SUMMARY
This work is focused on the study of epibiotic bryozoans of molluscs (gastropods and bivalves) of the north
and north-east Tunisian coasts. The main objectives of this study are to establish a list of marine and lagoon
epibionts bryozoans; to understand the structure and distribution of populations of these taxa, and to
investigate about the possible relationships that can be established between bryozoans and some molluscs.
The study of the Bryozoan fauna allowed us to identify 29 species belonging to three orders: Cheilostomata
(89.66%), Cyclostomata (6.90%) and Ctenostomata (3.45%). The majority of bryozoans collected (72.41%)
are strictly marine species, as to strictly lagoon species, they constitute only 3.45%, represented by the species
Scrupocellaria scrupea.
INTRODUCTION
The assessing of ecosystems status could be achieved through the study of benthic
macroinvertebrates [1]. Among the macro benthic invertebrates, the Bryozoa remains
unknown taxa and could give us an idea about the ecosystems state, hence the need to work
on this phylum [2]. Several studies concerned various aspects of bryozoans of the
Mediterranean ([3]; [4]; [5]; [6] and [7]). Note that the majority of these studies concern the
north shore of the Mediterranean ([4]; [5] and [7] ..). The few studies effectuated on the
Tunisian coast are limited to qualitative studies led to the identification of 225 species of
bryozoans ( [8] ; [9] ;[10] ; [11]; [12] and [2]). Work on the environmental aspects are rare
and have targeted the bryozoan epibionts attached to living substrates such as the work of
Rabaoui et al. (2009) [13]on Pinna nobilis and Ben Ismail (2012) [2] on Posidonia oceanica
. To fill some gaps, we are interested in the study of these organisms epibionts in the north
and north-east of the Tunisian coast we have considered the marine and the lagoon sites.
The Shelly substrate corresponds to the specimens of the molluscs classes (gastropods and
bivalves).
For this purpose, twelve stations were prospected belonging into two environment types:
marine and lagoon. Thus eight marine stations (Tabarka, Bizerte, Kalaat El Andalous,
Gammarth, La Goulette, Radès, Sidi Raies and Korbous) and four lagoon stations (Bizerta
lagoon, Kalaat El Andalous lagoon, the south and the north lagoon of Tunis) were selected
on the north and the northeast of Tunisian coast (Fig. 1) . Samples of molluscs are collected
by scuba diving at a depth ranging from 0 to 5m. The sampling is performed during the
spring and summer period, from March to September 2013. The mollusc shell was carefully
cleaned to remove impurities and algal epibionts and rinsed with water. Then it was dipped
in a solution of sodium hypochlorite to 6% for a few hours (6-12 hours) to whiten the
bryozoan’s colonies [14] for better observation of morphological characters.
Tunisian Coasts
Figure 1: Distribution of different studied stations (Google map 2013)
Legend: 1 : Tabarka ; 2 : Bizerta Lagoon; 3 : Bizerte ; 4 : Kalaat El Andalous Lagoon; 5 : Kalaat El Andalous
; 6 : Gammarth ; 7 : La Goulette ; 8 : north Lagoon of Tunis ; 9 : south Lagoon of Tunis ; 10 : Radès ; 11 : Sidi
Raies ; 12 : Korbous
967 specimens of Molluscs were examined belonging to the two gasteropoda and bivalva
classes, only 221 specimens were occuped by the epibiontic bryozoans. A total of 29
species of bryozoans were identified. The latter belong to 17 families, 3 orders and 2
classes. The Cheilostomata presented 89.66% at the overall sample, and are represented by
26 species. The Cyclostomata constitute 6.9% and were represented by 2 species, while the
Ctenostomata, which are presented only by a single species Scrupocellaria scrupea,
represent 3.45% of all the species found (Fig. 2).
Ctenostomata
3,45%
Cyclostomata
6,90%
Cheilostomata
89,66%
Figure 2: Distribution of bryozoans according to their orders
The marine environment is much richer in bryozoans with the presence of 21 species of
bryozoan which constitutes 72.41% of all species inventoried. The specie Scrupocellaria
scrupea, was only collected at the Bizerta lagoon (3.44%). we Note that 7 species of
Tunisian Coasts
bryozoans
(24.14%)
(Crassimarginatella
sp.,
Crassimarginatella
maderensis,
Crassimarginatella solidula, Cellepora pumicosa, Turbicellepora avicularis, Hagiosynodos
lata and Schizoporella dunkeri) were taken in both marine and lagoon environments, they
are considered as mixed species (Fig. 3)
Lagoon species
3.44%
Mixed species
24,14%
Marine species
72,41%
Figure 3: Distribution of bryozoans by type of environment (Marine and Lagoon)
Bryozoan's specific richness varies from one station to another. La Goulette has the largest
diversity with 18 species including 2 Cyclosomata species and 16 Cheilostomata species.
The value of the lowest species richness was recorded at the coast of Bizerte with only two
species. In stations Korbous, Tabarka and the north and south of Tunis lagoon, we have not
met epibiotic bryozoans on collected mollusks. Ctenostomata have only been found in
Gammarth site represented by the specie Zoobothyron verticillatum. in Rades, Sidi Raies,
the lagoon and the beach of Kalaat El Andalous and the lagoon and the coastline of Bizerte,
the Cheilostomata were the only bryozoans observed (Fig.4).
20
18
16
Specific Richness
14
12
10
8
6
4
2
0
Biz
M.A. lag
K.A. lag
K.A pla
Gam
Goul
Ra
S.R
Cyclostomata
0
0
0
0
0
2
0
0
Ctenostomata
0
0
0
0
1
0
0
0
Cheilostomata
2
3
6
6
8
16
10
7
Figure 4: Specific richness by stations
(Biz: Bizertz; M.A lag: Bizerta lagoon; K.A lag: Kalaat landalous lagoon; K.A. pla: Kalaat Landalous; Gam:
Gammarth; Gou: La Goulette; Ra: Rades; SR: Sidi Raies)
A total of 21 species of bryozoans were observed as epibiotic fauna of gastropod's shells.
These Ectoprocta belong to the order of Cheilostomata. Bryozoa identified on the bivalve's
shells are 19 species they are as follows: 16 species of Cheilostomata, 2 Cyclostomata
species and one species of Ctenostomata (Fig.5).
Tunisian Coasts
Species number of Bryozoans
25
20
15
10
5
0
Bivalva
Gasteropoda
CtEnostomata
1
0
cyclostomata
2
0
Cheilostomata
16
21
Figure 5: Distribution of bryozoans according to the classes of epibionted molluscs
In species of molluscs Hexaplex trunculus, Bolinus brandaris, Stramonita haemastoma,
Pinna nobilis, Bolma rugosa, Ostrea edulis, Cerithium vulgatum, Crassostrea gigas and
Mytilus galloprovincialis, the epibiotic fauna is formed only by Cheilostomata. The
Hexaplex trunculus present the highest number (18 species) followed by Bolinus brandaris
which houses 13 species of bryozoan’s species.
The other species of molluscs homed different orders of bryozoans species. We note that,
Pinctada radiata; present five species of Cheilostomata and one species of Ctenostomata.
On the Arca noae it was observed and 15 species of Cheilostomata and two species of
Cyclostomata (Fig.6).
Cheilostomata
120
Cyclostomata
Ctenostomata
Bryozoa Abondance
100
80
60
117
40
2
62
20
35
1
1
1
8
27
6
a
ed
ul
as
is
so
M
s
yt
t
re
ilu
a
sg
gi
ga
al
lo
s
pr
ov
in
ci a
lis
Pi
nn
a
no
Pi
bi
nc
lis
ta
da
ra
di
at
a
Ar
ca
no
ae
1
Cr
Os
tre
vu
um
Ce
rit
hi
lm
a
lg
ru
at
u
m
go
sa
m
a
to
Bo
ha
em
as
ra
m
on
ita
us
b
lin
St
ra
Bo
pl
ex
t
ru
nc
u
lu
s
nd
ar
is
0
He
xa
2
1
Molluscs species
Figure 6: Bryozoan’s Abundance depending on the mollusc’s species
Bryozoan's cover of Molluscs shells varies among species of molluscs, the bryozoan’s
species and the surface offered by shells to bryozoan. The molluscs selected are those
showed statistically significant numbers (30 or more specimens encrusted in all combined
stations). So we chose the species Hexaplex trunculus, Bolinus brandaris and Stramonita
haemastoma (Tab.1).
Tunisian Coasts
Table 1: Effectif of encrusted molluscs by stations
The Bryozoa Crassimarginatella maderensis and Crassimarginatella solidula are strictly
restricted to the molluscs Hexaplex trunculus and Bolinus brandaris with a fairly large
cover
(25% <R <75%). In contrast, bryozoans Hagiosynodos lata and Turbicellepora
avicularis are settled on several species of molluscs with a considerable cover (5% <R
<50%). They can be considered as indifferent or cosmopolitan species (Tab.2)
Table 2: Cover Category of bryozoan species according to Braun-Blanquet the method (all
stations combined)
Molluscs species
Bryozoans species
Aplousina sp.
Beania robusta
Cellepora pumicosa
Copidozum planum
Crassimarginatella maderensis
Crassimarginatella solidula
Cryptosula pallasiana
Electra pilosa
Hagiosynodos lata
Hippaliosina depressa
Haplopoma bimucronatum
Reptadeonella violacea
Rosseliana rosselii
Schizoporella dunkeri
Schizoporella magnifica
Schizoporella mutabilis
Scrupocellaria scrupea
Turbicellepora avicularis
Watersipora subovoidea
Turbicellepora sp.
Crassimarginatella Sp.
Bolinus brandaris Hexaplex trunculus
Stramonita haemastoma
2
1
2
1
3
3
1
2
1
1
4
3
2
3
2
2
2
3
2
1
2
1
2
2
+
2
2
2
2
2
2
+
+
1
1
1
3
2
Tunisian Coasts
CONCLUSION
In this study, we prospected 12 stations distributed between marine and lagoon
environments. During our sampling campaigns, we collected 967 gastropods and bivalves
molluscs of which only 221 specimens were encrusted by bryozoans, representing 22.85%.
In total 264 colonies of bryozoans were encountered on mollusks and 29 species were
identified. They belong to three orders. The order of Cheilostomes represents 89.66% of the
overall sample. As for Cyclostomes and Ctenostomes, they are respectively represented by
6.90% and 3.45%. Our results are consistent with the results of Ben Ismail (2012) [2] who
collected the same 3 bryozoans’ orders, previously mentioned, on the detritic substrate and
in the Posidonia meadow, while noting the dominance of Cheilostomes during his work.
Our results differ from those obtained by Ward and Thorpe (1991) [14] and Rabaoui et al.
(2009) [13], in this work the Ctenostomes have not been observed on the shells of molluscs.
These authors met five species of bryozoan’s epibionts Pinna nobilis Tunisian coast. These
bryozoans: 4 species belong to the order of Cheilostomes and one species belongs to the
order of Cyclostomes. Ward and Thorpe (1991) [14], targeting epibiotic bryozoan of the
mollusc Chlamys opercularis in Northern Ireland, have identified 19 species of bryozoans
encrusting the shell of this bivalve. These species are distributed as follows: 16 species and
3 species of Cheilostomes Cyclostomes. Most of the species collected in this work are
strictly marine species represented by 72.41% of the overall sample. We met mixed species
representing 24.14% and a strictly lagoon species constituting 3.45% of the overall sample,
formed by the only species Scrupocellaria scrupea. This seems to be related to the
prevailing critical conditions in the lagoon environments. Indeed, the lagoons are exposed
to an active and continuous sedimentation and are characterized by a high variability of
physico-chemical parameters. These extreme conditions seem to be the cause of Bryozoan’s
poverty of these environments [15]. In addition, we noticed that all species encountered at
the lagoon environments are Cheilostomes while species strictly marine affinities are
Ctenostomes, the Cyclostomes and Cheilostomes. The diversity of bryozoan’s orders that
we encounter in marine environments testifies to the Bryozoologique richness of this type
of environment. This result seems to confirm the work of Prenant and Bobin (1956)[16] and
Ryland (2005) [17] that specify Cyclostomes as being exclusively sea species while
Gymnolaemata (Ctenostomes and Cheilostomes) are primarily marine species , able to
colonize other environments (lagoons) as they tolerate extreme fluctuations in
environmental factors. The richest station on Bryozoan's fauna is La Goulette with 18
species while the less rich station is the coastal of Bizerte with only two species.
11 species of molluscs are encrusted by bryozoan’s species. Gastropods appear to be a
favorable substratum for installing Cheilostomes sheltering 21 species of bryozoans
belonging exclusively to Cheilostomes, while Bivalves hosted 19 species of bryozoans
belonging to three orders (Cheilostomes, Cyclostomes and Ctenostomes).
The Hexaplex trunculus includes the largest value of bryozoan species richness with 18
species Cheilostomes. The bryozoan’s cover was estimated on the shell outside only but it
should be noted that we met, a few times, bryozoans on the shells inside. This may be
indicative of a post-mortem facility [18]. Several studies have focused on the study of the
cover of molluscs and other solid substrates by bryozoans ([19] and [14]). They reported
significant variability between different types of mollusks and substrates.
According to Ryland and Stebbing (1971) [20], this variability could be caused by several
factors. Among these factors we find selectivity imposed by the choice of the larva to the
substrate Indeed, the physical characteristics of the substrate and the sensitivity of the larvae
of these stimuli (taking into account the physical characteristics of the substrates as stimuli)
Tunisian Coasts
pushing Larvae to choose their substrates Prospective. In our case, a considerable number
of Cheilostomes colonies were observed on gastropods and specifically on the Muricidae.
The species Crassimarginatella maderensis and Crassimarginatella solidula have been
installed on Hexaplex trunculus and Bolinus brandaris while enjoying an important cover.
Thus, we can consider that these Muricidae constitue a good substratum for the
development of these two species of bryozoans and Cheilostomes in general.
As for cash Hagiosynodos lata and Turbicellepora avicularis they meet on several species
of molluscs and often with considerable cover. They could be considered indifferent or
cosmopolitans species. Hagiosynodos lata is a specie with mixed affinity that was collected
at five stations of 8 (where we met epibiotic bryozoans) .it was present on most species of
molluscs and has enjoyed highest abondance of bryozoans (52 colonies). This suggests that
this species is highly adaptable to environments and substrates changement.
This work showed that the marine environment has greater Bryozoologique biodiversity
compared to the lagoon environment and contains the most diverse stations as Gammarth
and La Goulette. This could be attributed to the difficulty of the conditions characterizing
the lagoon environment with its extreme factors and dynamics of sedimentation prevent
installation of bryozoans. Our results suggested that the order of the most abundant
bryozoans is that of Cheilostomes and the most abundant specie is Hagiosynodos lata while
the richest station is La Goulette. Note that a difference between epibiont species of
gastropods and bivalves was recorded. Gastropods seem to attract only Cheilostomes given
the number and abundance species found on this substrate.
REFERENCES
[1] Chaouati, A - Bayed, A: (“Diversité taxonomique et structure de la macrofaune benthique des substrats
meubles de la lagune de Smir“) (Travaux de l’Institut des Sciences Rabat) (2005).
[2] Ben Ismaïl,D : (“Bryozoaires des côtes Tunisiennes : diversité, distribution et caractérisation
écologique“), (Thèse de Doctorat), (Univ. Tunis El ManarTuni) (2012).
[3] Pruvot, G : (“Recherches effectuées au cours des croisières de l’ORVET dans la Méditerranée en 19211922“). (Ed. BLONDEL LA ROUGERY, Paris) (1923).
[4] Gautier ,Y. V : (“Nouveau genre et nouvelle espèce de bryozoaire ctenostome Triticellopsis tissier “ )
(Rev. Trav. Inst. Pêches Marit) (1961).
[5] Koçak, F - Balduzzi ,A - Benli ,H. A: (“ Epiphytic bryozoan community of Posidonia oceanica (L.) Delile
meadow in the northern Cyprus (Eastern Mediterranean)”) (Indian journal of Marine Science) (2002).
[6] Hondt ,J. L. d’ - Ben Ismaïl, D : (“Bryozoaires des côtes Algériennes. Compléments aux Bryozoaires de
Tunisie“) (Bull. Soc. Zool. Fr) (2008).
[7] Madurell, T – Zabala, M - Dominguez-Carrió, C – Gili, J. M: ( “Bryozoan faunal composition and
community structure from the continental shelf off Cap de Creus (Northwestern Mediterranean)”)
(Journal of Sea Research) (2013).
[8] Canu, F – Bassler, R.S: (Bryozoaires marins de Tunisie) (Pub. Stat. Océanog. Salambô) (1930).
[9] Ben Mustapha, K – Komatsu, T - Hattour ,A – Sammari, C – Zarrouk, S - Souissi ,A - El Abed, A :
(“Tunisian mega benthos from infra (posidonia meadows) and circalittoral (coralligenous) sites “) (
Bull. Inst. Natn. Scien. Tech. Mer de Salammbô) (2002).
[10] Ayari, R – Taylor, P.D – Afli, A – Aissa, P: (“A new species of the cheilostomes bryozoan
Trematooecia“ ) (Cah. Biol. Mar) (2008).
[11] Ben Ismaïl, D- Ben Hassine, O. K- Mascarell, G - d’Hondt, J. L: (“Description d’un nouveau Bryozoaire
(CHEILOSTOMES) de Méditerranée occidentale (TUNISIE): Parellisina curvirustris raibauti, Subsp.
Nov “) (Bull. Soc. zool. Fr)(2009).
[12] Ben Ismaïl, D- Rabaoui, L – Diawara, M - Ben Hassine, O. K: (“The Bryozoan assemblages and their
relationship with certain environmental factors along the shallow and subtidal Tunisian coasts“)
(Cah. Biol. Mar) (2012).
[13] Rabaoui, L - Tlig-Zouari, S - Cosentino, A - Ben Hassine, O. K: (“Associated fauna of the fan shell Pinna
nobilis (Mollusca: Bivalvia) in the northern and eastern Tunisian coasts “) (Sci. Mar ) (2009).
[14] Ward, M. A – Thorpe, J. P: (“Distribution of encrusting bryozoans and other epifauna on the subtidal
Tunisian Coasts
bivalve Chlamys opercularis “ ) (Marine Biology)( 1991).
[15] Amini ,Z- Adabi, M. H - Burrett ,C. F - Quilty, P. G: ( “Bryozoan distribution and growth form
associations as a tool in environmental interpretation, Tasmania, Australia “) (Sedimentary Geology)
(2004).
[16] Prenant, M – Bobin, G : (“Bryozoaires, Deuxième partie. Chilostomes Anasca “) (Faune de France,
Fédération française des Sociétés de Sciences Naturelles) (1966).
[17] Ryland, J. S: ( “Bryozoa: an introductory overview “) (Les deux catalogues de Haute-Autriche. Musées
nationaux)( 2005).
[18] Žítt ,J - Kopáčová ,M - Nekovařík , C : (“Epibionts of mollusc shells from the Korycany limestones
(Upper Cenomanian, Czech Republic)“) (Bulletin of the Czech Geological Survey) ( 2003).
[19] Eggleston, D: (“Factors influencing the distribution of sub-littoral ectoprocts off the south of the Isle of
Man (Irish Sea)“) (Journal of Natural History) (1972).
[20] Ryland, J. S – Stebbing, A. R. D: ( “Settlement and orientated growth in epiphytic and epizoic bryozoans
“) (in Crisp D. J., editor. Proceedings of the 4th European Marine Biology Symposium. London:
Cambridge University Press) (1971).
Reproduction of Round sardinella (Sardinella aurita Valenciennes, 1847) from
Bou-Ismail Bay (Central Algerian Coast, South-Western Mediterranean)
Reproduction of round sardinella (Sardinella aurita Valenciennes, 1847)
from Bou-Ismail Bay (Central Algerian coast, south-western
Mediterranean)
A. Bouaziz1, A. Nouar1
Laboratoire d'Océanographie Biologique et Environnement Marin – F.S B - ALGERIE
Email : [email protected]; [email protected]
2
Laboratoire d'Océanographie Biologique et Environnement Marin - F.S B - USTHB - ALGER, ALGERIE
Email : [email protected]; [email protected]
1
SUMMARY
To study the annual reproduction cycle of round sardinella (Sardina aurita Valenciennes, 1847), 3083
individuals (1310 males and 1773 females) were sampled monthly in 1998. All the fishes were taken from the
landings of seiners operating in Bou-Ismail Bay (Central Algerian coast, south-western Mediterranean). The
spawning of S. aurita in Bou-Ismail Bay, as well as in the Mediterranean waters is isochronous and summery.
The various parameters recorded in the different stations sampled in August 1998, allow locating the
spawning on 50 m isobaths areas, which is characterized by a range of surface temperature and salinity
ranges respectively between 26 to 27 °C, and between 36.5 to 36.8 psu. Examination of the percentage of
mature females based on size allows fixing 14.1 cm as the size to which 50% of S. aurita female are able to
reproduce. Regarding males, 13.6 cm is the size at which 50% of the male population has reached maturity.
The population of Sardinella aurita (both sexes) reaches its size at first maturity (L50) at 13.9 cm. The mean
and confidence interval of the individual fecundity (FA) is 25001 ± 2412 eggs. Relative fecundity (FR) of S.
aurita from Bou-Ismail Bay is about 385 ± 21eggs per gram of body weight. Finally, we recommend
prohibiting the exploitation of S. aurita in the Bay of Bou-Ismail during the summer, during which season the
spawning stock biomass of sardinella approached near the coast to spawn.
Key Words : S. aurita, spawning, fecundity, Central Algerian coast
INTRODUCTION
In recent years, scientific debate runs around depletion and collapse of many fish stocks
through many strategic regions of the world’s ocean. The relentless increase of fishing
pressure on fish stocks increasingly limited despite their ability to self-renew is designated
as the main cause of decline in abundance of fishery resources and constitutes the greatest
threat to sustainable development of fishing industry. Following this, we are interested in
the study of the round sardinella (Sardinella aurita Valenciennes, 1847) because it
represents almost all pelagic contributions since 1994. In fact, during 2004, its production
reached 17850 tons, which corresponds to 90% of total landings of small pelagics fishes [1],
[2] from central region of the Algerian coast, included between the mount Chenoua at West
(2 ° 20'E) and Tamenfoust at East (3 ° 10'E).
As it is thus of the relative spawning stock biomass of round sardinella caught in the area?
Given that the evolution of the spawning biomass is an important indicator of stock status, a
decrease in this part of the stock is a sign of over-fishing which penalizes future recruitment
while its elevation is an indicator of preservation of the spawning stock. To answer this
question, the knowledge, among other things, of the age and size which individuals reach
sexual maturity is required, as well as time and place of spawning.
To study the of the gonado-somatic index (GSI) of round sardinella from Bou-Ismail Bay,
located 25 km east of Algiers, 3083 individuals (1310 males and 1773 females) were
sampled monthly from January to December 1998. This index allows knowing the strategy
and the spawning period of the fish. Due to the large amount of fat that accumulates in the
abdominal cavity during certain times of the year, the calculation of GSI index is based on
eviscerated fish. Regarding the size at first sexual maturity (L50), the total length at which
50% of the individuals are mature is the most often used and it is the latter which has been
adopted in this work. To accurately estimate the L50, sampling should be worn only on
individuals maturing and more, caught during the spawning period from June to September.
The size at first maturity was determined for 369 females, 390 males and for 759 both
sexes. The size at first maturity for the whole stock (both sexes) constitutes an essential data
for the evaluation of exploitable biomass of round sardinella. For determining the state of
maturity of gonads, we used the macroscopic scale of maturity obtained for both sexes of
Sardinella aurita of the central region of the Algerian coast obtained by [3] (Tables 1, 2).
To estimate the absolute and relative fecundity, only 35 gonads on the 46 studied were
considered, the others are removed from the inventory because of their immaturity or
because their spawning already begun. This was established after histological examination
of their ovaries. The gonads were preserved in modified Gilson's fluid [4] for two months,
during which the ovaries are regularly stirred to separate the eggs from ovarian tissue.
According to [5], for species with single swarming, individual fecundity is calculated by the
following formula :
Ft : individual fecundity, which corresponds to the total number of oocytes in
maturation contained in the ovary;
nt : average number of oocytes maturing counted in a sample of average weight or
average volume a;
A : total volume of the liquid egg mixture, or total weight of eggs;
Pg : weight of both ovaries;
pg : weight of the left ovary.
Calculating the average relative fecundity per weight unit, Fr, was performed from the [6]’s
formula :
FW : average relative fecundity per weight class;
ni : number of individuals per weight class, and
N : total number of individuals.
The confidence interval was calculated (with a risk α = 5%) from the following formula:
I. C : confidence interval of the mean relative fecundity;
S : standard deviation of the mean relative fecundity; and
N : total number of individuals.
Finally, in order to identify the eggs of Sardinella aurita and the area of spawning in the
Bou-Ismail Bay, 11 stations were sampled from 09 to 10 August 1998, with a sample of
plankton at each using a Bongo net. The choice fell on these stations because sardinellas
fully mature or in spawning activity were caught by purse seiners operating in the area
during the summer.
For the identification of the eggs of Sardinella aurita, the criteria recommended in the table
"EGGS", established by [7], [8], [9], [10] and [11] were selected.
Table 1 : Macroscopic scale of sexual maturity of S. aurita females [3]
Female stages of maturity ♀
Stage I (Immature)
Stage II (early maturing)
Stage III (pre-spawning)
Stage IV (spawning)
Stade V (Post-spawning or sexual
rest)
Observations
Ovaries transparent, small, filamentary with very thin membrane.
Oocytes invisible to naked eye.
Ovaries opaque, vascularized, yellow-orange colored. Oocytes
orange, visible by transparency but distant from each other.
Ovaries opaque, richly vascularized, orange. Oocytes clearly visible
orange.
Ovaries very voluminous, the presence of numerous reddish and
dilated blood vessels. Oocytes easily visible, spontaneous flow,
irregularly disposed, transparent.
Ovaries flaccid, highly vascularized, aspect of empty bag. Oocytes
not visible.
Table 2 : Macroscopic scale of sexual maturity of S. aurita males [3]
Male stages of maturity ♂
Stage I (Immature)
Stage II (maturation)
Stage III (emission)
stage IV (Post-emission)
Observations
Testicles transparent, very small, knife-blade shaped, embedded in
adipose tissue, hard to spot.
Reddish-white testicles, occupy half of the abdominal cavity.
White testicles occupy almost all the abdominal cavity, emission of
sperm simply by pressure on the flanks of the abdominal cavity.
Testicles with aspect of empty bag, sperm exhausted.
Spawning area, spawning period and identification of the sardinella aurita eggs
Monthly curves of the gonadosomatic index average (GSI) for males and females have
similar trends, with minimum values between October and March both for females (0.36 to
0.57) and males (0.1 - 0.29). From June, who marks the beginning of spawning, the GSI
values increase to their maximum in July, to rich 4.63 in females and 6.05 in males. Then,
the GSI starts to decrease slowly and then quickly, until September, marking the beginning
of the end of the laying period. Indeed, the GSI values lowers to 2.28 for females and 3.51
for males (Table 3). The high precision assigned to monthly GSI during the spawning
period, would mean the simultaneous presence of fish in beginning, middle and end of
spawning. To elucidate this observation, monitoring the evolution of monthly GSI in
relation to size during the breeding period is required. In this respect, the class intervals
[L50-19 cm[ and ≥ 19 cm were selected for both sexes, because they highlight significant
variations in GSI values. Indeed, the highest values are observed in July for fish whose size
is equal to or greater than 19 cm for both sexes, with respective values of 10.66 for females
and 6.13 for males. Regarding individuals of smaller sizes, the GSI peaked in August for
both sexes: 5.54 for females and 5.96 for males. Then, regardless of the size of the fish, the
weight index fall in September to its lowest value that ranges between 0.70 and 0.81, and
this, depending on the sex and size (Tables 4, 5).
Table 3 : Monthly variations of GSI means in ♂ and ♀ populations of Sardinella aurita
Females (♀)
Males (♂)
Month
G.S.I.
Total
Number
Accuracy
(α = 5 %)
G.S.I.
Total
Number
Accuracy
(α = 5 %)
January
0,38
146
0,026
0,2
34
0,001
February
0,36
148
0,027
0,2
48
0,031
March
0,49
167
0,021
0,1
101
0,012
April
0,81
128
0,054
0,25
41
0,016
May
0,83
75
0,032
0,51
67
0,057
June
1,17
202
0,062
1,21
171
0,136
July
4,63
169
0,145
6,05
193
0,148
August
3,95
188
0,173
5,72
236
0,156
September
2,28
157
0,169
3,51
125
0,375
October
0,5
143
0,010
0,29
97
0,014
November
0,39
105
0,003
0,18
104
0,00
December
0,57
145
0,007
0,28
93
0,001
Table 4 : Monthly change of female GSI average during the spawning period in S. aurita
Month
G.S.I.
June
July
August
September
3,71
4,54
5,54
0,74
LT ♀ < 19 cm
Total
Accuracy
Number
(α = 5 %)
62
0,694
84
0,572
77
0,437
86
0,124
G.S.I.
4,30
6,13
3,71
0,80
LT ♀ ≥ 19 cm
Total
Accuracy
Number (α = 5 %)
59
0,424
72
0,487
80
0,479
63
0,184
Table 5 : Monthly change of male GSI average during the spawning period in S. aurita
LT ♂ < 19 cm
LT ♂ ≥ 19 cm
Month
G.S.I.
Total
Number
Accuracy
(α = 5 %)
G.S.I.
Total
Number
Accuracy
(α = 5 %)
June
4,47
85
0,632
6,81
42
2,080
July
4,84
98
0,735
10,66
31
2,228
August
5,96
86
0,504
5,15
314
2,160
September
0,81
79
0,153
0,70
53
0,141
Analysis of Table 6 and Figure 1 shows that spawning of S. aurita occurs near the coast,
and preferably in the area III in front of Tipaza. Indeed, on the 7325 eggs numbered, 2978
match those of Sardinella aurita, to be 40.66% (Table 7).
Table 6 : Percentage of round sardinella eggs relative to total eggs collected in the Bou-Ismail
Bay
Sector
III
II
I
Station
Number of total fish
eggs
Number eggs of
S. aurita
% eggs of
S. aurita
01
02
03
04
05
06
Total
07
08
09
Total
10
11
Total
1972
699
620
163
1114
2757
7325
110
00
00
110
68
60
128
992
29
00
00
264
1693
2978
13
00
00
13
23
00
23
50.30
4.15
00
00
23.70
61.41
40.66
11.82
00
00
11.82
33.82
00
17.97
Table 7 : Characteristics of S. aurita’s eggs collected in the Bou-Ismail Bay
Living environment
Egg shape
Aspect of the egg capsule
Egg diamètre (mm) after correction (shrinkage due to
fixation = 6 %)
Color of egg
Oïl drop number
Oïl drop Diameter (mm)
Oil drop color
Oil drop position
Size of the perivitelline and yolk aspect
Pelagic
Spherical
Iridescent
Ø =1.336 ± 0.016 mm
Transparent
N = 01
Ø = 0.128 ± 0.0025 mm
Dull yellow brownish
Lower part of the yolk sac
Very large space with loose
yolk
Figure 1 : Position of stations sampled in the Bou-Ismail Bay
This percentage drops to 17.97% in Sector I, near the Zeralda’s coast. It reached its lowest
value in the order of 11.82% in the region II corresponding to the Fouka marine coast. The
various parameters recorded in the different stations sampled in Bou Ismail Bay in August
1998, allow locating the spawning near the 50 m isobaths, which is characterized by a range
of surface temperature and salinity ranges respectively between 26 to 27 °C, and between
36.5 to 36.8 psu. Our observations closely match those of the main authors who worked on
S. aurita in the Mediterranean Sea. Indeed, spawning occurs in warm waters near the coast.
On the Spanish coast, [12] reported the presence of high concentration of round sardinella’s
eggs in waters with a temperature of 23.5 °C. [13] and [12] found on the Balearic Islands
coasts round sardinella ongoing spawning from July to late September, in high temperatures
and salinities waters (24-25° C, 37-38 psu). [14] reported the presence in late September of
a new and exceptional spawning area of S. aurita off the beach of Sète (France) above
funds of approximately 25 m. Their hydrological conditions were also exceptional for this
region during the period of ichtyoplancton sampling: T = 22°C, S = 37.54 psu at 25 m
depth. Along the Algerian coasts, [15] noted that spawning spread from July to September
with a peak in August. According to [16], the spawning of sardinella from Algeria’s waters
sometimes lasts until October. In Tunisia, [17] collected eggs and larvae of S. aurita in July.
[18] and [19] conclude that S. aurita from Tunisian waters breed between June and
September. [20] states that the spawning of Egyptian round sardinella runs from late May to
September with a peak between July and August. According to [21], S. aurita captured
north of Aegean Sea (Greece) is characterized by a summer spawning when water’s
temperature exceeds 20 °C. According to [22], spawning of round sardinella from Israeli
coasts began in May, when the temperature is above 20 °C. It continues during the summer
months when the temperature reaches 28 ° C, and ends in September although the water
temperature is above 20°C during the months of October to December [23] found on the
coast of Israel eggs and larvae between May and June.
Size at first sexual maturity
Examination of the percentage of mature females based on size allows fixing 14.1 cm as the
size to which 50% of S. aurita female are able to reproduce in Bou-Ismail Bay (Table 8,
Figure 2), while 100% of females are mature beyond 16.5 cm. Regarding males, 13.6 cm is
the size at which 50% of the male population has reached maturity (Figure 3), while beyond
16.5 cm, all male met are adults. Finally, the analysis of Table 9 and Figure 4 shows that
total population of Sardinella aurita (both sexes) reaches its size at first maturity (L50) at
13.9 cm.
Table 8 : Size at first sexual maturity (L50) in ♂ and ♀ populations of Sardinella aurita
C. C.
(cm)
11,5
12,5
13,5
14,5
15,5
16,5
17,5
18,5
Females
Immature
Mature
Total
09
40
34
15
01
00
00
00
00
00
04
32
41
43
70
80
09
40
38
47
42
43
70
80
%
mature
00
00
10,53
68,09
97,62
100
100
100
Moving
average
3,51
26,21
58,75
88,57
99,21
100
Males
Immature
Mature
Total
04
19
27
02
01
00
00
00
00
00
19
63
52
39
75
89
4
19
46
65
53
39
75
89
%
Mature
00
00
41,30
96,92
98,11
100
100
100
Moving
average
13,77
46,07
78,78
98,34
99,37
100
Table 9 : First sexual maturity’s size (L50) of S. aurita from Bou-Ismail Bay (both sexes)
C. C. (cm)
11,5
12,5
13,5
14,5
15,5
16,5
17,5
18,5
Immatur
e
13
59
61
17
02
00
00
00
Matur
e
00
00
23
95
93
82
145
169
Sex combined
Tota
% mature
l
13
00
59
00
84
27,38
112
84,82
95
97,89
82
100
145
100
169
100
Moving
average
9,13
37,4
70,03
94,24
99,30
100
Figure 2 : Size at first sexual maturity (L50) in female population of S. aurita (♀)
Figure 3 : Size at first sexual maturity (L50) in male population of S. aurita (♂)
Figure 4: First sexual maturity’s size (L50) of S. aurita from Bou-Ismail Bay (both sexes)
Our observations differ significantly from those of the main authors who worked on S.
aurita in east Atlantic: on Mauritanian coast, [24] reported an onset of first sexual maturity
in females at 20 cm. In the same area and [25] fixes L50 to 29 cm. [26] reported that the
stock of sardinella from coastal sector of the Western Sahara to Cape Verde reaches
maturity at 25 cm. In the region of Senegal, [26] estimate the L50 for females to 18.5 cm,
90% of females are mature at 21 cm, while all are at 25 cm. For [27], size of first sexual
maturity is 20 cm for fish sampled in Dakar. [28] sets to 19 cm the size for which 50% of
the population of S. aurita of Congo coasts is mature. Finally, [29] mentions that round
sardinella from Ghana reach their L50 to 15 cm.
Contrary to what was observed in Atlantic ocean, our observations are relatively close to
those of researchers who worked on the Mediterranean round sardinella : [30] reported that
the Balearic Islands sardinella reach their L50 between 12 and 13 cm for females and at 14
cm for males. On the Mediterranean coast of Spain, sardinella reached its first sexual
maturity at a greater length, which is about 16.9 cm for males and 19.4 cm for females [12].
[16] found, on the Algerian coast, mature females of 13.5 cm and males able to reproduce
from 12 cm. Data from [15] confirm these observations. [18] found, in Tunisian waters, an
L50 value of 12 cm for males and 13 cm for females. [19], in the same studied area, place it
around 14.3 cm. In the Aegean Sea, [31] concluded that many individuals of sardinella are
mature at 15 cm. In the north-eastern Mediterranean, [21] estimated that Male round
sardinella reach first sexual maturity at a smaller total length than females (15.5 and 16.8
cm respectively). In the eastern middle Adriatic Sea, [32] concluded that Fifty per cent
(L50) of males and females reached sexual maturity at TL 15.8 cm and at 16.6 cm,
respectively. On the Israeli coasts, [22] noted a significant proportion of mature males from
12 cm at the beginning of the spawning season. He also noted that the minimum size of a
mature female was 12.5 cm.
Fecundity
Evaluation of absolute fecundity (AF) of the smallest female, whose size is 14.5 cm, is
about 11680 eggs while that of the largest, measuring 25.5 cm, oscillates around 40348
eggs. The mean and confidence interval of the individual fecundity of sardinella from BouIsmail Bay is 25001 ± 2412 eggs. Following the recommendations of the FAO [33],
according to which fecundity is related to fish length by an allometric equation, twelve
couples of values (TL, AF) were adjusted by the Fishparm software [34] in order to
calculate the parameters of the linear regression. The results obtained offer to describe the
following equation: FA = 27.78 × TL2.232 (Figure 5). Relative fecundity (FR) of S. aurita
from Bou-Ismail Bay is about 385 ± 21 eggs per gram of body weight. Linear regression
established between eviscerated fish weight and relative fecundity (Figure 6), strongly
recommended by the FAO [33], leads to the following linear regression : FR = 262.92 ×
(W)ev+ 7208.94[35]. Our results are close to those obtained in the north-eastern
Mediterranean by [21]. These authors indicate that the Mean absolute fecundity (FA)
increased exponentially with body length (FA = 0.0949 × L4.22) and weight (FA = 511.19 ×
W1.02), with an average of 21000 oocytes produced per spawning female. Relative
fecundity (FR) ranged between 242 and 681 oocytes/g of body weight (average 445
oocytes/g). In the eastern middle Adriatic Sea, [32] concluded that absolute fecundity
ranged from 8458 to 48 032 (mean 34 565 ± 10 310), whereas relative fecundity was from
171 to 722 (mean 385 ± 104.35). This result is almost identical than that obtained in the
present study.
In the Atlantic region, [27] estimate the fecundity of S. aurita in the Dakar region at 370430
eggs per gram of fish. This fertility remains less than that calculated by [28], who
established the following relationship: F = 436.415×W-22,076.437 for sardinella from
Congolese waters.
It is difficult to compare the fecundity between Mediterranean and Atlantic populations of
round sardinella because the size at first sexual maturity in the tropical waters off Senegal
and Congo, respectively 20 cm [27] and 19 cm [28] remains much higher than that of the
Mediterranean round sardinella.
Figure 5 : Evolution of absolute fecundity (FA) versus total length (TL) in S. aurita
Figure 6 : Variation of relative fecundity (FR) versus eviscerated weight of S. aurita from Bou-Ismail
Bay
CONCLUSION
In conclusion, the spawning of S. aurita in central region of Algerian coasts, as well as in
the Mediterranean waters is isochronous and summery, contrarily that of the round
sardinella of the Atlantic ocean, according to [36], is heterochronic and occurs in two
periods: one during the water warming in late winter, the other during warm season in
desalted waters. This comparative study allows us to conclude that the Mediterranean round
sardinella reaches their first sexual maturity’s size before those of the African Atlantic
waters. This is due, no doubt, by the fact that the lengths at the different ages of the Atlantic
round sardinella are much higher than those of S. aurita from the Mediterranean Sea.
Finally, we recommend prohibiting fishing in the Bay of Bou-Ismail during the summer,
season during which the spawning stock biomass of round sardinella approached near the
coast to spawn.
REFERENCES
[1]. Bouaziz, A : Diagnostic des stocks exploités des côtes algériennes (Diagnosis of exploited stocks of the
Algerian coast). In: the Precautionary approach to local fisheries and species introductions in the
Mediterranean Sea. CIESM Workshop Series, n°7. Kerkenna Island (Tunisia), September 1999, 96
pp., 126 refs. 1999.
[2]. Bouaziz, A : Estimation du point de référence biologique, F0.1, de Sardinella aurita de la région centre de
la côte algérienne (Estimation of biological reference point, F0.1, of Sardinella aurita in the central
region of the Algerian coast). Bull. Soc. Zool. France, 131 (2): 97-106. 2006.
[3]. Bouaziz, A : La sardinelle (Sardinella aurita Valenciennes, 1847) des côtes algériennes: distribution,
biologie et estimation des biomasses (Sardinella (Sardinella aurita Valenciennes, 1847) of the
Algerian coast: distribution, biology and biomass estimation). Thesis, University of USTHB
(Algiers), 135 pp. 2007.
[4]. Simpson, A. C: The fecundity of the plaice. Fish. Invest. Lond., 17 (5): 3-27. 1951.
[5]. Kartas, F – Quignard, J. P : La fécondité des poissons Téléostéens (The fertility of fishes Teleostei).
Masson éd. Collection de biologie des milieux marins, 5: 1-121. 1984.
[6]. Stequert, B. – Ramcharrum, B : La fécondité du listao (The fecundity of skipjack). (Katsuwonus pelamis).
Aquat. Living Resour., 8 (1): 79-89. 1995.
[7]. Furnestin, J : Biologie des Clupéidés méditerranéens (Biology of Mediterranean Clupeidae). Vie et milieu,
4 (1): 37-56. 1952.
[8]. Marinaro, J-Y : Contribution à l’étude des œufs et larves pélagiques de poissons méditerranéens
(Contribution to the study of eggs and pelagic larvas of Mediterranean fishes). Pelagos 3(1): 1-118.
1971.
[9]. Russel, F. S : The eggs and planktonic stages of British marine fishes. Academic Press, London, 524 pp.
1976.
[10]. Fahay, M : Guide to the stages of marine fishes occurring in the Western North Atlantic, Cape Hatteras
to the Southern Scotian shelf. J. North west Atlantic Fish. Sci., 4: 1-423. 1983.
[11]. Moser, H. G - Richards, W. J - Cohen, D. M - Fahay, M. P – Kendall, A. W - Richardson, S. L :
Ontogeny and systematics of fishes. Am. Soc. Ichthyol. Herpetol. Spec. Publ., 1: 1-760. 1984.
[12]. Andreu, B - Rodriguez-Roda, J : Considération sur la proportion des sexes dans les pêches de poissons
pélagiques dans la Méditerranée et leur signification statistique (Consideration of the sex ratio in
pelagic fisheries in the Mediterranean and their statistical significance). Vie et Milieu. Suppl., 2: 271281. 1959.
[13]. Navarro, F. P : Estudio sorbre clupeidos de Baleares (Study of the Clupeids of the Balearic Islands).
Notas Resum. Inst. Esp. Oceanogr., 21: 1-33. 1927.
[14]. Maurin, C – LEE, J. P : Note sur la présence de Sardinella aurita C. V. dans le golfe du Lion (Note on
the presence of Sardinella aurita C. V. in the Gulf of Lion). In the Sci. Mond. Biol. Sardine Rapp.,6:
p. 24. 1960.
[15]. Dieuzeide, R – Roland, J : Etude biométrique de Sardina pilchardus Walb. et de Sardinella aurita C.V.,
capturées dans la baie de Castiglione (Study biometric of Sardina pilchardus Walb. and Sardinella
aurita CV, captured in the Bay of Castiglione). Bull. Sta. Aquac. Pêches Castiglione, 8: 111-216.
1957.
[16]. Bounhiol, J. P : Sur la biologie de l’allache (Sardinella aurita Val.) des côtes d’Algérie (On the biology
of the sardinella of the Coast of Algeria). Rapport présente au congrès de Strasbourg de l'Association
Française pour l'Avancement des Sciences 4p. 1921.
[17]. Heldt, J. H : La sardinelle ou allache dans les mers tunisiennes (Sardinella in the Tunisian seas). Ann.
Biol., Copenhague, 1-6. 1950.
[18]. KARTAS, F : Les Clupéidés de Tunisie. Caractéristiques biométriques et biologiques. Etude comparée
des populations de l'Atlantique et de la Méditerranée (Clupeidae of Tunisia. Biometric and biological
characteristics. Study compared by the populations of the Atlantic Ocean and of the Mediterranean
Sea). Thesis, University of Tunis, 608 pp. 1981.
[19]. Gaamour, A - Ben Abdallah, L - Khemiri, S - Mili, S : Etudes de la biologie et de l’exploitation des
petits pélagiques en Tunisie (Studies of the biology and the exploitation of the small pelagic in
Tunisia). MedSudMed Technical Documents, 5: 48-56. 2004.
[20]. Bebars, M.I : Exploitation rationnelle des pêcheries égyptiennes : Application aux pêcheries des
sardinelles (Sardinella aurita Valenciennes, 1847) de la baie de Selloum, Egypte (Rational
exploitation of fisheries Egyptian: Application to fisheries sardinella (Sardinella aurita Valenciennes,
1847) in Selloum Bay, Egypt). Thesis, University of Montpellier, 326 pp. 1981.
[21]. Tsikliras, A. C – Antonopoulou, E : Reproductive biology of round sardinella (Sardinella aurita) in the
north-eastern Mediterranean. Scientia Mar., 70 (2): 281-290. 2006.
[22]. Ben-Tuvia, A : The biology of Sardinella aurita with a systematic account of the family Clupeidae of the
Mediterranean coast of Israel. Fish. Bull., Haifa, 7: 20-24; 8: 14-15, 20-25. 1956.
[23]. Komarovsky, B : A study of the food of Sardinella aurita off the Mediterranean coast of Israel during
the peak season (May-June, 1958). Tech. Pap. Gen. Fish. Coun. Medit., (42): 1-9. 1958.
[24]. Chavance, P - Chabane, F - Hemida, F- Korichi, H.S - Sanchez, M.P - Bouchereau, J. L – Tomasini, G.A
– Djabali, F : Evaluation du rendement par recrue relatif à partir de fréquences de tailles : application
à quelques stocks d’anchois, de sardinelles et de chinchards de la Méditerranée occidentale
(estimation of relative yield per recruit from size frequency: application to some stocks of anchovy,
sardine and horse mackerel in the western Mediterranean). FAO Rapp. Pêches, (347): 186-220. 1991.
[25]. Wague, A. - M’Bodj, O. B - Etude de quelques aspects de la reproduction chez la sardinelle ronde
Sardinella aurita (Valenciennes, 1847) pêchée le long des côtes mauritaniennes (Study of some
aspects of the reproduction of round sardinella Sardinella aurita (Valenciennes, 18470) along the
Mauritanian coastline). Bul. Scient. Inst. Maurit. Rech. Océanog. Pêches, 29: 13-18. 2002.
[26]. Boely, T : Étude du cycle sexuel de la sardinelle (Sardinella aurita Val. 1847) au Sénégal (Study of the
sexual cycle of sardinella (Sardinella aurita Val. 1847) in Senegal). Océanogr. trop. 17 (1): 3-13.
1982.
[27]. Conand, C : Contribution à l’étude du cycle sexuel et de la fécondité de la sardinelle ronde, Sardinella
aurita : Pêche sardinière dakaroise en 1975 et premier semestre 1976 (Contribution to the study of
the sexual cycle and fecundity of round sardinella: Sardine fishing, Dakar in 1975 and the first half of
1976). Cah. ORSTOM, Ser. Océanogr., 4: 301 – 312. 1977.
[28]. Fontana, A – Pianet, R : Biologie des sardinelles Sardinella eba (Val.) et aurita (Val.) des côtes du
Congo et du Gabon (biology of Sardinella eba and sardinella aurita from the coast of Congo and
Gabon). Doc. Scient. Centre Pointe-Noire, O.R.S.T.O.M. (nouv. Sér.), 31: 1-38. 1973.
[29]. O.R.S.T.O.M : Rapport du groupe de travail sur la sardinelle (S. aurita) des eaux ivoiro-ghanéennes
(Report of the workgroup on the sardinella (S. aurita) ivoiro-Ghanaian waters). Rapp. Réun. Cons.
int. Explor. Mer, 180: 350-355. 1976.
[30]. Oliver, M – Navarro, F. P : La alacha y la sardine de Baleares (The sardinella and the sardine of the
Balearic Islands). Investigaciones en 1950 y 1951. Bol. Inst. Esp. Oceanogr., 58: 1-49. 1952.
[31]. Ananiades, C.I : Quelques considérations biométriques sur l'allache (Sardinella aurita C.V.) (Some
considerations on the biometric sardinella). Prakt. Hell. Hydrobiol. Inst., 5 (1): 1-45. 1952.
[32]. Mustac´, B - Sinovcic´, G : Reproductive cycle of gilt sardine, Sardinella aurita, Valenciennes 1847, in
the eastern middle Adriatic Sea. J. Appl. Ichthyol., 28: 46–50. 2012.
[33]. Holden, M. J – Raitt, D. F. S : Manuel des sciences halieutiques. 2ème partie. Méthodes de recherches sur
les ressources et leur application (Manuel of the halieutic sciences. 2nd part. Methods of researches
on the resources and their application). FAO Doc. Tech. Pêches, (115) Rev., 1: 1-223. 1974.
[34]. Sailla, S. B – Recksiek, C. R. – Prager, H : Basic fishery science programs. Elsevier, Dev. Aquacult.
Fish. Sci., 18: 1-231. 1988.
[35]. Gayanilo, F.C – Pauly, D – Sparre, P : FISAT User’s Guide. FISAT II. En ligne :
http//www.fao.org/fi/statist/fisoft/fisat/downloads [cited 04 avril 2005]. 2005.
[36]. Boely, T - Chabanne, J – Freon, P – Stequert, B : Cycle sexuel et migrations de Sardinella aurita sur le
plateau ouest africain, des Iles Bissagos à la Mauritanie (Sexual cycle and migration of Sardinella
aurita on the shelf west African, From the Bijagos Islands at Mauritania). Rapp. P.-V. Réun. Cons.
int. Explor. Mer, 180: 350-355. 1978.
Status of Artisanal Fisheries of the Libyan Coast
Status of artisanal fisheries of the Libyan coast
Shakman E.1*; Etyab K.1; Taboni I.1, Et-wail M.2; Ben Abdallah A1
1
Zoology department, Tripoli University.
2
Al – Zawia University
*
Corresponding Author: [email protected]
SUMMARY
This study was carried out along the Libyan coast during the period from 1st February to the end of March
2013. 131 landing sites have been visited in order to investigate their status and fishing activities. The study
found that more than 91% of the landing sites were permanent and around 8% seasonal. The type of landing
sites were mostly harbors (42.86%), 31.75% protected bays and 25.4% are open beach. However, seven types
of fishing boats were observed; flouka was the largest percentage (70.06%), then 18.14% for mator, 3.28%
forlampara, 0.41% for Tarrad, Gayag(0.16%),5.97 for Daghesa and 1.98% for batah. Moreover, the
majority of them were concentrated in the western region of the country. The most common used fishing gears
are the trammel nets about 80%, which are used by flouka, mator, Tarrad and batah. The using of trammel
nets rely on the fishing season, fishes size and the targeted species. The other fishing gears are also used but
occasionally.
Keywords: Fleet, Fishing gears, libya
INTRODUCTION
Several surveys have been done along the Libyan coast. The first trawl fishing survey of the
western part of the Libyan coast was achieved by the Tunisian research vessel DAUPHIN
from April 17 to May 19, 1965 (Zupanovic and El-Buni 1982). The next fishing survey was
carried out by the French research vessel THALASSA, in November 1969 (Maurin 1973,
Aldebert and Pichot 1973, Bonnet 1973). In 1972 the survey of the Libyan territorial waters
and the adjacent international waters in the central Mediterranean was carried out by
Japanese fishing vessel HOYO-MARU (Gorgy et al. 1972). During the period from
September 1973 to October 1974 a survey was done by a French firm of consulting
engineers (SOGREAH) using the research vessel and facilities provided by the Libyan Marine
Biology Research Center (MBRC). In this survey a study of the living resources on the
Libyan continental shelf of the Tripolitanian coast west of 15 ° E was performed (Sogreah
1977). From January to May 1975 an exploratory fishing survey was done by German
fishing vessel MEIKE in the Gulf of Sirt (Instrupa 1975). From May 1975 through August
1976, extensive studies of oceanography and fisheries were carried out by both Libyan and
Romanian research teams on board of the vessels DELTA DUNARII and GILORT in the
eastern territorial waters (between Ras Azzaz and Ras Karkura) (Contransimex 1977). In
1993 a survey along the Libyan coast was done on the fisheries and oceanography by FAO
and Marine Biology Research Center (MBRC) (Lamboeuf and Reynolds 1994). In 2000 an
artisanal fishery in Libya census of fishing vessels and inventory of artisanal fishery métiers
was carried out along the Libyan coast by FAO and facilities provided by Marine Biology
Research Center (MBRC) (Lamboeuf 2000). Some 28.5 million people are directly
employed by the marine fishing sector (both industrial and artisanal) across the globe, 95%
of them in Asia, Africa and Latin America (Dubois & Zografos, 2012). The objectives of
this study to evaluate the artisanal fishery along the Libyan coast
This survey was carried out from February 2013 to the end of March 2013; it was
performed along the Libyan coast in an area extending from Farwah in the western part of
Libya up to the Al Bardiyah Gulf on the Libyan border with Egypt (Fig. 1). The aim of this
survey was to find out the number of boats, the type of boat and fishing gear used in the
coastal area. A total of 131 landing sites were visited; the latitude and longitude of the
region, the number of boats, and the types of fishing gear were recorded for each site.
Important information about fishing vessels and fishing gear was collected from local
fishermen and fishermen’s unions.
Figure 3: Map of Libya, sampling sites
RESULTS
In the Libyan coast, most of the landing sites are permanents (Fig. 2). The number of boats
found during this study was 3687; 70.06% of them were Fluka, 18.14% for Mator, 3.28%
for Lampara, 0.41% were Tarrad, 0.16% were Gayag, 5.97% Daghesa and 1.98% for Batah
(Fig. 3). However, the majority of them were concentrated in the western part of Libya
(Table 1).
Table 1. Number and percentage of fishing vessels along the Libyan coast
Region
Number
Percentage
East region
705
19.12%
Sadra gulf
582
15.79%
West region
2400
65.09%
Total
3687
100
8.62
Permanent
Seasonal
91.38
Percentage
Figure 2: Percentage of the landing sites
80
70
60
50
40
30
20
10
0
70.06
18.14
5.97
1.98 0.41 3.28 0.16
Fishing vessels
Figure 3: Fishing vessels used in the coastal area along the coast of Libya in 2013
Artisanal units %
In the coastal area the most used fishing vessel was fluka. Moreover, Lampara used to catch
small pelagic fish, were concentrated in the western part and with a few numbers in the
Gulf of Sirt, especially in Musrata. On the other hand, Batah was concentrated in the
western region (Farwah site) and only a small number of was found in the eastern region
(Attimimi and Ainghazala) where the shallow water areas (Fig. 4).
70
60
50
40
30
20
10
0
West region
Sadra gulf
Regions
East region
Figure 4: Distribution of Fishing vessels along the Libyan coast
Percentage
The most important fishing gear used in the coastal area was Trammel nets (Haliq). They
are used by Flouka in water level of one meter to fifty meters depth, and are operated by
mator in water of more than thirty meters depth. Furthermore, Trammel are used by batah in
depths up to 5 meters (Fig. 5).
90
80
70
60
50
40
30
20
10
0
Nets
Figure 5. Percentage of fishing gears (Nets) along the Libyan coast
DISCUSSION
Artisanal fishing activities are very different depending on the environmental, social,
economic and historical contexts in which fishers live, Artisanal fisheries provide critical
income and edible protein to hundreds of millions and contribute to poverty alleviation and
sustainable development in many coastal areas of the world In this study, a total of 3,687
boats were being used in the coastal area of Libya. The percentages of different fishing craft
were: 70.06% Fluka, 18.14% Mator, 3.28% Lampara, 0.41% Tarrad, 0.16% Gayag, 5.97%
Daghesa and 1.98% Batah (Fig. 3). Most of them were concentrated in the western part of
Libya (65.09%) (Table 1). The lampara was found predominantly in the western part, with a
few exceptions in the Gulf of Sirt. The lampara is used to catch small pelagic fish species
(Sardine, Mackerel etc.). The flouka and the mator were found right along the Libyan coast,
while the batah, which is used in shallow water, was found in the Farwah Lagoon, with a
few boats of this type in the Attimimi and Ainghazala regions. The flouka was used in
regions where the water was between one and fifty meters deep, while the mator was used
for depths of more than thirty meters; the batah was used in depths of up to 5 meters.
In 2000 the country’s entire fishing fleet numbered 1,866 boats; of these 1,266 boats were
operated along the Libyan coast. Around 55% of the total number of boats was found in the
western region, while 23% and 22% were found in the Gulf of Sirt region and in the eastern
part of Libya respectively. The results of this study are almost identical in the percentage
but with different in the total number of the boats to the framework survey of 135 landing
sites in 2000, in which 61% of the fleet were flouka, 28% were major, 7% were lampara
used to catch small pelagic fish, while the batah represented only a small fraction of the
total number of boats (4%) (Lamboeuf 2000). There is increase in the fleet because the
country has invested in the marine sector particularly in the privet sector. in 2007 only 76
active landing sites were investigated and only operational craft were counted. Therefore
the results were different (Shakman & Kinzelbach, 2007). to conclude, the main fishing
vessel used in the coastal area was the flouka, and most of them concentrated in western
part of Libya, the most commonly used fishing gear in the coastal area were trammel nets.
ACKNOWLEDGEMENTS
We would like to thank the Libyan Authority for Research, Science and Technology for
funding this project, and also we thank the fishermen and fishermen’s union in Libya for
their collaboration
REFERENCES
Aldebert Y., Pichot P. 1973. Observations sur les Heterosomes de Méditerranée oriental/ secteur Tunisolibyen/ CIESM. Journées Ichtyologie 57-60, Rome.
Bonnet M. 1973. Les céphalopodes capturés par la (Thalassa) en Novembre 1969 au large de la Libye et de la
côte orientale Tunisienne. Revue Trav. Inst. Pèche Marit. Nantes 37 (2): 253-256.
Contransimex C. 1977. Final report concerning the results of the fisheries oceanographic survey, carried out
by the Romanian researcher teams on board “Delta Dunarii” and “Gilort” in the eastern territorial
waters of the Libyan Arab Republic between Ras Azzaz and Ras Karkura II: 173-563.
Gorgy S. A., Mugahid A., ALI R. 1972. Survey of the Libyan territorial waters and the adjacent international
waters in the central Mediterranean. Communication présentée au 23 congrès Assemblée Plénière
CIESMM, Athènes 3-11 (4) 72 J.
Instrupa 1975. Final report on results of the test fishing program gulf of Sirt, Libyan Arab Republic: pp. 190.
Lamboeuf M. 2000. Artisanal fisheries in Libya, census of fishing vessels and inventory of artisanal fishery
metiers. FAO-COPEMED-MBRC pp 42.
Lamboeuf M., Reynolds J. E. 1994. The fishing fleet of Libya: preliminary results of the 1993 frame survey.
TBN No. 16
Maurin C. 1973. Quelques aspects de la faune ichthyologique Méditerranéenne. Journées ichthyol. 27-38.
CIESM (1970). Rome.
Shakman E. A., Kinzelbach R. 2007. Commercial fishery and fish species composition in coastal waters of
Libya. Rostocker Meereskundliche Beiträge 18: 65-80.
Sogreah E. 1977. Trawl fishing ground survey off the Tripolitania coast. Final Report. Part V: 1-44, and final
report: Introduction and General Conclusions: 1-30.
Zupanovic S., EL-Buni A. A. 1982. A contribution to demersal fish studies off the Libyan coast. Bulletin of the
Marine Research Centre, Tripoli, Libya 3: 78-122.
Community Structure of Bloomer Phytoplanktons around the Shrimp Culture Sites
in Bushehr Province Coastal in Persian Gulf
Community Structure of Bloomer Phytoplanktons around the Shrimp
Culture Sites in Bushehr Province Coastal, in Persian Gulf
Khosrow Aein jamshid1; Fatemeh Mohsenizadeh2; Soheila Omidi3 ; Feridoon Owfi4
1
[email protected], 1,2,3National Shrimp Research Institute of Iran
4
Iranian Fisheries Research Organization
SUMMARY
The present work has been performed to aware about the red tide condition before entering the bloomer
phytoplanktons in water intake canals of the shrimp culture sites in Bushehr province coastal, in Iranian part
of Persian Gulf. Field investigation and sampling have been carried out in the southern of the intake canals of
shrimp culture sites. Phytoplanktons density, physico-chemical parameters such as pH, salinity and water
temperature and nutrients were studied in this work. The relationship between water temperature and salinity
with phytoplankton density at different stations were strong negative. Correlation between Dinophyceae with
nutrients was in reverse trend which observed between Bacillariophyceae with nutrients. By decreasing the
concentration of SiO4-4, the density of Bacillariophyceae decreased and Dinophyceae were dominated in the
area. The structure of phytoplankton community has changed in Bushehr province waters. The abundance of
bloomer Dinophyceae increased from 7.5% in 1976 to 29.3% in 2011, whereas the Bacillariophyceae are
decreased from 73.1% in 1976 to 61.7% in 2011. The highest density of Prorocentrum sp. Was in October and
November which the average of water temperature at that time was closer to its optimum temperature range.
The results of this study indicate that due to high density of toxin producer phytoplankton genus such as
Alexandrium, Prorocentrum and Psudonitzschia, in the vicinity of surveyed shrimp farm complexes, especially
in August which is coincided with the shrimp culture season in Bushehr province and also for high biomass
bloomer genus such as Thalassiothrix and Chaetoceros in Delvar shrimp farm in August, there is the risk of
bloom outbreaks in Bushehr province shrimp farm complexes.
Keywords – Phytoplankton, Bloomer, Shrimp culture, Bushehr, Persian Gulf.
INTRODUCTION
Coastal ecosystems have impacted by environmental problems such as sea grasses losing,
coral reef degradation, and loss of water quality due to urban and industrial effluents. These
conditions face the marine and coastal zone with algal blooms phenomena. In recent years,
the algal blooms causes many risks to human health and also brings negative effects on
living resources and marine reserves, damage to marine ecosystems, and the deleterious
effects on ecotourism [1]. About 4000 species of phytoplankton identified in the world, but
only 80 species, most belong to the class of Dinophyceae are toxic and about 200 species
are high biomass bloomer [2]. The bloom of dinoflagellates and other phytoplankton
groups such as diatoms, cyanobacteria and chlorophytes had serious harm to shrimp
industry, in recent decades [3-6]. Coastal waters are used for supplying shrimp farm
complexes. One of the most important factors which affected the production of farmed
shrimp is phytoplankton quality and maintaining of plankton bloom [7]. By the addition of
fertilizers the nutrient budget of shrimp ponds will increase and it enhance the
phytoplankton growth. The bloom of certain species of phytoplankton, especially if a
dinoflagellate bloomed, can seriously harm farmed shrimps [3].
Occurrence of the extensive bloom of Cochlodinium polykrikoides in the Persian Gulf in
2008 and 2009 had considerable damage to the marine ecosystem [8]. It led the National
Shrimp Research Institute of Iran (NSRII) to concerns about the serious impact of this
phenomenon on aquaculture activities and its social consequences. The present study was
aimed to investigate on phytoplankton communities and their relationship with
environmental parameters and nutrients in the southern of shrimp farm and hatchery
complexes in Bushehr province to aware about the presence of algal bloom species before
entering in water intake of the hatcheries and farmed shrimp complexes in Bushehr
province and to inform the shrimp farmer about the red tide condition. Timely information
about the structure of phytoplankton communities in the vicinity of the water intake canals
of shrimp complexes, allow us to control and management the harmful algal blooms.
EXPERIMENTAL
By concern to the distribution of shrimp farms and hatcheries complexes along the coastal
of Bushehr province, three stations were selected in the southern of water intake canal of
Mond, Delvar and Heleh shrimp complexes (Fig. 1). Monthly sampling has been carried out
from April 2011 to November 2011. Identification and density of phytoplankton specially
the bloomer species, the physic-chemical situation and their relationship with
phytoplankton density and distribution, in the vicinity of shrimp complexes were the goals
of this work.
Figure 1: The studied area in Bushehr province, Persian Gulf
According to the objectives of the project, water samples were gathered monthly.
Phytoplankton and zooplankton samples were identified using inverted microscope of
Nikon, Model Eclipse Tis and a Nikon stereo microscope. Plankton sampling and
laboratory methods have been done based on the references of [9-13]. Water samples for
measurement of chlorophyll-a and nutrients were sampled by Ruttner bottle of Hydro-Bios
Model. The nutrients were analyzed by using HACH spectrophotometer Model DR 4000.
Water temperature and pH were recorded by the pH meter model WTW and salinity was
recorded with an Atago S/Mill refractometer. All measurements were performed with three
replicates. Sampling and analysis of nutrients and chlorophyll-a were performed according
to Methods of MOOPAM, 2010 and Clesceri, 1989 [13 and 14]. Recording and data
processing and statistical analysis have been done by using EXCEL 2007 software.
RESULTS
The average of water temperature was 28.3 °C in the studied station. The minimum of water
temperature was 19.0 °C in April and its maximum value reached to 34.2 °C in July at
Delvar station. The average of salinity was 41.2 ppt. The highest of salinity value was 45.2
ppt in July at Delvar station and its minimum value was 38.2 ppt in July at Mond station.
Summary results of nutrient include of silicate (SiO 4-4), nitrate (NO3-), nitrite (NO2-), orthophosphate (PO4-3), ammonia (NH3) and chlorophyll-a are collected in Table 1.
Table 1: Concentration of nutrients and chlorophyll-a in different station, Bushehr province
waters, 2011
SiO4-4
PO4-3
Chlorophyll-a
NO3NO2NH3
Mond
0.83 ± 0.07
0.20 ± 0.02
2.22 ± 0.18
0.04 ± 0.00
0.006 ± 0.000
0.83 ± 0.07
Delvar
1.04 ± 0.08
0.10 ± 0.01
2.31 ± 0.36
0.04 ± 0.00
0.011 ± 0.001
1.04 ± 0.08
Heleh
0.94 ± 0.09
0.16 ± 0.02
1.46 ± 0.11
0.03 ± 0.01
0.010 ± 0.001
0.94 ± 0.09
Average
0.94 ± 0.04
0.15 ± 0.01
1.99 ± 0.14
0.03 ± 0.01
0.009 ± 0.000
0.94 ± 0.04
The identified phytoplankton were belong to three class of Bacillariophyceae (52.6%,
13,280 ± 7,226 cell/lit), Dinophyceae (37.7%, 6,302 ± 8,268 cell/lit) and Cyanophyceae
(9.7%, 1,955 ± 806 cell/lit) (Figure 2). The maximum density of total phytoplankton was
23,632 cell/lit and their temporal maximum density was 54,623 ± 22,569 cell/lit in August.
The highest spatial density of phytoplanktons was 141,120 cell/lit at Delvar station in
December (Figures 2-4).
Figure 2: Density and percentage of different classes of identified phytoplanktons, Bushehr province,
2011
Figure 3: Density of phytoplanktons in different months, Bushehr province, 2011
25,000
23,632
20,028
20,000
15,844
cell/lit
15,000
10,000
5,000
0
Mond
Delvar
Heleh
Station
Figure 4: Density of phytoplanktons in the studied stations, Bushehr province, 2011
Based on the reference list of IOC [15], Zingone [16] and Maso [1] the most abundant toxin
producer and high biomass bloomer phytoplankton genus in the studied area were
Alexandrium , Prorocentrum , Dinophysis , Ceratium , Gymnodinium which are belong to
Dinophyceae class; Chaetoceros, Skeletonema, Thalassiothrix, Thalassionema,
Psudonitzschia and Nitzschia which are belong to Bacillariophyceae class; and Oscillatoria
which is belong to Cyanophyceae class. Alexandrium and Gymnodinium are producers of
PSP toxin, while the Prorocentrum and Dinophysis are DSP toxin producer. Psudonitzschia
and Nitzschia are producer of ASP toxin. Thalassiothrix, Thalassionema, Chaetoceros,
Skeletonema, Ceratium and Oscillatoria are belongs to high biomass bloomer
phytoplanktons.
Alexandrium, Chaetoceros and Thalassiothrix were the most abundant microalgae bloomer
in the studied area with average density of 22,323, 7,018 and 5,713 cell/lit respectively (Fig.
5). The average values of temporal density of Alexandrium and Prorocentrum are 44,230
and 2,063 cell/lit respectively (Table 2). The maximum density of Alexandrium was
124,500 cell/lit at Mond station in August, and for Prorocentrum was 6,300 cell/lit in
November also at Mond station. The maximum density of Thalassiothrix was 138,240
cell/lit at Delvar station in depth layer in August, and for Chaetoceros was 33,220 cell/lit in
September at Heleh station. Oscillatoria is the only identified high biomass bloomer
phytoplanktons of Cyanophyceae class which its maximum of spatial density was 3,030
cell/lit at Heleh station (Table 2).
Table 2. Average of temporal density of bloomer phytoplanktons Bushehr province, 2011
Genus
Chaetoceros
Nitzschia
Psudonitzschia
Skeletonema
Thalassionema
Thalassiothrix
Alexandrium
Ceratium
Dinophysis
Gymnodinium
Prorocentrum
Oscillatoria
25،000
Mond
4,055
1,421
1,062
Delvar
9,652
1,500
1,198
Heleh
8,170
706
2,340
1,800
390
2,858
44,230
679
180
6,346
300
243
10,155
475
558
2,063
1,872
750
940
215
610
3,030
22،323
cell/lit
20،000
15،000
10،000
7،018
5،000
5،713
2،318 1،800 1،406 1،109
1،089 514 390
215 180
Al
e
xa
n
Ch driu
m
ae
Th toce
r
al
as os
sio
t
Os hrix
ci
ll
Sk ator
ia
el
Ps eton
ud
on ema
itz
sc
h
Ni ia
tzs
Pr
or chia
oc
en
tru
Ce m
Th
ra
t
al
as ium
sio
Gy ne
m
m
no a
di
Di niu
m
no
ph
ys
is
0
Fiure 5: Density of bloomer phytoplanktons in different months, Bushehr province, 2011
-3
Chlorophyll-a (mg.m )
3
2.5
2
Y = 0.0001X + 0.0053
R2 = 0.7023
1.5
1
0.5
0
15000
17000
19000
21000
23000
25000
Phytoplankton density (cell/lit)
Figure 6: Regression of chlorophyll-a vs. phytoplankton density in the studied stations, Bushehr
province, 2011
1.1
Silicate conc. (ppm)
1.05
1
0.95
0.9
0.85
Y = 2E-05X + 0.6543
R2 = 0.9158
0.8
0.75
0.7
0.65
0.6
8000
10000
12000
14000
16000
18000
20000
Bacillariophyceae density
Fig. 7. Regression of silicate vs. Bacillariophyceae density in the studied stations, Bushehr province,
2011
Phosphate conc. (ppm)
0.25
Y = -1E-05X + 0.2931
R2 = 0.9771
0.2
0.15
0.1
0.05
0
8000
10000
12000
14000
16000
18000
20000
Bacillariophyceae density
Figure 8: Regression of phosphate vs. Bacillariophyceae density in the studied stations, Bushehr
Province, 2011
The identified Zooplankton in were belonged to 8 branches and 19 groups (Fig. 9). The
highest density of zooplankton was recorded in Helleh station by 1194 n/lit. Nauplii were
the dominant zooplankton groups with an average density of 136.4 n/lit, Tintinnids 98.7,
Cyclopoida 60.8, Calanoida 35.7 and Harpacticoids 14.5 n/lit.
140
35.0%
123 (32.8 %)
109 (29.2 %)
120
n//lit
100
30.0%
25.0%
90 (23.9 %)
80
20.0%
60
15.0%
40
20
0
10.0%
18 (4.8 %)
1.1%
1.0%
5.0%
0.9%
0.8%
0.5%
0.2%
0.0%
a
a
da
p)
oa
ata rmat a
sca ti fer a
li da
at h
Co pepod rot oz
at o
ord
o
e
nne etogn
ol lu
n
m
h
d
R
e
o
A
o
o
P
M
C
N
C
a
(n
in
Ch
da
Ech
opo
r
h
t
Ar
Figure 9: Density and percentage of different branches of identified zooplanktons, Bushehr province,
2011
Total zooplankton (n/lit).
600
500
400
300
200
Y = -0.0336x + 1021.8
R2 = 0.9881
100
0
15000
17000
19000
21000
23000
25000
Total phytoplankton (cell/lit)
Fig. 10. Regression of total zooplanktons vs. total phytoplanktons density in the studied stations,
Bushehr province, 2011
DISCUSSION
The correlation coefficient of water temperature with density of Bacillariophyceae,
Dinophyceae and Cyanophyceae were 0.99, -0.95 and -0.49, respectively. Strong positive
correlation between Bacillariophyceae and water temperature implying that in surveyed
area, when the water temperature increases, the density of Bacillariophyceae increases. The
results revealed that the Bacillariophyceae are thermo-tolerant algae while Dinophyceae
and Cyanophyceae are thermo-intolerant algae. This results are consistent with the findings
of Izadpanahi, 2005 [17]. The highest density of Prorocentrum is in October and November
which the average of water temperature at that time was closer to its optimum temperature
range. Except for the sudden increase of Alexandrium density at Mond station in 2011
August, its highest overall density was October and November, which the water
temperature was in its optimum range. Our results are consistent with the findings of Sadaf
Gul [18] and Anderson [19]. The correlation coefficient between salinity and phytoplankton
density at different stations was -0.99. High negative correlation between these data shows
that in the surveyed area, by increasing the salinity, the density of phytoplankton decreases.
The correlation coefficient of salinity with density of Bacillariophyceae, Dinophyceae and
Cyanophyceae were 0.95, -0.88 and -0.64, respectively. The results revealed that the
Bacillariophyceae are halotolerant algae while Dinophyceae and Cyanophyceae are
halointolerant algae. These results are consistent with the findings of Izadpanahi, 2005 [17].
The Linear regression analysis of the density of phytoplankton with concentration
chlorophyll-a showed a strong positive relationship between these parameters and
phytoplankton (Fig. 6). Correlations coefficient between chlorophyll-a and phytoplankton
density was 0.84.
In the studied area, the main cause of nutrient variation is outflow of nutrient rich effluent
from the shrimp complexes. The average concentration of silicate at Mond, Delavar and
Heleh stations were 0.83, 1.04 and 0.94 ppm, respectively (Table 1). The correlation
coefficient of Bacillariophyceae, Dinophyceae and Cyanophyceae with silicate were 0.99, 0.94 and-0.51, respectively. The Linear regression analysis of the density of
Bacillariophyceae with concentration silicate and phosphate showed a strong positive and
negative relationship, respectively (Figures 7 and 8). Strong positive correlation between
Bacillariophyceae and silicate is due to high affinity of these groups of phytoplankton to
silicate. The Bacillariophyceae cell walls are consisting of silica. They require the presence
of bioavailable silicate or silicic acid in their growth environment [20]. In the studied area,
the population of Dinophyceae have changed with variation of Bacillariophyceae
population.
The correlation coefficient of phosphate with density of total phytoplankton,
Bacillariophyceae, Dinophyceae and Cyanophyceae were 0.98, -0.97, 0.90 and 0.58,
respectively. Our results showed that by changing the balance of Si:P, when the SiO 4-4
concentration decreased, the density of Bacillariophyceae decreased and Dinophyceae
became dominated groups in the area. Aein Jamshid (2010) reported that the correlation
coefficient of phosphate and nitrate with Cochlodinium polykrikoides in the southern part of
Bushehr province waters in 2009 were +0.90 and +0.59, respectively. Their results showed
that the Cochlodinium polykrikoides, which is belong to Dinophyceae class, is a phosphorus
limited species [8]. The long-term investigation of Philippart and his co-worker showed that
the phytoplankton production during the spring and summer blooms was Phosphorus
limited. They reported that diatoms are Silicon limited and flagellates are Nitrogen limited
[21]. Our results are consistent with these findings with an except that the Dinophyceae are
Phosphorus limited not Nitrogen limited.
The Linear regression analysis of the density of zooplanktons with density of
phytoplankton, especially with Dinophyceae showed a negative relationship (Fig. 10).
Correlations coefficient between zooplanktons with total phytoplankton and Dinophyceae
were -0.13 and -0.68, respectively. This trends also found between Copepoda and
phytoplanktons. These results are consistent with the findings of Khodadadi, 1991 [22].
Comparison of the phytoplankton density in the present study with the results of Eco Zist
(in 1976) and Izadpanahi (in 2000) showed that total phytoplankton density has increased in
the studied area [20]. A reverse trend has found in density of zooplanktons and specially for
Copepoda. Based on the above researches, the structure of phytoplankton community in
Bushehr province waters are changed. The abundance percentage of high risk toxin
producer and bloomer class of Dinophyceae increased from 7.5% in 1976 to 29.3% in 2011,
whereas the percentage of Bacillariophyceae are decreased from 73.1% in 1976 to 61.7% in
2011. Density of zooplanktons were decreased from 1750 n//lit in 1976 to 357 n/lit in 2011
(Table 3). The results of this study indicate that due to high density of toxin producer
phytoplankton genus such as Alexandrium, Prorocentrum and Psudonitzschia, in the
vicinity of surveyed shrimp farm complexes, especially in August which is coincided with
the shrimp culture season in Bushehr province and also for high biomass bloomer genus
such as Thalassiothrix and Chaetoceros in Delvar shrimp farm in August, there is the risk
of bloom outbreaks in Bushehr province shrimp farm complexes.
Table 3: The abundance percentage and density of planktons in Bushehr province waters
phytoplankton
density (cell/lit)
Eco-Zist
1976
Izadpanahi
2000
Present
work 2011
Abundance percentage
Dinophyceae
Bacillariophyceae
Zooplankton
density (n//lit)
Copepoda
(n//lit)
4300
7.5
73.1
1750
52
1312
20.3
26.2
1312
35
21538
29.3
61.7
357
29
REFERENCES
[1]
M. Maso and E. Garces, “Harmful microalgae blooms (HAB); problematic and conditions that induce
them”, Marine Pollution Bulletin, Vol. 53, pp 620–630, 2006.
[2] A. Sournia, “Red tide and toxic marine phytoplankton of the world ocean: an inquiry into biodiversity”,
Harmful marine algal blooms, Paris: Lavoisier, Intercept Ltd, pp. 103-112, 1995.
[3] F. P. Osuna and R. A. Rodrıgueza, Nutrients, phytoplankton and harmful algal blooms in shrimp ponds: a
review with special reference to the situation in the Gulf of California, Aquaculture, Vol. 219, pp.
317–336, 2003.
[4]
X. Jiasheng, Z. Mingyuan and L. Binchang, The formation and environmental characteristics of the
largest red tide in North China, Toxic Phytoplankton Blooms in the Sea, Elsevier, New York, pp.
359– 362, 1993.
[5] R. Jimeńez, Ecological factors related to Gyrodinium instriatum bloom in the inner estuary of Gulf of
Guayaquil, Toxic Phytoplankton Blooms in the Sea, Elsevier, New York, pp. 257–262, 1993.
[6] G. I. Lizarraga, J. J.Bustillos, R. Alonso, C. Hummert and B. Luckas, Comparacio ń del perfil de toxinas
de Gymnodinium catenatum y moluscos bivalvos en dos localidades del Golfo de California.
International Meeting of the Mexican Society of Planktology, Veracruz, Mexico., Vol. 95, 2002.
[7] W. Dall, B. J. Hill, P. C. Rothlisberg, D. J. Sharples, The Biology of the Peneidae, Advances in Marine
Biology, Academic Press, New York, Vol. 27, pp. 315–330, 1990.
[8] K. Aein Jamshid, F. Mohsenizadeh, A. Haghshenas and S. Omidi, “Interactive effects of industrial
activities and marine environment in Pars Special Economic Energy Zone”, Second national
conference on sustainable development perspective, and knowledge-based integrated of Pars Special
Economic Energy Zone, Mars 2010.
[9] D. E Andrew, “ Standard Methods for Examination of Water & Wastewater”, 21ed, Washington DC.,
2005.
[10] G. E. Newell and R. C. Newell, “ Marine Plankton (a practical guid)”, Hatchinson of London, UK,
1977.
[11] M. Hoppenrath, M. Elbrächter, and G. Drebes, “Marine Phytoplankton”, Kleine Senckenberg-Reihe 49.
E. Schweizerbart Science Publishers, Stuttgart Germany, 2009.
[12] M. Omori and T. Ked, “Methods in marine zooplankton ecology”, John Wiley and sons, 89, 1984.
[13] MOOPAM, ” Manual of Oceanographic Observation and Pollutant Analyses Methods”, ROPME
Publishing, 4th ed., 2010.
[14] L. S. Clesceri, A. E. Greenberg and R. R. Trussell, Standard methods for the water examination of water
and waste. Port city press, Baltimor, p. 1268, 1989.
[15] Ø. Moestrup, R. Akselman, G. Cronberg, M. Elbraechter, S. Fraga, Y. Halim, G. Hansen, M.
Hoppenrath, Larsen, J., N. Lundholm, L. N. Nguyen, A. Zingone, “2009 Ed IOC-UNESCO
Taxonomic
Reference
List
of
Harmful
Micro
Algae”
Available
online
at
http://www.marinespecies.org/HAB. Accessed on 2013-07-26.
[16] A. Zingone and H. O. Enevoldsen, “The diversity of harmful algal blooms: a challenge for science and
management”, Ocean & Coastal Management, Vol. 43, pp. 725-748, 2000.
[17] Gh. Izadpanahi et als. Hydrology and hydrobiological study of the Persian Gulf in the Bushehr region.
Final project report (in Persian), Iranian Fisheries Research Organization, 2005.
[18]
Sadaf Gul and S. M. Saifullah, “The dinoflagellate genus prorocentrum (prorocentrales,
prorocentraceae) from the north Arabian sea”, Pak. J. Bot., Vol. 43, No. 6, pp. 3061-3065, 2011.
[19] D.M. Anderson et al, “The globally distributed genus Alexandrium: Multifaceted roles in marine
ecosystems and impacts on human health”, Harmful Algae, Vol. 14, pp. 10–35, 2012.
[20] T. J. Smayda, What is a bloom? A commentary. Limnology and Oceanography, Vol. 42, pp. 1132-6,
1997.
[21] C. J. M. Philippart, J. J. Beukema, G. C. Cadée, R. Dekker, P. W. Goedhart, J. M. Van Iperen, M. F.
Leopold, P. M. J. Herman, Impacts of nutrient reduction on coastal communities, Ecosystems Vol.
10, pp. 96-119, 2007.
[22] M. Khodadadi, “Identifacation of Persian Gulf planktons, from Bahrakansar to Nayband bay”, Final
project report (in Persian), Iranian Fisheries Research Organization, 1991.
Contribution to the Phylogenetic and Phylogeographic Study of some Limpets Species
in the Algerian Coastline
Contribution to the phylogenetic and phylogeographic study of some
limpets species in the Algerian coastline
Karim Mezali1 and Zoheir Bouzaza1,2
Department of Marine Sciences and Aquaculture, 2Department of Biology, Faculty of Natural
Science and Life, Abdelhamid Ibn Badis University of Mostaganem, 27000, PO Box 300, Algeria.
1
SUMMARY
In ecology, the study of patterns between species is necessary to understand the factors affecting their
distribution and the dislocations causing their divergence. The aim of this work is to study the phylogeny
and the phylogeography of some Prosobranchia Gastropoda (Patella rustica and Patella ferruginea) to
understand the pattern of connectivity between populations by explaining the causes of their differences, their
distribution and their responses to environmental change using the paleontological data. After identifying our
species morphologically, we performed the molecular work (DNA extraction, PCR, DNA sequencing ...) using
the mitochondrial marker cytochrome oxydase I (COI). The results of mitochondrial DNA
sequences obtained were treated using some software (Codon Code Align, MEGA 5…) following the
method of maximum likelihood "ML". We noted that the divergence and geographic distribution among
species was consistent with some paleontological changes, which could be the cause of differences of the
studied species.
Keywords: Phylogeography, mitochondrial DNA, paleontological upheaval, Phylogeny, Limpets.
INTRODUCTION
One of the sciences that most intrigued the human being is the study of the relationship
between the living being (phylogeny) and their evolution through time and space (The
phylogeography) which then gave the idea of the concept of speciation [1]. Natural
populations show in the environment where they live many morphological adaptations [2].
Natural selection is a key point of this theory which could influence the life history traits in
order to optimize the reproductive success of the species [3]. Marine organisms defy
evolutionary models and most common speciation, because they live in an environment that
is apparently devoid of dispersal barriers, and often have large numbers of individuals and
well-developed dispersal capacities [4]. Speciation in the marine realm defeats the allopatric
speciation model, marine species usually show a high dispersal capacity with low barriers,
we can say that the absolute dispersion exist in the marine environment [5]. Many marine
species, like limpets, release their gametes into the water, where fertilization takes place.
The aim of this work is to know the history of vicariance and evolutions of the species of
limpets studied and try to find out when the divergence occurred and what paleogeographic
phenomenon has caused it.
STUDY AREA
Our study was performed on the Algerian coast, from east to west; we collected two species
of limpets: Patella rustica, Patella ferruginea (Fig. 1). Algeria has a coastline about 1280
km, the Algerian-Moroccan border in the west to the Algerian-Tunisian border to the east
[6].
Figure 1: Map showing the sites where the species of limpets have been sampled along the Algerian
coastline. The orange squares represent the stations where the species P. rustica was collected, and the
green triangles represent the stations where the species P. ferruginea was collected.
Collection of samples
We chose several samples from the Far East to the extreme west of the Algerian coast as it
is shown in Figure 1. Abbreviations and sampling stations are given in Table 1.
Table 1: Abbreviations and details of study sites
Station name
VK
CO
RN
ZM
BO
FP
BE
CE
ST
R
Region name
Vieille calle (El Kala)
Collo
Rocher Noir
Ziama Mensouria
Boulimate
Figuier Plage
Bérard
Cap Evi
Stidia
Rechgoun
Geographic situation
36.9° N, 8.45° E
36.9° N, 6.53° E
36.78° N, 5.63° E
36.74° N, 5.56° E
36. 87° N, 4.84° E
36.78° N, 3.53° E
36.6° N, 2.6° E
36.12° N, 0.23° E
35.83° N, 0° E
35.30° N, 1.46° O
We chose several samples from the Far East stations to the extreme west of the Algerian
coast as it is shown in Figure 1.
Molecular study
The molecular work based on tissue samples taken by scalpel from the podia pulpit of
limpets sampled after having carefully washed with distilled water. The samples were
stored in 96% Ethanol. Mitochondrial DNA was extracted from tissues and used for PCR
amplification [7]. Extraction of mtDNA was made following the "JETQUICK tissue DNA
Kit" (This protocol is a modification of the method published by Botwell (1987)) [8]. After
extracting mtDNA of our samples, we performed PCR amplification [7]. We have isolated
the portion of the mitochondrial COI gene using the sense primer HCO (5'CATGGATGACCACGACACTC-3')
and
anti-sense
LCO
(GGTCAACAAATCATAAAGATATATTGG 5'-3') [9].
Sequencing was performed according to the method of Sanger et al. (1977) [10]. We
sequenced 584 bp of 24 individuals of Patella rustica (Pr), 16 individuals of Patella
ferruginea (Pf) and four individuals of Patella caerulea (Table 2).
Table 2 Table showing the number of sequenced species for each station studied
Species
Stations
VK
RN
ZM
FP
BE
CE
ST
R
Patella rustica
(Pr)
6
3
1
5
1
2
6
-
Patella ferruginea
(Pf)
1
5
2
4
4
-
Patella caerulea
(Pc)
1
3
Data Analysis
Relationships between individuals or populations are visualized via the construction of
phylogenetic trees. After aligned mtDNA sequences scrutinized by the BioEdit program
[11] and manually, we proceeded to develop phylogenetic trees, but before that we had to
find the best statistical model that could give us the most robust tree. For this, we used the
"jModeltest 0.1.1" [12] program. As for the development of phylogenetic trees, "Mega 5.0"
program [13] has allowed us to build trees using the method of maximum likelihood [14]
"ML". The relationship between haplotypes can be understood through the construction of
haplotype networks using the "Median Joining" method [15]. The construction of these
networks is based on the theory of coalescence [16].
RESULTS
Phylogenetic and phylogeographic study
The phylogenetic study has been prepared by developing trees by the method of Maximum
Likelihood "ML". By using the "jModeltest 0.1.1" [12] program, the "Jukes-Cantor" model
was considered as the most suitable to study the distribution parameter and the parameter
Gamma invariable site "(G+ I) ". Using a number of replicas bootstrap 100, The
Phylogenetic tree of all species sequenced in this study was prepared according to the "ML"
method using 584 Pb aligned with the "BioEdit" program [11] and manually.
Sequence analysis revealed, among those species studied, the existence of three strongly
divergent groups as shown in Figure 2 based on the average distances between individual
pairs of populations with Log shows (L) = -1349.54 (L being the likelihood). The species
Patella vulgata (P. vulgata), taken from genbank, is used as an "out group" to have a good
reference for a better topology.
Between the group of P. rustica and P.caerulea there is a significant difference of about
14%, however, between P. ferruginea and P. caerulea there is also a wide divergence of the
order of 13.6%. Between P. rustica and P. ferruginea there is a smaller difference of 9.9%.
The significant difference in the three groups is more marked than the average divergence
within each group and it is less than 1%.
Figure 2: Phylogenetic tree of sequenced species obtained by "ML" method with a number of 100
bootstrap replicas
We used the "relaxed clock" model with a log-normal distribution of substitution rates, with
two different mean values (0.6% and 1.2% per million years) [17] and [18] for molluscs, a
classically encountered in animals rates [19]. A difference of 9.9% could state that the
nearest common ancestor (TMRCA) of the two species (P.rustica and P. ferruginea) could
be between 8.25 and 4.125 MA, for the two species P. rustica and P. caerulea the nearest
common ancestor would be between 11.86 and 5.83 MA, and finally for P.ferruginea and
P. caerulea the TMRCA is between 11.33 and 5.66 MA. Analyses of mitochondrial
polymorphism, under the assumption of neutrality, provide interesting ideas about the
history of the geographical expansion of each group of species studied. In the absence of
selective effect, these features suggest a recent increase in the population size. We can,
however, see the representation of minimal relations between haplotypes (Fig. 3), there are
three distinct groups representing each studied taxa.
Figure 3: Networks of haplotypes representing minimal relations between haplotypes of three species of
limpets present in our study.
DISCUSSION
The divergence between the group of P. rustica and P. caerulea is the most important, it is
between 5.83 and 11.86 Ma, when located on the Upper Miocene (between 11.608 ± 0.005
and 5.332 ± 0.005 Ma) specifically the Tortonian (between 11.6 and 7.2 Ma.). This era also
includes the period of divergence between P. caerulea and P. ferruginea. During this era,
Europe as we know it today, was partially submerged by the sea surface and the
temperature was higher with significant fauna and flora [20]. For P. rustica and P.
ferruginea, the divergence is smaller, ranging between 8.25 and 4.125 Ma, it might have
started during the Messinian by paleontological effects. The sea level in the Mediterranean
had fallen to dryness; episode marks the Messinian Salinity Crisis. The Messinian crisis has
created new habitats with sporadic distribution, generating an allopatric speciation between
the Mediterranean and the Atlantic and the disappearance of many species. The episode
ends in the early Pliocene (5.332 ± 0005 to 2.588 ± 0.005 Ma) by the opening of the Strait
of Gibraltar [21]. The haplotype network (Fig. 3) shows that there is a star distribution. This
would explain a recent population explosion, it could be due to the colonization of new
territories after the last glacial maximum (20-19 KAAJ) which induced an increase in the
sea level and thus the formation of the transition Atlantic waters to the Mediterranean
through the Strait of Gibraltar.
REFERENCES
[1] Blondel J. : « Biogéographie : Approche écologique et évolutive ». Collection Ecologie, Masson Ed, 27 :
297 p, Paris. (1995).
[2] Bazzaz F. A., Chiariello N. R., Coley P. D. & Pitelka L. F.: « Allocating resources to reproduction and
defence ». BioScience, 37(1): 58 pp. (1987).
[3] Lack D. L., Hodgkin A. L., Venables L. S. V., Mayr E, Hardy A. C., Thorpe W. H. & Tinbergen N.. « My
life as an amateur ornithologist ». Ibis, 115(3): 421 (1973).
[4] Muths D. : « Structures génétique et démographique des populations de deux espèces d’ophiures aux
caractéristiques biologiques contrastées, Acrocnida brachiata et Ophiothrix fragilis, en Atlantique
Nord-Est » Thèse en vue de l’obtention du diplôme de doctorat de l’Université de ParisVI, 256 p.
(2006).
[5] Palumbi S. R. :« Genetic divergence, reproductive isolation and marine speciation ». Annual Review of
Ecology and Systematics, 25 : 547-572. (1994).
[6] Zeghdoudi E. : « Modélisation bioéconomique des pêcheries méditerranéennes Application aux petits
pélagique de la baie de Bou Ismail (Algérie) ». Thèse en vue de l’obtention d’un diplôme de Master
de science économique de géstion, Pesquera Barcelone, 60 p. (2006).
[7] Mullis K. B. & Faloona F. A. : « Specific synthesis of DNA in vitro via polymerasecatalyzed chain
reaction ». Methods in Enzymology, 155 : 335–350. (1987).
[8] Botwell D. L. L. : « Rapid isolation of eukariotic DNA ». Anal. Biochem. 162: 463 p. (1987).
[9] White T. J., T. Bruns T., Lee S., Taylor J. W. (1990). Amplification and direct sequencing of fungal
ribosomal RNA genes for phylogenetics. Pp. 315-322 In: PCR Protocols: A Guide to Methods and
Applications, eds. Innis, M. A., D. H. Gelfand, Sninsky J. J., and White T. J.. Academic Press, Inc.,
New York.
[10] Sanger F., Nicklen S. & Coulson A. R. (1977). « DNA sequencing with chain terminating Inhibitors ».
Proceedings of the National Academy of Sciences of the United States of America, 74(12) : 5463–
5467.
[11] Hall T. A. : « BioEdit: a user-friendly biological sequence alignment editor and analysis program for
windows 95/98/NT ». Nucl. Acids. Symp. Ser. 41: 95-98. (1999).
[12] Posada D. : « jModeltest 0.1.1, Phylogenetic Model Averaging ». Mol. Biol. Evol. 25 : 1253-1256.
(2008).
[13] Tamura K., Peterson D., Peterson N., Stecher G.,Nei M., Kumar S. : « MEGA5: Molecular Evolutionary
Genetics Analysis ». Software version 5.03, Bioinformatics. http://www.megasoftware.net/ (2011).
[14] Cavalli-Sforza L. L. & Edwards A.W.F. : « Phylogenetic analysis: models and estimation
procedures ». American Journal of Human Genetics, 19 : 233-257. (1967).
[15] Bandelt H. J., Forster P. & Rohl A. (1999). « Median-Joining Networks for Inferring Intraspecific
Phylogenies ». Mol. Biol. Evol. 16(1):37–48.
[16] Kingman J. F. C. : « The coalescent ». Stochastic Processes and their Applications, 13 : 235-248. (2000).
[17] Hellberg M. E. & Vacquier V. D. : « Rapid evolution of fertilization selectivity and lysine DNA
sequences in teguline gastropods ». Molecular Biology and Evolution, 16 : 839–848. (1999).
[18]Marko P. B. : « Fossil calibration of molecular clocks and the divergence times of geminate species pairs
separated by the Isthmus of Panama ». Molecular Biology and Evolution, 19 : 2005–2021. (2002).
[19] Rand D. M. : « Thermal habit, metabolic rate and the evolution of mitochondrial DNA ». Trends in
Ecology & Evolution 9 : 125-131. (1994).
[20] Bachiri Taoufiq N & Barhoun N. : « La végétation, le climat et l'environnement marin au Tortonien
supérieur dans le bassin de Taza-Guercif (corridor rifain, Maroc Oriental) d'après la palynologie ».
Geobios, 34(1) : 13-24. (2001).
[21] Liu G., Leopold E. B., Liu Y., Wang W., Yu Z. & Tong G. : « Palynological record of Pliocene climate
events in North China ». Review of Palaeobotany and Palynology Vol. 119, Issues 3-4, June 2002,
Pages 335-340. (2002).
Etude de la Diversité Génétique de Trois Espèces du Genre Epinephelus: E. aeneus,
E. costae et E. marginatus dans le Golfe de Gabès par Analyse du Gène
Cytochrome b de l’ADN Mitochondrial
Étude de la diversité génétique de trois espèces du genre Epinephelus :
E.aeneus, E.costae et E.marginatus dans le Golfe de Gabès par analyse du
gène cytochrome b de l’ADN mitochondrial
Elglid.A1, Fadhlaoui-zid K.1, Crouau-Roy B.2, Bradai M. N.1
Institut National des Sciences et Technologies de la Mer (INSTM), Tunisie [email protected]
2
Laboratoire d’Evolution et Diversité Biologique (EDB) CNRS-Univ. P. Sabatier [email protected]
1
RESUME
Les mérous du genre Epinephelus ont une grande valeur commerciale. Toutefois, certaines de ces espèces
sont surexploitées voire en danger comme le cas d’E. marginatus dont la croissance est lente et la maturité
est tardive. Le gène cytochrome b de l’ADN mitochondrial est analysé afin d’évaluer la variabilité génétique
et les relations phylogénétiques de ces trois espèces de mérous en Méditerranée. Une faible diversité
génétique a été détectée pour E. marginatus et E. aeneus ce qui les rend plus sensible à l’exploitation.
Mots clés : E. marginatus, E. aeneus, E. costae, ADN mitochondrial, Golfe de Gabè
SUMMARY
Groupers of the genus Epinephelus have great commercial value. However, some of these species are
overfished or in danger as in the case of E.marginatus with slow growth and late maturity. In this study the
mitochondrial gene cytochrome b was analyzed to assess genetic variability and phylogenetic relationships of
three Epinephelus species (E.aeneus, E.costae and E.marginatus) in the central Mediterranean Sea. The most
relevant result was the low genetic diversity detected for E.marginatus and E.aeneus which makes them more
vulnerable to exploitation.
Keywords: Central Mediterranean Sea, cytochrome b, Epinephelus
INTRODUCTION
Les mérous du genre Epinephelus représentent une composante importante des faunes
marines démersales tropicales, subtropicales et tempérées chaudes, tous sont des prédateurs
de poissons et d’invertébrés. Ils sont hermaphrodites ; d’abord femelles puis mâles
(protogyniques). Ces mérous sont très demandés sur le marché aussi que par les pêcheurs
sportifs, et sont ciblés principalement par des pêches artisanales. Certaines espèces surtout
du genre Epinephelus sont surexploitées voire en danger; E. marginatus est en danger selon
l’évaluation régionale de l’UICN, espèce de faunes protégées (annexe III - Convention de
Berne) et espèce dont l’exploitation devrait être réglementée selon la convention de
Barcelone (Annexe III). La croissance est en effet lente et la maturité est tardive [1]. De ce
fait plusieurs expériences d’élevage ont été lancées [2]. Les mérous ont fait l’objet de
quelques études biologiques en Tunisie [3], [4], [5], [6]; mais aucune investigation
génétique. Pour la gestion et la durabilité des populations de poissons, l’étude de la diversité
génétique est essentielle, en effet le gène cytochrome b (cytb) d'ADN mitochondrial
(ADNmt) étudié dans ce papier possède de nombreux attributs qui le rendent
particulièrement approprié pour les études de génétique des populations, y compris son
rythme rapide d’évolution, l'absence de recombinaison et de l'héritage maternel. L'objectif
de la présente étude est de déterminer la variabilité génétique de ces trois espèces
moyennant l’analyse d’un fragment du gène cytochrome b.
Les spécimens de mérou E.aeneus, E.marginatus et E.costae utilisées dans cette étude, sont
péchés dans le Golfe de Gabès (Fig1). Pour E.caninus, E.haifensis, les séquences ont été
téléchargées de la Banque de Gènes respectivement sous le numéro HQ167719.1 et
HQ167721.1. Un fragment du gène cytochrome b de l’ADN mitochondrial de taille 905 pb
a été amplifié à l'aide de deux amorces 28 For [7] et EpiR (développé dans cette étude).
L’amplification génique ou « Polymerase Chain Reaction » (PCR) a été réalisée dans un
mélange réactionnel de 25 µl contenant 16,8 µl d'eau distillée stérile, 5 µl de tampon 5X, 1
µl dNTP (2,5 mM), 0,5 µl de chaque amorce (10 µM), 0,2 µl Go Taq polymérase (5U), et
1µl d’ADN (25 ng d'ADN). Les conditions pour l'amplification étaient les suivantes : 95 ° C
pendant 5 min, suivie de 40 cycles à 95 ° C pendant 1 min, 52 ° C pendant 45 sec et 72 ° C
pendant 1 min, avec un cycle d'extension finale supplémentaire à 72 ° C pendant 10 min.
Les produits de PCR obtenus ont été purifiés puis séquencés, dans les deux sens (sens et
anti-sens) à l’aide des amorces qui ont servis pour l’amplification (28 For et EpiR) puis
déposées dans la banque de gènes sous les numéros suivant KC533550.1, KC533570.1 et
KC533556.1 respectivement pour E.aeneus, E.marginatus et E.costae.
Les séquences obtenues de taille 940-pb ont été alignées à l'aide du logiciel BioEdit v.7.0.5.
[8]. Afin d’estimer la diversité génétique dans chaque population, la diversité haplotypique
(h) et la diversité nucléotidique (π) [9 ; 10] ont été calculées moyennant le logiciels DnaSP
[11]. L’arbre phylogénétique a été obtenu avec le software Mega V.5 [12].
Figure 1. Site d’échantillonnage
RESULTATS
Le séquençage d’un fragment de 940 pb du gène cytb a permis de déterminer la
composition moyenne des bases, le nombre de sites polymorphes (informatifs et singletons)
pour les différentes espèces (Tableau 1).
Tableau 1 : Composition moyenne des bases, nombre des sites conservés, variables,
informatifs et singletons des séquences de cytb pour E. aeneus, E.marginatus et E.costae
Espèces
Composition en base en %
T
C
A
G
E.aeneus Tunisie 28.9
31.9
25.0
14.2
E.marginatus
28.7
32.0
24.6
14.7
Tunisie
E.costae Tunisie 28.7
32.6
24.1
14.6
Conservés
842
841
Variables
7
8
847
10
Sites
informatifs
1
4
Singletons
6
4
2
8
Au total 24 haplotypes distincts ont été trouvés, 7 haplotypes pour E. aeneus et
E.marginatus avec diversités haplotypiques (h) respectives de 0,395 et 0.294, pour E.costae
10 haplotypes et une diversité élevée (h=0.833). Les valeurs de la diversité nucléotidique
(π) sont faibles pour les trois espèces, elles sont de 0.0005 pour E.aeneus, 0.0007 pour
E.marginatus et 0,001 pour E.costae. Ces faibles valeurs de (π) et (h) témoignent un signal
d’un sévère goulot d’étranglement ou bottleneck démographique pour les deux espèces
E.aeneus et E.marginatus qui a été prolongé dans le temps alors que pour E.costae la
valeur de h est forte alors que celle de π est faible; dans ce cas nous assistons à une
croissance rapide de la population à partir d’une population ancestrale à faible effectifs et
où le temps de l’expansion n’a pas été largement suffisant pour retrouver une forte diversité
entre les haplotypes. Ce résultat démontre que la diversité génétique de E.costae est plus
importante que E.aeneus et E.marginatus ce qui rend ces deux dernières plus fragiles à
l’exploitation.
L'arbre phylogénétique construit à l'aide de méthodes neighborjoining et maximum de
vraisemblance [13] montre qu’E.aeneus est le taxon ancestral des Epinephelinae (Fig 2).
Les analyses morphologiques et moléculaires doivent être couplées pour résoudre divers
problématiques de la systématique et la phylogénie des espèces. En effet, la distance
génétique entre E.marginatus et E.haifensis (Φst = 0,167, P <0, 05) ainsi que l’arbre
phylogénétique montre que ces deux espèces sont différentes puisqu’elles ont été
confondues sous le nom d’E.guaza jusqu’à où Heemstra (1991) [14] les a séparés au moyen
des critères morphologiques.
Figure2 : Arbre Neighbor-joining (NJ) basé sur les séquences nucléotidiques de cytb
Les chiffres au-dessus des branches indiquent les valeurs de bootstrap (1000 répétitions).
CONCLUSION
L’étude de la structure génétique des mérous du genre Epinephelus dans le Golfe de Gabès
moyennant le séquençage du gène cytochrome b de l’ADN mitochondrial a permis de
mettre en évidence que les deux espèce E.marginatus et E.aeneus sont génétiquement peu
diversifiées. Compte tenu de l’importance économique de ces espèces et afin de mieux
appréhender la variabilité génétique surtout pour E.marginatus qui est une espèce menacée,
une analyse parallèle portant sur les microsatellites qui sont des marqueurs très
polymorphes est en cours de réalisation.
REFERENCES
[1] Morris, A.V., Roberts, C.M. and Hawkins, J.P. 2000. The threatened status of groupers (Epinephelinae).
Biodiversity and Conservation, 9(7): 919-942.
[2] Chiu ST, Tsai RT, Hsu JP, Liu CH, Cheng W (2008) Dietary sodium alginate administration to enhance
the non-specific immune responses, and disease resistance of the juvenile grouper Epinephelus
fuscoguttatus. Aquaculture 277:66–72.
[3] Bouain A. 1980. Sexualité et cycle sexuel des mérous (Poissons, Teleostéens, Serranidés) des Côtes du
Sud Tunisien. Bull. Off. Natl. Peches (Tunisia), 4(2) : 215-229.
[4] Bouain A, Siau Y. 1983. Observations on the female reproductive cycle and fecundity of three species of
groupers (Epinephelus) from the southeast Tunisian seashores. Marine Biology, Berlin, Heidelberg,
73(2) : 211-220.
[5] Bruslé J., Bruslé S. 1975. Contribution to the study of the reproduction of two species of groupers, E.
aeneus (G. Saint-Hilaire, 1809) and E. guaza (Linné, 1758) on the coasts of Tunisia). Rev. Trav. Inst.
Pêches Marit., 39(3) : 313-320.
[6] Chauvet C. 1981. Calcul par otolimétrie de la relation. Long. T - Age d’Epinephelus guaza (Linné 1758)
de la Côte Nord de la Tunisie. Rapp. Comm. Int. Mer Médit., 27(5) : 103-106.
[7] Meyer A., Kocher T.D., Basasibawaki P.,Wilson A.C., Monophyletic origin of Lake Victoria’s cichlid
fishes suggested by mitochondrial DNA sequences, Nature (London) 347 (1990) 550–553.
[8] Hall, T.A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for
Windows 95/98/NT. Nucl. Acids. Symp. Ser. 41:95-98
[9] Nei M, Tajima F. 1981. DNA polymorphism detectable by restriction endonucleases. Genetics 97:145–
163.
[10] Nei M. 1987. Molecular Evolutionary Genetics. New York:;Columbia University Press
[11] Librado, P. and Rozas, J. 2009. DnaSP v5: Bioinformatics., 25: 1451–1452.
[12] Tamura K, Peterson D, Peterson N, Stecher G, Nei M, and Kumar S (2011). MEGA5, Molecular Biology
and Evolution (submitted).
[13] Saitou, N., and Nei, M. 1987. The neighbor-joining method: a new method for reconstructing
phylogenetic trees. Mol Biol Evol 4:406–425.
[14] Heemstra P.c., 1991. A taxonomy revision of the eastern Atlantic groupers (Pisces: Serranidac), Bol.
Mus. Mun. Funchal., 43 (226): 5-71
Faune Vertébrée de Quelques Milieux Insulaires d’Algérie : Diversité et Aspects de
Conservation
Faune vertébrée de quelques milieux insulaires d’Algérie : Diversité et
aspects de conservation
Vertebrate fauna of some islands in Algeria: Diversity and conservation issues
1
Moulaï R.1, Bougaham A. F.1, Aissat L. 1, Chelli A.1, Ghermaoui M.2, Hamadi K.3
Laboratoire de Zoologie Appliquée et d’Ecophysiologie Animale, Faculté des Sciences de la Nature et de la
Vie, Université de Béjaia 06000 Béjaia, Algéria. 2Université de Tlemcen (Algéria). 3USTHB (Algéria)
Email : [email protected]
SUMMARY
Vertebrate fauna inhabiting a number of island environments in Algeria is listed and characterized. The
island systems studied are spread both east to west at the center of the Algerian coast. Ten islands have been
explored; the Rachgoun island in Oran sector, the Aguéli and Tigzirt islands at the central coast; El Euch ,
Pisans , Sahel, Petit Cavallo, Grand Cavallo island , îlot Grand Cavallo and Tazrout islands on the east
coast. Taxa listed belong to classes of birds (Aves), reptiles (Reptilia) and mammals (Mammalia) . Eleven (11)
species of birds nest more or less evenly over the ten sites surveyed. Only the Yellow-legged Gull, Larus
michahellis breeds on the islands with varying numbers. The largest colonies have been recorded on
Rachgoun island on Grand Cavallo to Jijel coast and the island of Pisans to Bejaia . The Rachgoun island is
the richest, with 7 species breeding, followed islands of El Euch, Pisans, Grand Cavallo and Petit Cavallo,
with 5 species for each site. Some islands have only two breeding species (Tazrout, Aguéli and Grand
Cavallo) . Six species (06) of reptiles have been observed within island communities surveyed. All of them
belong to the suborder saurian and no Ophidian has been observed. It is also interesting to note that no
amphibian species have been listed. The absence of this group is classic, just like it is on most of the small
Mediterranean islands. Both small size of the islands and their climate frequently do not allow the presence of
water points required for the reproduction of amphibians. On the island Grand Cavallo, inhabits the highest
number of reptiles (5 species) followed by El Euch , Pisans and Petit Cavallo islands, with 3 species for each
site. One mammalian species has been noted in all the island, it is the black rat, Rattus rattus.
Keywords: islands, Vertebrate, Algeria, Diversity
INTRODUCTION
Les systèmes insulaires constituent des modèles de choix pour étudier les patrons
écologiques en raison de la relative simplification des communautés et des interactions
biotiques, notamment sur les îles de faibles superficies (HONER et GREUTER, 1988). Ces
ensembles isolés s’avèrent très fragiles et sensibles vis a vis des multiples perturbations, ce
qui conduit souvent à des déséquilibres spectaculaires, en particulier des phénomènes
invasifs de première ordre (ATKINSON, 1985 ; CHAPUIS et al., 1989). La diversité
biologique dans ses milieux fragiles à été bien étudiée dans la partie nord de la
Méditerranée, nous pouvons citer les travaux de (DAJOZ, 1987 ; VIDAL, 1998 ; BONNET
et al., 1999), ce qui n’est pas le cas de la rive sud de la Méditerranée, notamment en
Algérie, ou il est vrai que malgré une côte de 1200 Km, le nombre d’îles et d’îlots est très
limité. Les travaux sur l’évaluation de la diversité animale des îlots de l’Algérie sont quasi
inexistant, sauf de rares études s’intéressants à des taxons bien définis à l’exemple des
oiseaux marins nicheurs (JACOB et COURBET, 1980 ; BOUKHALFA, 1990 ; MOULAI,
2006 ; BOUGAHAM, 2008). De rares études peuvent cependant être citées, comme celles
de MOULAI (2005) sur l'évaluation de la diversité biologique (faune et flore) des îles de
Bèjaia ou encore celle de AISSAT (2011) sur la faune des îles à l’ouest de Jijel.
Conservation
L'objectif de cette présente étude, vise à inventorier la faune vertébrée peuplant un certain
nombre de milieux insulaire en Algérie, disséminés aussi bien à l’est, à l’ouest qu’au centre
de la côte algérienne. Pour les besoins de l’étude, une dizaine d’îles sont prospectées. Il
s’agit de l’île Rachgoun, dans le secteur oranais, de l’île d’Aguéli et de l’île de Tigzirt au
niveau de la côte centrale, de l’îlot d’El- Euch, de l’île des Pisans, de l’îlot de Sahel, de l’île
Petit Cavallo, de l’île Grand Cavallo, de l’îlot Grand Cavallo et de l’île de Tazrout sur le
littoral est.
Localisation et description des milieux d’études
Une dizaine d’îlots sont prospectés. Ils sont localisés, aussi bien sur la côte ouest, centre,
qu’a l’est de l’Algérie (Fig. 1).
Milieux insulaires de la côte ouest
Sur cette portion du littoral, seul l’île rachgoun fera l’objet de la présente étude. Le littoral
de Rachgoun localisée sur la partie occidentale du Nord-Ouest algérien, appartient à la
façade maritime de l’Oranie située à l’Ouest de la wilaya d’Ain T’émouchent et au Nord Est
de la Wilaya de Tlemcen, elle correspond en fait au Massif de la basse Tafna. Rachgoun est
distante de 37 km de la ville d’Ain T’émouchent et d’environ 58 km de la ville de Tlemcen
et de 7 km de la ville de Béni-Saf. Elle est localisée à trois kilomètres de la côte, face à
l’embouchure de l’Oued Tafna. L’île de Rachgoun s’éloigne d’environ 3 km du rivage, de
la plage de Madrid, elle s’étale sur une superficie d’environ de 16,5 hectares. Le plateau de
l’île s’élève jusqu’à une altitude de 65 mètres avec une faible pente de moins de 10%, la
profondeur dans l’eau est comprise entre 2 et 20 m. Le couvert végétal de l’île de Rachgoun
est de type matorral dégradé. Il est dominé d’une part par Salsola vermiculata, Lycium
barbarum et Withania frutescens et par des espèces rudérales constituées de Malva
sylvestris, Urtica urens, Lavatera mauritanica et Parietaria judaica
Milieux insulaires de la côte centrale
Au niveau de la côte centrale, nous avons échantillonné, deux sites, il s’agit de l’île
d’Aguéli et de l’île de Tigzirt (Fig. 1).
Ile d’Aguéli
L’île d’Aguéli est un îlot rocheux situé à 1 km du Rivage de Réghaia. Il couvre une
superficie de 0,25 Ha. La hauteur de l’île ne semble pas dépasser les 20 mètres. Le couvert
végétal de l’îlot est dominé par les plantes herbacées. On peut rencontrer, Atriplex
prostrata, Lotus cytisoides et Lavatera cretica
Île de Tigzirt
L’îlot se situe à 150 m environs au Nord-Nord-Ouest du littoral de Tigzirt. Il a une altitude
variant entre 0 et 20 m, exposé vers le Nord et une superficie de 0,35 Ha. Ses coordonnées
géographiques sont de 4°08’ de latitude Nord et de 36°53`longitude Est. La nature de la
roche mère au niveau de l’îlot découle du flysch numidien. Il est de type sédimentaire
quartzites à ciment siliceux, ses graines de quartez mesure environs 1mm (Hassissen,
Comm. Perso.). Le couvert végétal est de type matorral dégradé, dominé par Phyllirea
media et Olea europea
Milieux insulaires de la côte est
Il s’agit de sept îlots. Nous citons d’ouest en est ; l’îlot d’El- Euch, l’île des Pisans, l’îlot de
Sahel, l’île Petit Cavallo, l’île Grand Cavallo, l’îlot Grand Cavallo et l’île de Tazrout
(Fig.1).
Conservation
Ilot de Sahel
Il est situé à 6,15 km de Béjaia dans la localité d’Adrar Oufarnou. Il est séparé du rivage par
une distance de 7 mètres, sa superficie est de 0,2 ha avec une hauteur maximale de 15
mètres.
Ile des Pisans
Appelée aussi « Nezla » est située à 10,5 km de Béjaia dans la région de Boulimat. L’îlot
des Pisans est localisé à 1,25 km du rivage avec une superficie de 1,2 ha et une hauteur
maximale de 30 m.
Ilot d’El Euch
Il est aussi connu sous le nom de l’île des Pigeons. Il est situé à 50 km de Béjaia et à 3 km à
l’est de Cap Sigli. L’îlot est distant d’environ 0,12 km du rivage et couvre une superficie de
0,8 ha avec 20 m de hauteur maximale. Tous les sites ont une structure en grande partie
rocheuse. Adrar Oufarnou est formé par des schistes rouges et verts avec du calcaire
lenticulaire inter-stratifié. Il appartient au Jurassique supérieur. L’îlot de Sahel quant à lui
est dominé par du tuf carbonaté. Sur l’îlot d’El Euch et l’île des Pisans la roche est plutôt de
type grès fin à ciment siliceux (quartzite), ce qui fait qu’ils appartiennent probablement à la
série sédimentaire du Flysch numidia (DUPLAN, 1952). Le couvert végétal des trois îlots
de Béjaia est de type matorral dégradé. Il est dominé par Olea europea et Pistacia lentiscus
pour l’îlot de Sahel, Opuntia ficus indica et Lavatera arborea pour l’île des Pisans,
Phyllirea media et Atriplex halimus pour l’îlot d’El Euch (MOULAÏ, 2005). L’inventaire
des végétaux vasculaires réalisé au niveau de ces trois sites, montre l’existence de 41
espèces dans l’îlot de Sahel, 40 espèces dans l’île des Pisans et 50 espèces dans l’îlot d’El
Euch (MOULAÏ, 2005)
Ile Grand Cavallo
Il est située à 20 Km de Jijel dans la localité d’El Aouana. Elle est séparée du continent de
950 m, sa superficie est de 6 ha. Son relief est assez accidenté. Sa face Ouest comprend une
falaise avec une altitude maximale de 50 m. Le substrat, est de type magmatique, composé
de Feldspath blanc de grande taille et de Mica blanc, à texture grenue (Hassissene comm.
perso.). Généralement, le couvert végétal est de type matorral haut, il peut atteindre 4
mètres de hauteur. Il est formé principalement de Pistacia lentiscus et de Phillyrea media,
et en partie, d’une flore nitratophile, à l’exemple de, Lavatera cretica, Urtica membranacea
et Chenopodium murale
Ilot Grand Cavallo
Il est aussi situé dans la région d’El Aouana. Il est séparé du rivage par une distance de 50
m. Il possède une superficie de 0,15 ha avec une altitude maximale de 30 m. La nature du
substrat est de type magmatique à Feldspath blanc et Micas noirs (Biotite), d’une texture
microgrenue (Hassissene comm. perso.). Le site a en grande partie, une structure rocheuse
et dénudée. Le couvert végétal, est sous forme de touffes localisées au sommet de l’îlot. On
trouve Pistacia lentiscus, Phillyrea media et quelques sujets de Chamaerops humilis. On
note aussi, quelques plantes herbacées.
Ile Petit Cavallo
Il est localisée à 13 Km de Jijel dans la région d’Andreu. Elle est séparée de l’abord
continental par une distance de 750 m. Elle s’étend sur une superficie de 4 ha. Le relief est
assez plat avec une altitude maximale de 10 m. Les roches sédimentaires prédominent, sous
forme de Grès moyen à ciment dolomitique (Grès numidien) (Hassissen, comm. perso.).
Dans l’ensemble, le site est recouvert d’un matorral plus au moins haut, composé
essentiellement de Pistacia lentiscus et de Phyllirea media. En outre, il abrite une
importante flore, présentée principalement par Dactylis glomerata, Daucus carota maritima
et Lavatera cretica.
Conservation
Ile de Tazrout
Il est localisée à 20 km à l’est de la ville de Jijel non loin des plages de la région de Sidi
Abdelaziz. Elle est connue sous le nom de l’île des Moules. Il s’agit d’un îlot rocheux assez
plat, séparé du rivage d’une vingtaine de mètres. Sa superficie ne dépasse pas les 0,20 Ha
avec une altitude de 15 mètres. Son couvert végétal qui n’est pas très fournis est dominé par
des herbacés.
Figure 1 : Localisation des principaux milieux insulaires étudiés sur la côte d’Algérie
METHODOLOGIE
Trois classes de vertébrés fréquentent nos milieux insulaires ; les oiseaux, les reptiles et les
mammifères. L’inventaire de la faune vertébrée est réalisée essentiellement durant la
période printanière, sauf pour les îles de Jijel ou des sorties automnales (novembre) furent
réalisées.
Les oiseaux
Pour cette classe, il faut distinguer au niveau des îles, deux catégories, les oiseaux
coloniaux et les oiseaux non coloniaux. Les méthodes d’inventaires et de dénombrement
différent pour chaque catégorie.
Les oiseaux coloniaux : Pour notre cas, ils sont représentés essentiellement par les
populations de Goélands leucophées, Larus michahellis. Pour cette espèce les
dénombrements ont été réalisés entre le mois de mars et le mois de mai à raison d’une a
trois sorties par mois. Les visites sur sites et les méthodes de recensement dépendaient
étroitement de l’accessibilité des colonies et de l’état de la mer. Pour les colonies difficiles
d’accès le nombre de couveurs a été estimé à partir d’une embarcation à l’aide d’une paire
de jumelles. Pour les autres colonies, plus faciles d’accès, nous avons effectué entre avril et
mai un comptage individuel des nids en les marquant au premier passage afin d’éviter de les
recompter aux passages suivants.
Les oiseaux non coloniaux : il s’agit en général de passereaux ou des espèces apparentées à
ce groupe. Les oiseaux sont observés directement dans leurs milieux naturels à l'aide d'une
paire de jumelle et d'un appareil photo numérique. L‘acquisition de connaissances sur la
communauté d’oiseaux des zones d’études a consisté à réaliser l’inventaire qualitatif des
espèces lors de la migration en automne et pendant la période de reproduction. Les relevés
Conservation
printaniers des espèces qui fréquentent les zones d’études ont été effectuées selon une
approche similaire à celle des méthodes par transect qui consiste à noter toutes les espèces
vues ou entendues le long d’un tracé linéaire couvert par l’observateur. Il faut noter qu’en
automne et en hiver, les individus de plusieurs espèces ne sont que de passage au cours de
leur migration et les oiseaux ne présentent pas tous la stabilité spatio-temporelle requise
pour les techniques de dénombrement usuelles.
Les reptiles et les mammifères
Diverses techniques ont été mises à profit pour répertorier les mammifères et les reptiles et
les travaux ont consisté à la fouille des habitats propices et à la recherche visuelle
d’individus des diverses espèces. Ces techniques visent à déterminer la présence des
espèces dans le territoire et à récolter des informations sur les habitats employés. Les
données recueillies sont principalement de nature qualitative bien qu’il soit possible
d’évaluer l’abondance relative des espèces (BERILL et al., 1992). Les reptiles étant très
difficiles à capturer en absence de pièges appropriés, nous nous sommes contentés de les
observer à l'œil nu avec quelques prises de photographies, quelques espèces de reptiles ont
été capturées par des pièges trappes installés pour les insectes. Les renseignements
recueillis auprès des pécheurs (enquête) ont été d'une très grande utilité pour notre travail.
La recherche de traces de présence est aussi utilisée, à l’exemple, des empreintes, des
ossements, des restes de repas, des excréments…etc., notamment pour les mammifères.
Les résultats et leurs interprétation seront donner pour les catégories faunique suivantes ; les
oiseaux, les reptiles et les mammifères. Les amphibiens étant absents sur les îles étudiées.
Les oiseaux
Quinze (15) espèces d’oiseaux nichent plus au moins régulièrement sur les dix sites
prospectés (Tab.1). Seule le Goéland leucophée, Larus michahellis se reproduit sur toutes
les îles avec des effectifs variables. Les colonies les plus importantes sont notées sur l’île
Rachgoun (GHERMAOUI et al., 2013) , sur l’île Grand Cavallo à Jijel (BOUGAHAM et
MOULAÏ , 2013) et sur l’île des Pisans à Béjaia (MOULAÏ et al., 2006). Le Martinet pâle,
Apus pallidus est aussi bien représenté, il est présent dans 90 % des sites. Il est absent sur
l’île Tazrout prés de Jijel. Cette espèce dépend étroitement de la présence de falaises et de
cavités pour se reproduire. D’autres oiseaux sont plus au moins bien représentés dans nos
îles, à l’exemple de la Fauvette mélanocéphale, Sylvia melanocephala (70 %) et du Pigeon
biset, Columba livia (60%). La première espèce est liée aux zones de matorrals tandis que la
deuxième affectionne les zones rocheuses et les falaises (Tab.1). Certaines espèces ayant
des exigences particulières ou sont considérées comme des espèces pionnières, ne niche que
dans seul un site à la fois. Il s’agit du Faucon pelerin, Falco peregrinus qu’on ne retrouve
que sur l’îlot de Sahel à Béjaia, du Rossignol philoméle, Luscinia megarynchos et du
Pinson des arbres, Fringilla coelebs sur l’île Grand Cavallo, du Cisticole des jonc, Cisticola
juncidis sur l’île Petit Cavallo, du Canard colvert, Anas platyrynchos sur l’île de Tazrout.
L’Aigrette garzette, Egretta garzetta, le Héron garde-bœuf, Bubulcus ibis et le Puffin
cendrée, Calonectris diomedea, le Faucon éleonore, Falco eleonorae, le Monticole bleue,
Monticola solitarius n’ont été observés que sur la plus grande île prospectée, l’île Rachgoun
en Oranie.
Du point de vue diversité aviaire par site. L’île Rachgoun est la plus riche, avec 9 espèces
nicheuses, suivi des îles Grand Cavallo et de Petit Cavallo, avec 6 espèces pour chacun des
sites (Tab.1). Certains îlots ne comportent que deux espèces nicheuses (île de Tazrout, île
Conservation
d’Aguéli et l’îlot Grand Cavallo). Ce sont des milieux rocheux, assez accidentés,
comportant peu de végétation et de surcroît de faible superficie. Ces sites paraissent assez
défavorables pour l’installation d’une avifaune nicheuse diversifiée. Le nombre d’oiseaux
nicheurs dépend largement de la superficie de l’île, de la présence des sites de nidification
favorable, du degré d’éloignement du continent et de la nature des niches écologiques
présentes (végétation, ressources trophiques, refuges, falaises, points d’eau...). Mais aussi
de l’intensité des perturbations qu’elle soit d’origine anthropiques (dérangements,
destruction des nichées…) ou naturels (importance des colonies de Goélands par ex.). En
perspective, il serait intéressant d’estimé l’abondance des oiseaux non coloniaux
(passereaux et groupes apparentés), d’étudié la biologie et l’écologie de certaines espèces en
comparaison avec leurs congénères du continent. L’écologie trophique et la biologie de
reproduction du Héron garde-bœufs et de l’Aigrette garzette de l’île Rachgoun, serait
intéressant à entreprendre pour ses espèces pionnières.
Tableau 1 : Oiseaux nicheurs de quelques milieux insulaires d’Algérie
Sites
île de
Tazrout
île Petit
Cavallo
île
Grand
Cavallo
îlot
Grand
Cavallo
Ilot
de
Sahel
Ile
des
Pisans
île
d’El
Euch
île de
Tigzirt
Ile
d’Aguéli
île
Rachg
oun
2
6
6
2
4
5
5
4
2
9
Oiseaux nich.
Larus
michahellis
Calonectris
diomedea
Falco
perregrinus
Falco
eleonorae
Bubulcus ibis
Egretta
garzetta
Anas
platyrhynchos
Columba livia
Apus pallidus
Sylvia
melanocephala
Fringilla
coelebs
Cisticola
juncidis
Monticola
solitarius
Turdus merula
Luscinia
megarhynchos
Total : 11
Les Reptiles et les mammifères
Six espèces (06) de reptiles sont observées sur les milieux insulaires prospectés (Tab.2). Ils
appartiennent tous au sous ordre des Sauriens, aucun Ophidien n’est observé. Il est aussi
intéressant de noter qu’aucune espèce d’amphibien n'a été répertoriée. L’absence de ce
groupe est classique, à l’image de ce qu’il en est sur la plupart des petites îles
méditerranéennes. La taille souvent réduite des îles et le climat ne permet souvent pas la
présence de points d’eau nécessaires à la reproduction des amphibiens (PEYRE, 2007 ;
LANZA et VANNI, 1990). L'inventaire effectué par PEYRE (2007) sur les îles Habibas, a
révélé l'existence de 6 espèces de reptiles à savoir, Chalcides ocellatus, Hemidactylus
Conservation
turcisus, Tarentola maritanica, Scelarcis perspicillata, Trogonophis weigmanni et
Macroptodon abubakeri. Sur nos îles seuls, deux espèces sont bien représentées, il s’agit de
la Tarente de Mauritanie, Tarentola mauretanica (70 % des sites) et le Psamodrome
d’Algérie, Psammodromus algirus (60 %) (Tab.2). Les deux espèces affectionnent tous les
types de milieux comportant un élément minéral (falaises, pentes arides avec rochers,
murets) (ROUAG et BENYACOUB, 2006).
Il est à noter que le lézard hispanique, Podarcis vaucheri et Trogonophis weigmanni, n’ont
été observé que sur un seul site à la fois. Sur l’île Grand Cavallo pour le premier et sur l’île
d’Aguéli pour la deuxième espèce. L’île Grand Cavallo, semble être la plus diversifiée en
espèces de reptiles (5 espèces) suivi des îles d’El Euch, des Pisans et de Petit Cavallo, avec
3 espèces pour chacun des sites (Tab.2). Le déterminisme de la richesse en espèces de
Sauriens et le même que celui noté pour les oiseaux, notamment en terme de superficie et
de présence d’habitats favorables. L’île Grand Cavallo est la plus grande île prospectée (6
hectares) (à part bien-sur, l’île Rachgoun ou aucune donnée sur les reptiles n’a été
répertoriée). Ajoutant à cela que la densité des reptiles dans leur milieux dépend d'une part,
de la richesse spécifique de la communauté liée au nombre de niches écologiques
disponibles et d'autres part, à la disponibilité des places d'exposition solaires, indispensables
à la thermorégulation et dépend étroitement du recouvrement de la végétation au niveau du
sol. L'absence de prédateurs redoutables tel que les chats, la diversité des habitas et
l'abondance des ressources alimentaires semble contrôler la diversité et l’abondance des
reptiles (CHEYLAN et GRILLET, 2005).
Tableau 2 : Reptiles de quelques milieux insulaires d’Algérie
Sites
île de
Tazrout
île Petit
Cavallo
île
Grand
Cavallo
îlot
Grand
Cavallo
Ilot
de
Sahel
Ile des
Pisans
île
d’El
Euch
île de
Tigzirt
Ile
d’Aguéli
-
3
5
-
1
3
3
2
1
Reptilia
Tarentola
mauretanica
Psammodromus
algirus
Podarcis
muralis
Podarcis
vaucheri
Chalcides
ocellatus
Trogonophis
weigmanni
Total : 06
Une seule espèce de mammifères est noté sur la totalité des milieux insulaires, il s’agit du
Rat noir, Rattus rattus (Tab.3). Ce mammifère peut être favorisé par le développement de la
végétation nitrophile et l’augmentation de la biomasse végétale, qui sont causés en grande
partie par les populationsde Goélands leucophées (CHEYLAN, 1985).
Tab. 3 – Mammifères de quelques milieux insulaires d’Algérie
Sites
Mamalia
île de
Tazrout
île Petit
Cavallo
île
Grand
Cavallo
îlot
Grand
Cavallo
Ilot
de
Sahel
Ile des
Pisans
île
d’El
Euch
île de
Tigzirt
Ile
d’Aguéli
île
Rachgoun
Rattus
norvegicus
Total : 01
1
1
1
1
1
1
1
1
1
1
Conservation
REFERENCES
[1] Aissat L., 2010 - Evaluation et caractérisation de la faune des milieux insulaires de la région de Jijel.
Memo. Magister en Analyse de l’Environnement et Biodiversité, Univ. Béjaia, 133 p.
[2] Atkinson, I. A. E., 1985 - The spread of commensal species of Rattus rattus to oceanic Islands and their
effects on islands avifauna. In P.J. Moors (eds). Conservation on Islands birds: case studies for the
management of threatened island species. ICBP Tech. Pub., 3: 35-81.
[3] Berill, M., Bertman, S., Brigham, D et Campbell, V., 1992 - A comparaison of three methods monotring
frog populations .Ed. Bishop et K.E. Petit, Ohawa, 76p.
[4] Bonnet, V., Vidal, E., Medail, F. et Tatoni, T., 1999 - Analyse diachronique des changements floristiques
sur un archipel Méditerranéen périurbain (Iles du Frioul, Marseille). Rev. Ecol. (Terre et Vie), 54 : 318.
[5] Bougaham A., 2008 - Contribution à l’étude de la biologie et de l’écologie des oiseaux de la côte à l’ouest
de Jijel. Memo. Magister en Biologie de la Conservation et Ecodéveloppement, Univ. Béjaia, 103 p.
[6] Bougaham A. F. et Moulaï R., 2013 - Observations sur quelques espèces d’oiseaux de la côte à l’ouest de
Jijel (Algérie). Go-South Bull. (2013), 10 : 76-85
[7] Boukhalfa, D., 1990 - Observations de quelques espèces d’oiseaux de mer nicheurs sur la côte d’Oran
(Algérie). Rev. l’oiseau et RFO, 3 : 248-251.
[8] Chapuis, J. L ., Vernon, P. et Frenot, Y., 1989- Fragilité des peuplements insulaires : exemple des îles
Kerguélene, archipel subantarctique. Actes des journées del’Environnement du C.N.R.S., réaction des
êtres vivants aux changements de l’environnement. C.N.R.S : 235-248.
[9] Cheyaln, G., 1985 - Les adaptations écologiques de Rattus rattus à la survie dans les îlots méditerranéens
(Provence et Corse). Bulletin Écologie, 19 : 417-426.
[10] Cheylan, M. et Grillet, P., 2005 - Statut passé et actuel du lézard Ocellé (Lacerta lepida, Sauriens,
Lacertides) en France : implication en terme de conservation. Vie et Milieu, 55 :15-30.
[11] Dajoz, R. , 1985 -Précis d’écologie. Ed. Dunod, Paris, 505p.
[12] Ghermaoui M., Abdellaoui K. et Moulaï R., 2013 - Première observation d’une nidification mixte du
Héron garde-bœuf, Ardea ibis et de l’Aigrette garzette, Egretta garzetta en milieu insulaire sur l’île
de Rachgoun en Algérie. Alauda 81 (3) : 71-72
[13] Höner, D. et Greuter, W., 1988 - Plant population dynamics and species turnover on small islands near
Karpathos (South Aegean, Greece). Vegetatio 77 : 129-137.
[14] Jacob, J.P. et Courbet, B. , 1980 -Oiseaux de mer nicheurs sur la côte en Algérie. Le Gerfaut 70 : 385 401.
[15] Lanza, B. et Vanni, S. (1990). Notes on the biogeogray of the mediterranean island. Ecologia
mediterranea, 8 : 253-272.
[16] Moulaï, R., 2005 - Contribution à l'évaluation de la diversité biologique des îlots de la côte occidentale de
Béjaia (Algérie). Actes du 1er Séminaire International sur l'environnement et ses problèmes connexes,
Univ. Bejaia, 5-7 Juin 2005.
[17] Moulaï, R., 2006 - Bioécologie de l'avifaune terrestre et marine du Parc National du Gouraya (Bejaia),
cas particulier du Goéland leucophée Larus michahellis Naumann, 1840. Thèse Doctorat d'état,
Sci.agro.Inst.nat.agro.,El Harrach,185p.
[18] Moulai, R ., Sadoul,N . et Doumandji, S., 2006 - Effectifs et biologie de la reproduction du Goéland
leucophée Larus michahellis dans la région de Bejaïa (Algérie). Alauda 74 (2) :225-234.
[19] Peyere, O., 2007 - Diversité des iles d'habitats. Reserve naturelle des iles Habibas. Notes naturalistes
Petites îles méditerranéennes. PIM, Conservatoire des espaces littoraux et des rivages lacustres.
France. 28-42.
[20] Rouag, R. et Benyacoub, S., 2006 - Inventaire et écologie des reptiles du Parc National d'Elkala
(Algérie). Bull. Soc. Herp., 117 :25-40.
[21] Vidal, E., 1998 - Organisation des phytocénoses en milieu insulaire méditerranéen perturbé. Analyse des
inters relations entre les colonies de Goélands leucophées et la végétation des îles de Marseille.
Thèse doctorat, Biologie des populations et écosystèmes – Aix- Marseille III : 243 p.
Reproductive Dynamics as a Management Tool for the Spotted Grunter Pomadasys
Reproductive Dynamics as a Management Tool for the Spotted Grunter
Pomadasys commersonnii (Lacepède, 1801) from the Arabian
Sea off Oman
1
2
F. R. Al-Kiyumi1; Sahar F. Mehanna2*; Badria Al-Siyabi1
Marine Sciences and Fisheries Centre, P.O. Box 421, Muscat, Oman
National Institute of Oceanography and Fisheries, P.O. Box 182, Suez, Egypt
*Author for correspondence (email: [email protected])
SUMMARY
The principal objective of this work is to gain an understanding of the reproductive dynamics of spotted
grunter Pomadasys commersonnii, in the Arabian Sea off Oman. Consequently, it provides information that
will assist in the design of a management plan to promote sustainability of this important fishery species. Its
maturity, spawning season, length and age at first sexual maturity and sex ratio were studied based on the
data collected during five bottom surveys in the Oman waters of Arabian Sea during September 2007 to
September 2008. The monthly gonado-somatic indices and macroscopically investigated maturity stages
indicated that P. commersonnii spawns more than once a year with a peak spawning activity during
September to November. The overall sex ratio throughout the study period was not significantly different from
1:1, while the size at 50% sexual maturity (L50) was 59.1 and 60.9 cm FL for males and females respectively.
It was found that about 33% of P. commersonnii were caught before reaching their first sexual maturity. So,
the study recommends reduction of fishing pressure especially during the spawning season and reevaluated
the mesh sizes of trawl nets used in Oman waters as well as identify the nursery ground and protect them
through implementing MPA.
Keywords: Pomadasys commersonnii, Arabian Sea, sex ratio, spawning season, length at first sexual
maturity, management.
INTRODUCTION
Knowledge of reproductive biology of a fish species is essential for effective fishery
management. The quantity and quality of reproductive output play a key role in
understanding the population dynamics and life-history characteristics of exploited fish
stocks (Hilborn & Walters, 1992; Marshall et al., 2003). Key parameters required for stock
assessments are estimated including sex ratio, reproductive season, and size at maturity
(Sun et al., 2009). The diversity of the Haemulidae family allows their large distribution
throughout the world and covers the Atlantic, Indian and Pacific oceans (Bauchot and
Hureau, 1990). Members of this family are commonly referred to as grunt (Bauchot &
Hureau, 1990). They are common from 20 to 50 m depth on hard bottoms, mainly coralian
reefs (Chateau & Wantiez, 2005) and over sand (Fisher et al., 1987). The grunts, family
Haemulidae, consists of 18 genera (133 species), including the population of the small
spotted grunter Pomadasys commersonnii (Lacepède, 1801). Spotted grunter, P.
commersonnii (Pisces: Haemulidae) is found in inshore coastal regions and estuaries of the
Western Indian Ocean (Smith & Heemstra, 2003). In southern Africa, it is most common
along the east coast with occasional fish recorded as far west as False Bay during the
summer months (Day et al., 1981; Heemstra & Heemstra, 2004). They attain a maximum
size of 87 cm TL and age of approximately 15 years (Wallace & Schleyer, 1979). This
species can produce a jet of water to clear away mud to reveal benthic invertebrates upon
which it feeds. Some species of grunter, including the spotted grunter, are able to make a
grunting sound by grinding the strong jaws in their throat together, hence their common
name. The small spotted grunter is common in the Oman waters especially in the Arabian
Sea contributing 6% of the total demersal catch from Oman waters of Arabian Sea. This
species is exploited mainly by trawls and is highly appreciated by the Oman people because
of its high quality flesh and is one of the commercially important fish in Oman. Despite its
importance, little is known about it. The present study aimed to supply basic information
about the reproductive biology of this species in Oman waters of Arabian Sea in relation to
sex ratio, size at first maturity and spawning season. This information on reproductive
characteristics may be useful for improving the estimation of biologically sound reference
points for managing the small spotted grunter fishery in Oman waters.
Sampling
Samples of small spotted grunter, P. commersonnii were collected during the survey of the
Arabian Sea sector of Oman between September 2007 and September 2008. Five seasonal
trawl surveys of demersal fish with an average duration of 47 days per survey were
conducted by the RV"Al Mustaqila 1” on the continental shelf of Oman in the Arabian Sea
between Ras al Hadd in the north and Yemen border in the south (Fig. 1). The bottom trawl
was used to collect demersal fish on the continental shelf in the 20–250 m depth range.
Trawl station positions were selected randomly with a minimum distance of 2.0 nautical
miles in-between. Trawl survey tows were carried out during daylight hours only with a
towing speed was of 3.5 knots. A total of 7803 specimens have been collected during five
surveys which covered 12 months from which 3020 males, 3063 females and 1720 unsexed
were used in this study. The fork length (FL, to the nearest mm) and total weight (W, to the
nearest 0.01 g) were measured for each individual. Sex, maturity stage and gonad weight
(GW, to the nearest 0.001 g) were recorded for each specimen.
Figure 1: Oman coast of the Arabian Sea showing the surveyed area
Sex ratio
The sex-ratios, determined by month and by size classes, were statistically tested for
significant deviations from the expected 1:1 ratio with a χ ² test (Dagnélie, 1975).
Maturity stages
The gonadal maturity was defined according to their macroscopic aspect and development
(Pajuelo et al., 2003a). Five stages were distinguished:
I.
Immature: gonads are thread–like and thin, testes are whitish and opaque, while
ovaries are pinkish and translucent.
II.
Maturing and recovering: gonads become larger and occupying one third to half of
the body cavity. Ova are minute and visible with slight yolk.
III.
Mature: gonads occupy about two-thirds of the length of the body cavity. In ovary,
the eggs become larger, yellow and easily extruded with pressure. Testes have pure
white color and their walls become thin.
IV.
Ripe: gonads occupy the entire body cavity. Testes are white milt run from the vent
of males and eggs from females on pressure from their abdomen.
V.
Spent: gonads are flaccid. Ovary has dark red color and few residual eggs are
visible. The testes have gray brown color and there may be a little residual milt.
Gonado-somatic index (GSI)
It was determined from the equation: GSI = Wg * 100/ Wt, where Wg is the gonad weight
in gram and Wt is the total observed weight in gram.
Spawning season
The spawning period was determined from the gonadosomatic index (GSI) according to
Anderson and Gutreuter (1983) and by computing the proportions of fish at each maturity
stage.
Length at first sexual maturity (L50)
Length at maturity was modeled by using a 2-parameter logistic ogive of the form:
PL = 1/1+e - (L - L50%) / δ
Where PL is the percentage of fish mature at length L, L50 is the length at first sexual
maturity and δ is the steepness of the ogive. The ogive was fitted by minimizing the
negative log-likelihood.
Condition factor
During the reproductive cycle, physiological condition and fish stoutness were determined
monthly from the condition factor (Le Cren, 1951).
Sex ratio
The studies on sex ratio provides information on the proportion of male to female fish in a
population, it also indicates the dominance of sex in s given population and the basic
information necessary for fish reproduction and stock size assessment (Vicentini & Araujo,
2003). A total of sexed 6083 specimens of small spotted grunter (3020 males and 3063
females) were used to determine the monthly variation in sex ratio. The proportions of
males and females in different months were given in Fig. (2). Overall males to females’
ratio was 1: 1.01. This ratio did not differ significantly from 1:1 ratio. During November,
February and June males to females’ ratio was 1:0.85, 1:1.46 and 1:1.61, respectively.
Those ratios were statistically differing from 1 to 1 expected ratio at 95% confidence level
(Table 1). Percent and ratio between males and females among successive length class
intervals were graphically represented in Fig. (3). The ratio among successive length strata
showed a great fluctuation. Males were dominant in small lengths while females were
dominant in large sizes, also females were outnumbered males in most length classes.
Males outnumbered females in few length groups (45 cm and from 53 to 61 cm).
700
Male
Female
600
Number
500
400
300
200
100
0
Month
Figure 2: Sex ratio by month for Pomadasys commersonnii in the Arabian Sea off Oman
700
Male
Female
600
Frequency
500
400
300
200
100
0
333537394143454749515355575961636567697173757779
Fork length
Figure 3: Sex ratio by length group for Pomadasys commersonnii in the Arabian Sea off Oman
Table 1: Monthly variations of sex-ratio of Pomadasys commersonnii in the Arabian Sea off
Oman (ns: not significant)
Month
Sep
Oct
Nov
Dec
Jan
Feb
Mar
Apr
May
Jun
Jul
Aug
Sep
Male
136
57
486
231
35
171
97
214
532
240
-578
243
Female
130
54
412
200
28
250
87
218
529
386
-531
242
Chi
square
0.135
0.081
6.098
2.229
0.777
14.82
0.543
0.037
0.008
34.05
-1.99
0.963
P
Significant
0.713
0.775
0.013
0.135
0.378
0.0001
0.460
0.847
0.927
5.368E-09
-0.158
0.963
ns
ns
s
ns
ns
s
ns
ns
ns
s
-ns
ns
Reproductive cycle
Macroscopically, the different stages of gonadal development were easily distinguished for
both sexes. GSI is an alternative method to determine sexual maturity or reproductive
activity (Wang et al., 2003). The GSI variations for males and females present a prolonged
spawning period for the small spotted grunter (Fig. 4). From September, the GSI values
(GSI = 3.55 for males and 3.34 for females) decreased for both sexes and reached its
minimum in March (GSI = 0.44 for males and 0.80 for females), then re-increased from
April towards the next September. These periods correspond to the maturation of the
gonads. The fluctuation of the GSI values indicated that this species has a long spawning
season extends from June to November and the spawning may occurred twice per year as
the eggs in the mature ovaries have different sizes. The main spawning season is during
August to November for both sexes. These results were confirmed by the similar trend of
the maturity stages expressed in frequency throughout the year (Fig. 5). Our findings are in
agreement with the previous ones for the same species (Al-Nahdi et al., 2010). Protracted
spawning has also been described for P. Kaakan, P. olivaceus and P. incisus and appears to
be a feature of the biology of Pomadasys species (Joubert, 1981; Lee et al., 1992; AlHusaini et al., 2002; Pajuelo et al., 2003b).
4
3.5
Male
Female
3
GSI
2.5
2
1.5
1
0.5
0
Sep Oct Nov Dec Jan Feb Mar Apr May Jun Jul Aug Sep
Month
Figure 4: Monthly gonado-somatic index of Pomadasys commersonnii in the Arabian Sea off Oman
0
IV
F=242
0
II
III
IV
F=515
50
0
II
III
IV
% frequency
F=182
50
0
100
II
III
IV
F=249
50
0
II
III
% frequency
I
IV
0
I
II
III
IV
100
V
M=314
Nov
F=309
50
0
100
II
III
IV
V
M=35
Jan
F=28
50
0
100
II
III
IV
Sep
V
M=122
F=115
50
0
V
100
V
F=48
I
M=169
IV
50
V
Mar
III
M=49
I
M=209
Dec
II
Oct
V
100
I
100
V
M=525
May
I
% frequency
I
M=236
50
100
0
V
Sep
I
% frequency
III
F=417
% frequency
100
II
M=468
Aug
50
% frequency
% frequency
I
% frequency
% frequency
50
100
% frequency
M=177
F=177
Apr
% frequency
100
I
II
III
IV
V
M=117
Jun
F=180
50
0
I
II
III
IV
V
Figure 5: Monthly distribution of maturity stages for Pomadasys commersonnii in the Arabian Sea off
Oman
Condition factor Kn
The monthly Kn value was higher in males than in females during September, October and
January (Fig. 6) indicating that the males were slightly in better condition than females in
these months, but in the rest of months females show a better condition than males. The K n
values fluctuated from month to month recording high values during the months of high
percentages of mature individuals (from June to September). In contrast to the findings of
Al-Nahdi et al. (2010), the relative condition factor in the present study shows a high
correlation with the spawning months.
Kn
1.08
1.06
1.04
1.02
1
0.98
0.96
0.94
0.92
0.9
0.88
Male
Sep Oct Nov Dec Jan Feb Mar Apr May Jun Jul Aug Sep
Months
Figure 6: Monthly relative condition factor of Pomadasys commersonnii in the Arabian Sea off Oman
Length at first sexual maturity L50
From the logistic curve (Fig. 7), it was obvious that the length at first sexual maturity was
59.1 and 60.9 cm FL for males and females, respectively. Completely matured fishes (100%
mature) occurred at 67 and 69 cm FL for males and females respectively. These values are
higher than those reported in Al-Nahdi et al. (2010). They gave L50 for the same species at
44.2 cm for males and 42 cm for females. Differences between the results may be attributed
to the differences in length range. In their sample, length of males ranged between 20 and
75 cm, while length of females ranged between 20 and 79 cm.
It is evident that a considerable proportion (33 %) of P. commersonnii catch didn’t reach the
first sexual maturity and sampled fish were smaller than 13 cm total length. On the other
hand, in term of weight or biomass, fishes smaller than size at first sexual maturity
represented about 25.04 % of the total catch.
Figure 6: Monthly relative condition factor of Pomadasys commersonnii in the Arabian Sea off Oman
In conclusion, Pomadasys commersonnii in the Arabian Sea off Oman is a demersal species
exploited mainly by trawls. Its spawning period occurs between June and December and
sexual maturity is reached at 59.1 and 60.9 cm FL. Up to 33% of the catch are under sized
and not reach their maturation. So, the study recommends reduction of fishing pressure
especially during the spawning season and re-evaluated the mesh sizes of trawl nets used in
Oman waters as well as identify the nursery ground and protect them through implementing
MPA. Also, a detailed study on this species should be done using a representative random
sample from the commercial catch as the samples used in this study considered as selective
ones. In addition, a detailed study concerned gear selectivity of trawl should be done to find
the proper mesh size which guarantees the contribution of a considerable part of the stock
of P. commersonnii during the spawning season.
REFERENCES
Al-Husaini M., Al-baz A., Al-Ayoub S., Safar S., Al-wazan Z. and Al-jazzaf S., 2002. Age, Growth, Mortlity
and Yield per recruit for nagoor, Pomadasys kaakan, in the Kuwait water. Fisheries Research., 59:
101-115.
Al-Nahdi, Al-Marzouqi A., Jayaabalan N and Al-Habsi S., 2010. Maturation and spotting of the small spotted
grunt, Pomadasys commersonnii (lacepede, 1801) in the Arabian Sea off Oman. Thalassas. 27: 6779.
Anderson R.O. and Gutreuter S.J., 1983. Length, weight and associated structural indices. In: L.A. Nielson &
D.L. Johnson (Editors). Fisheries Techniques, Am. Fish. Soc. Bethesda; 283-300.
Bauchot M.L. and Hureau J.C., 1990. Sparidae, in: chek-list of the fishes of the Eastern Tropical Atlantic.
Clofeta II. In: J.C. Quero, J.C. Hureau, C. Karrer, A. Post & L. Saldanha (Editors). UNESCO Paris,
pp. 790-812.
Chateau J. and Wantiez L., 2005. Comparaison de la structure des communautés de poisons coralliens
d’intérêt commercial entre une réserve marine et deux zones non protégées dans le Parc du lagon sud
de Nouvelle-Calédonie (Comparison of coral reef fish communities between two fished and one
protected reefs in New Caledonia South Lagoon Marine Park). Cybium, 29(2): 159-174.
Dagnelie P., 1975. Theorie et methodes statistiques. 2: les methodes de l’inference statistique (Theory and
statistical methods. 2: Statistical inference methods). Les presses agronomiques de Gembloux, 451
pp.
Day J.H., Blaber S.J.M. and Wallace J.H., 1981. Estuarine Fishes. In Estuarine Ecology with particular
Reference to Southern Africa. pp. 197-221. Cape Town, A.A Balkema.
Fisher W., Schneider M. and Bauchot M.L., 1987. Mediterranee et mer Noire. Zone de peche 37, revision 2.
Fiches FAO d’Identification des Especes pour les Besoins de la Peche (Mediterranean and Black Sea.
Fishing area 37, rev. 2. FAO fiches of species identification for fisheries needs). Vol. II, Vertebres.
Rome, FAO, 1473 pp.
Heemstra P. and Heemstra E., 2004. Coastal fishes of southern Africa. National Inquiry Service Centre
(NISC) and South African Institute for Aquatic Biodiversity (SAIAB), Grahamstown, South Africa.
488 pp.
Joubert C.S.W., 1981. Aspects of the biology of five species of inshore reef fishes on the Natal Coast, South
Africa. Invest. Rep. Oceanogr. Res. Inst., 51: 1-16.
Le Cren E.D. 1951. The length - weight relationship and seasonal cycle in gonad weight and condition in
perch (Perca fluviatilis). J. Anim. Ecol., 20: 201-219.
Lee,J.U., M. Samuel, F.Y. Al-yamani and P.S. Joseph. 1992. Fin Fisheries management Project. Phase IV.
Final Report No 3484. Kuwait Institute for scientific Research, Kuwit.
Marshall C. T., O’Brien L., Tomkiewicz J., Marteinsdottir G., Morgan M. J., Saborido-Rey F., Koster F. W.,
Blanchard J. L., Secor D. H., Graus G., Wright P. J., Mukhina N. V. and Bjornsson H., 2003.
Developing alternative indices of reproductive potential for use in fisheries management: case studies
for stocks spanning an information gradient. Journal of Northwest Atlantic Fisheries Science 33:161–
190.
Pajuelo J.G., Lorenzo J.M. and Gregoire M., 2003a. Age and growth of the Bastard grunt (Pomadasys incisus:
Haemulidae) inhabiting the Canarian Archipelago, Northwest Africa. Fish. Bull., 101: 851-859.
Pajuelo J.G., Lorenzo J.M., Gregoire M. and Dominguez-Seoane R., 2003b. Life of Pomadasys incisus
(Osteichthyens: Haemulidae) in the Canarian Archipelago. Sci. Mar., 67(2): 241-248.
Smith M.M. and Heemstra P.C., 2003. Smiths’ Sea Fishes. p.569. Struik Publishers, Cape Town, South
Africa.
Sun C., Chang Y., Tszeng C., Yeh S. and Su N., 2009. Reproductive biology of blue marlin (Makaira
nigricans) in the western Pacific Ocean.Fish.Bull.107: 420-432.
Vicentini R.N. and Araujo F.G., 2003. Sex ratio and size structure of Micropogonias furneiri (Desmaarest,
1823) Perciformes, Sciaenidae) in Sepetiba bay, Rio de Janeiro, Brazil. Braz. J. Biol. 3: 559-566.
Wallace J.H. and Schleyer M.H., 1979. Age determination in two important species of South African angling
fishes, the kob (Argyrosomous hololepidotus Lacep.) and the spotted grunter (Pomadasys
commersonnii Lacep.). Transactions of the Royal Society of South Africa 44: 15-26.
Wang S.P., Sun C.L. and Yeh S.Z., 2003. Sex ratios and sexual maturity of swordfish (Xiphias gladius L.) in
the waters of Taiwan. Zooll. Stud. 42(4): 529-539.
Reproductive Parameters of the Common Stingray Dasyatis pastinaca from the Gulf
of Gabès (Central Mediterranean Sea)
Reproductive parameters of the common stingray Dasyatis pastinaca from
the Gulf of Gabès (central Mediterranean Sea)
1
Saadaoui A1. Saidi B1. Bradai M. N1.
National Institute of Marine Sciences and Technologies, Sfax, Tunisia.
[email protected] /[email protected]
SUMMARY
The biological features of the common stingray, Dasyatis pastinaca, were studied in the Gulf of Gabès
(central Mediterranean Sea). In total, 333 specimens (184 females, 149 males) of Dasyatis pastinaca were
collected between June 2011 and April 2014. Sexual maturity was assessed following Stehmann method. Disc
width (DW) - body mass relationships were compared by sex. The size at which 50% of individuals were
mature (DW50) was estimated for each sex. Males ranged from 14.2 to 47 cm DW while females from 12.7 to
66 cm DW. The smallest mature male measured 33.5 cm DW and the largest immature one was 36 cm DW.
The smallest mature female measured 39 cm DW and the largest immature one was 44 cm DW. The DW at
which 50% of the population reached maturity was estimated to be 34.3cm and 40.4 cm for males and
females, respectively. No significant differences were found in Disc width-body mass relationships by sex.
Keywords: Dasyatis pastinaca, maturity, Gulf of Gabès, Central Mediterranean Sea
INTRODUCTION
The common stingray Dasyatis pastinaca is a shallow waters demersal batoid fish over
sandy and muddy bottoms. It is common along Tunisian coasts, mainly in the Gulf of Gabès
where it forms an important component of bycatch in several gears, such as bottom trawl,
gillnets and longline [1]. Information on reproductive biology of D. pastinaca is scarce in
Mediterranean Sea [2], [3], [4], [5]. For this, we undertake the study of the reproductive
biology of D. pastinaca in the Gulf of Gabès and we estimate in this paper the size at
maturity of this species in the area.
Samples of Dasyatis pastinaca were collected off the Gulf of Gabès (Central Mediterranean
Sea), between June 2011 and April 2014. For each individual, sex, disc width (DW) to
nearest 1 mm and total body mass (in nearest g) were recorded. The DW and M T
relationships were analysed and compared by sex with the Student’s t-test [6]. Sex ratios
were compared to the 1:1 proportion using the chi-square (χ2) test. The assignment of
maturity stage was performed using macroscopic evaluations of the reproductive system: in
females, the size of the ovarian eggs, the condition of the oviducts, the nidamental gland,
and the presence of egg-cases; in males the consistency of the claspers, the development of
sperm ducts and gonads [7]. The percentage of mature individuals in 1 cm intervals was
calculated for both sexes. A logistic ogive was fitted to the data in order to estimate the size
at which 50% of individuals were sexually mature.
RESULTS
A total of 333 specimens were collected, consisting of 184 females (55.26%) and 149 males
(44.74%), which was not significantly different from a 1:1 sex ratio (χ 2 test, P > 0.05).
Females DW ranged from 12.7 to 66 cm (77.11- 12500 g) and males DW from 14.5 to 47
cm (103.2-4150 g). Overall, the mean DW for female (43.44 cm) was higher than males
(35.51 cm). The DW and MT relationships by sex mostly overlapped and no significant
differences were found (Student’s t-test) (Fig1).
Figure1: Dasyatis pastinaca. Relationship between total mass (M T) and Disc width (DW).
The curves were fitted by males: y=0.0245 x 3.1209 (R2=0.923) and females: y = 0.022 x 3.1403 (R2=0.9851).
The smallest mature female measured 39 cm DW and the largest immature one was 44 cm
DW. All females greater than 44.5 cm DW were determined to be mature. The smallest
mature male measured 33.5 cm DW and the largest immature one was 36 cm DW. All
males greater than 39 cm DW were classified as mature. The DW at which 50% of the
population reached maturity was estimated to be 34.3 cm and 40.4 cm for males and
females, respectively (Fig 2).
Figure 2: Dasyatis pastinaca. Relationship between maturity status and disc width for males and females
DISCUSSION
The size distribution of D. pastinaca in the present study corresponds with ranges reported
by Ismen, Yeldan et al and Yigin et al ([3], [4] and [5]). The ranges of females were higher
than that of males. The DW and MT relationship refers to overall sample because no
significant differences were found by sex.
The reproductive variables of D. pastinaca in different regions are illustrated in Table 1.
Table1: Sizes at sexual maturity and maximal sizes of Dasyatis pastinaca in deferent regions
Size at maturity (cm)
Males
Females
62.5 *
45*
49*
32
42
Maximal size (cm)
Area
Authors
-
North Aegean Sea, Saros Bay
Yigin & al [5]
-
Northeastern
Mediterranean
Yeldan & al [4]
Males
Females
Gulf of Gabès
-
69
Ennajar & al [11]
Iskenderun bay
22
32
24
38
34
-
51
-
Ismen [3]
Senegal, Atlantique
Tunisian coasts
Capapé [10]
*LT
Female D. pastinaca mature at a larger size than those of males. Similar results were
reported for this species by other authors [3], [4] and [5]. The same result was found for the
other Dasyatis species [8], [9], and [10]. In this study, D. pastinaca has a greater size at
maturity than reported by Ennajar et al and Ismen ([11], [3]). Possible explanations for
these differences in the sizes at maturity of this species include geographic variation,
hydrographic characteristics of the area and the methodology adopted.
REFERENCES
[1] Bradaï, M. N., Saidï, B., Enajjar, S and Bouaïn, A. (2006). The Gulf of Gabès: A spot for the
Mediterranean Elasmobranchs. Workshop on Mediterranean cartilaginous fishes with emphasis on
southern and eastern Mediterranean, 14-16 October 2006, Ataköy-Marina, Istanbul/Turkey.
[2] Capapé, C., 1976. Contribution a la biologie des Dasyatidae des cotes tunisiennes. I. Dasyatis pastinaca
(Linnaeus, 1758): répartition géographique et bathymétrique, sexualité, reproduction, fécondité. Ann.
Mus. Civ. Sto. nat. Giocomo Doria, Genova 81, 22–32.
[3] Ismen, A. 2003. Age, growth, reproduction and food of common stingray (Dasyatis pastinaca L., 1758) in
Iskenderun Bay, the eastern Mediterranean. Fisheries Research 60 (2003) 169–176.
[4] Yeldan, H., Avsar, D., Manasırlı, M. 2009. Age, growth and feeding of the common stingray (Dasyatis
pastinaca, L., 1758) in the Cilician coastal basin, northeastern Mediterranean Sea. Journal of Applied
Ichthyology 25(Suppl 1):98_102.
[5] Yigin, C.C. and Ismen, A. 2012. Age, growth and reproduction of the common stingray, Dasyatis
pastinaca from the North Aegean Sea. Marine Biology Research, 2012; 8: 644_653.
[6] Zar, J. H. (1984). Biostatistical Analysis. Englewood Cliffs, NJ: Prentice-Hall.
[7] Stehmann, M. 2002. Proposal of a maturity stage scale for oviparous and viviparous cartilaginous fishes
(Pisces, Chondrichthyes). Arch. Fish. Mar. Res., 50: 23-48.
[8] Smith et al. 2007. Maturity and growth characteristics of a commercially exploited stingray, Dasyatis
dipterura. Marine and Freshwater Research, 2007, 58, 54–66.
[9] Yokota, L. et al. 2007. Reproductive biology of three ray species: Gymnura micrura ( Bloch & Schneider,
1801), Dasyatis guttata ( Bloch & Schneider, 1801) and Dasyatis marianae Gmes, Rosa & Gadig,
2000, caught by artisanal fisheries in Northeastern Brasil. Cah. Biol. Mar. (2007) 48: 249-257.
[10] Capapé, C., Diop, M., N’dao, M., Ben Brahim, R., 1996. Observations biologiques comparées entre
quelques espèces de sélaciens des cotes Tunisiennes (Méditerranée centrale) et de la région de Dakarouakam (Sénégal, Atlantique oriental tropical). Ichtyophysiologica Acta 19, 179–199.
[11] Enajjar, S., Bradai, M.N. and Bouain, A. 2003. Données préliminaire sur la reproduction de la pastenague
commune Dasyatis pastinaca (Linnaeus, 1785) du golfe de Gabès. Bull. Inst.natn. Scien. Techn. Mer,
Salammbô, 8: 26 – 30.
THEME 2: Environmental Impacts: Coastal Hazards
Use of Hematological and Biochemical Parameters and Histological Changes to Assess
the Toxicity of Drumstick Tree (M. oleifera) seeds extract on Tilapia (O. niloticus) Fish
Use of hematological and biochemical parameters and histological
changes to assess the toxicity of drumstick tree (Moringa oleifera) seeds
extract on Tilapia (Oreochromis niloticus) fish
1
Hossam H. Abbas1 and Ashraf A. El-Badawi2
Department of Hydrobiology, Veterinary research Division, National research Centre, Egypt
2
Ecology Department, Central Lab. For Aquaculture Research, ARC, Egypt
SUMMARY
Nowadays Moringa oleifera (M. oleifera), family Moringaceae, is considered an important food source for
human in many parts of the world, and as antiviral, antibacterial, sex reversal in tilapia fish and
immunostimulant agent in fishes. This study was conducted to investigate the effect of acute and chronic
exposure of Moringa oleifera seeds extract on some hematological, biochemical variables and
histopathological changes of tilapia fish species Oreochromis niloticus. The 96 h LC50 value of M. oleifera
seeds extract to the studied fish was 138 mg/L. For acute study, the same concentration of 96 h LC 50 (138
mg/L) was used while for chronic exposure, 1/10 of 96 h LC50 value (13.8 mg/L) was taken. At the end of acute
and chronic exposure, hematological parameters like red blood cell count (RBCs), hemoglobin (Hb),
hematocrit (Hct), and mean corpuscular hemoglobin concentration (MCHC) were significantly (P<0.05)
decreased in fish exposed to seeds extract. However a significant (P<0.05) increase in white blood cell count
(WBCs), mean corpuscular volume (MCV) and mean corpuscular hemoglobin (MCH) values were observed in
the exposed fish during above treatment period when compared to that of the control groups. Biochemical
parameters such as glucose showed a significant decrease in acute exposure while increased significantly in
chronic exposure (P<0.05). The obtained results showed a significant decrease in total protein and plasma
cholesterol levels in fish exposed to acute and chronic concentrations of seeds extract while a significant
(P<0.05) increase in aspartate aminotransferase (AST), alanine aminotransferase (ALT), creatinine, uric acid
and alkaline phosphatase (ALP) activity was observed. Chemical muscle composition in fishes exposed to
chronic exposure showed a significant increase in muscle water content and ash content while showing a
significant decrease in muscle total lipids and total protein. The studied growth indices showed a significant
decrease in body weight gain (BWG), specific growth rate (SGR) and hepatosomatic index (HSI).
Histopathlogical sections showed pathological changing in gills, liver, kidney and spleen and the obtained
results were discussed. This study could provide valuable information about the toxicity of M. oleifera seeds
extract to Oreochromis niloticus. especially with the wide spread of using in the field of aquaculture and to
establish safer limit in water purification.
Key words: Moringa oleifera, Oreochromis niloticus, hematology, biochemical parameters, histopathology,
growth
INTRODUCTION
The role of aquaculture in food production, economic development and food security is now
well recognized. As the fastest growing food production sector, aquaculture holds promise
to help provide a growing human population with food as many of the world’s capture
fisheries have reached their biological limits of production or have been depleted through
over-fishing and habitat degradation (FAO, 2004). Less well recognized is aquaculture’s
role in conservation and the recovery of threatened and endangered species. In fact,
aquaculture has often been implicated in contributing to the endangerment of aquatic
biodiversity. The aquaculture sector has made significant advances in increased production
and environmental protection. However, the sector is now being criticized for degrading the
aquatic habitat through release of effluents that include uneaten food, waste products, and
pharmaceuticals, and through the escape of farmed fish. There is potential to improve the
production, efficiency and environmental sustainability of the sector and the effective
management of aquatic genetic resources can assist in addressing all of the above issues
(Ferreira et al. 2007). Moringa oleifera and Carica papaya are bioactive phytochemical
plants, rich with saponine (Ayotunde and Ofem, 2008) and nowadays aquaculturists are
using many types of extractions from these plants (seeds, leaves and pods) in sex reversal of
tilapia fish with different concentrations to avoid using of 17 α-Methyletestosterone
hormone (Oluduro and Aderiye, 2009; Abbas and Abbas, 2011). Such botanical products
when used extensively may enter aquatic systems such as streams, river, and lakes, which
may have an effect on non-target organisms in a due course of time (Dongameza et al.,
2006; Tiwari and Singh, 2006; Winkaler et al., 2007; Gabriel et al., 2009).
Moringa oleifera is the most widely cultivated species of the genus Moringa, which is the
only genus in the family Moringaceae. In developing countries, Moringa has potential to
improve nutrition, boost food security, foster rural development, and support sustainable
landcare. Many parts of the Moringa are edible. Regional uses of the Moringa as food vary
widely, and include the immature seed pods, called "drumsticks", popular in Asia and
Africa, leaves, particularly in the Cambodia, Philippines, South India, Sri Lanka and Africa,
mature seeds and oil pressed from the mature seeds (Murakami et al. 2007). Moringa has
numerous applications in cooking throughout its regional distribution. It may be preserved
by canning and exported. Moringa is undergoing preliminary research to investigate the
potential properties of its nutrients and phytochemicals, some of which include antibacterial
effects in vitro, improved glucose tolerance in a rat model of diabetes, inhibition of EpsteinBarr virus activity in vitro and reduction of skin papillomas in mice. Moringa seed powder
is being assessed for its potential to make river water potable. Research showed that
filtering with seed powder may diminish water pollution and bacterial counts (Afuang et al.,
2003; Ayotunde et al., 2011a &b; Compaore et al., 2011 and Melesse et al., 2013) where
the powder joins with the solids in the water and sinks to the bottom and this treatment also
removes 90-99% of bacteria contained in water. Using Moringa to purify water replaces
chemicals such as aluminum sulphate, which are dangerous to people and the environment,
and are expensive (Muyibi and Evison, 1995; Fahey, 2005).
Moringa has been used in folk medicine, including Siddha medicine and Ayurvedic
traditional medicines and in the Philippines. In Ayurvedic traditional medicine, the leaves
are believed to affect blood pressure and glucose levels. In Africa, Indonesia and
Philippines Moringa leaves are given to nursing mothers in the belief that they increase
lactation (Peixoto et al. 2011). Also, it is also used to reduce swelling, increase sex drive (as
an aphrodisiac), prevent pregnancy, boost the immune system, and some people use it as a
nutritional supplement or tonic. Moringa is sometimes applied directly to the skin as a
germ-killer or drying agent (astringent). It is also used topically for treating pockets of
infection (abscesses), athlete’s foot, dandruff, gum disease (gingivitis), snakebites, warts,
and wounds (HDRA, 2003). Moringa also is used for “tired blood” (anemia); arthritis and
other joint pain (rheumatism); asthma; cancer; constipation; diabetes; diarrhea; epilepsy;
stomach pain; stomach and intestinal ulcers; intestinal spasms; headache; heart problems;
high blood pressure; kidney stones; fluid retention; thyroid disorders; and bacterial, fungal,
viral, and parasitic infections (Rao et al., 1990; Ferreira, 2004).
All of the parts of the tree can be used in a variety of ways. It provides lots of leafy material
that is useful when using as human food, animal food, fertilizers, natural pesticides,
domestic cleaning agent, fuel wood and other uses (HDRA, 2003; Astuti et al., 2007).
The seeds of Moringa are often referred to as peas and can be used from the time they
appear until they turn yellow and their shells begin to harden. The seeds contain 35% oil
and this is used for cooking purposes. The oil does not turn rancid and also burns without
smoke. Oil from Moringa seeds is used in foods, perfume, and hair care products, and as a
machine lubricant (Richter et al., 2003). The seeds are roasted, pounded, mixed with
coconut oil and used for their antibiotic and anti-inflammatory properties to treat arthritis,
rheumatism, gout, cramp, sexually transmitted diseases and boils. Roasted seeds and oil can
encourage urination and can also be used as a relaxant for epilepsy (Carceres et al. 1992).
Biological monitoring techniques like hematological, biochemical variables and histological
changes have become attractive and useful for monitoring environmental quality, water
pollution and the health condition of aquatic organisms (Olufayo, 2009). The entry of
toxicants into aquatic media may affect the water quality parameter which in turn leads to
changes in the hematological variables of fish, due to its close association with the external
environment (Carvalho and Fernandes, 2006 and Kavitha et al., 2010). Biochemical
biomarkers like glucose, protein, creatinine, uric acid and enzymes are frequently used as
bioindicators of the general state of health and early warning of stress in fish under stressful
conditions (Abou El-Naga et al., 2005; Osman et al., 2010).
Extraction of M. oleifera
The seeds of M. oleifera were collected from the plant protection area, agriculture Research
Centre, Dokki, Giza, Egypt, and seed powder was prepared according to the method
described by Price (2000). Seed powder (25 g) was soaked in 250 ml of distilled water for
15 h. Then, the suspension was shaken thoroughly and filtered through Whatman filter
paper No. 1 to collect crude extract (stock solution).
Determination of LC 50
The lethal concentration (LC50) of M. oleifera was obtained by exposing Oreochromis
niloticus
to different concentrations of Moringa in static system. The concentration
response relationship (LC50) was determined according to the method of Litchfield and
Wilcoxon (1949).
Animals and experimental design
Healthy fishes of Oreocromis niloticus (35.2±4.8 g) were collected from Hager Abo-Daghar
Farm, Luxor governorate, Egypt and stocked and acclimated in glass aquaria. During the
period of acclimatization the fish were fed by 25% protein pelleted diet twice daily. The
feeding was withheld for one week before starting the experiment to keep the experimental
animals more or less in the same metabolic state. Aeration was provided throughout the
study. Physicochemical parameters of studied water are measured according to APHA
(1998) and presented in Table (1). The physicochemical parameters of tested water were
maintained throughout the study period. Before the start of the experiment, suitable
numbers of fish were transferred into glass aquaria which were continuously aerated.
Two separated experiments were conducted. For acute toxicity test, ten aquaria
(80X60X50cm) were prepared and each aquarium filled with 200 L of water. The
concentration of M. oleifera seed extract (138.0 mg/L) was added after removal of same
quantity of water to five aquaria. Then 10 fish were introduced into each aquarium.
Simultaneously a control setup without the addition of extract was also maintained in the
other five aquaria. After 96 h, the live fish from treatment and control groups were
sacrificed for growth indices, chemical muscle composition and the hematological,
biochemical assay and histopathological changes.
For chronic toxicity test, a total of 100 fingerlings from the stock were introduced into the
same size glass aquaria 200 L (80X60X50 cm) capacity with dechlorinated water. The
sublethal concentration (1/10 of LC50 which was 13.8 mg/L) of M. oleifera seed extract was
added to the aquaria after removal of same quantity of water. A control group was
maintained in other separated glass aquaria. Chronic exposure was carried out for a period
of 42 days (6 weeks) and sampled at the end of exposure.
Sampling
Fish were randomly selected from control and experimental aquaria and blood samples
were withdrawn from the arteria caudalis using a syringe containing sodium citrate as an
anticoagulant. The whole blood was used for hematological assay. Total number of
erythrocytes (RBCs) and leukocytes (WBCs) were counted using improved Neubauer
Haemocytometer. Hemoglobin (Hb) content was estimated using cyanmethemoglobin
method described by Van Kampen and Zijlstra (1961). Hematocrit (Hct) was carried out in
small capillary hematocrit tubes using microhaematocrit centrifuge at 3000 rpm for 15
minutes. Blood indices namely Mean corpuscular volume (MCV), Mean corpuscular
hemoglobin (MCH) and Mean corpuscular hemoglobin concentration (MCHC) were
calculated according to Gupta (1977). The blood was then centrifuged for 15 min at 3000
rpm to separate plasma which was used for the estimation of glucose, total protein, alanine
aminotransferase (ALT), aspartate aminotransferase (AST) and alkaline phosphatase (ALP)
activities, creatinine, uric acid and cholesterol.
Growth indices in chronic exposure
Body weights were recorded to the nearest gram and total body lengths were measured to
the nearest 0.l cm to adjust the artificial feed rate every two weeks (Initial weights ranged
from 3o-40 g for all the experimental studies at the beginning of the experiment. Then the
following growth indices were determined:
Body weight gain [BWG (g)] = (Final body weight)-(initial body weight).
Specific growth rate [SGR]: Specific growth rate (growth rate/day) was determined
as a percentage of body weight gain/day according to the equation postulated by Allen and
Wooton (1982):
Ln Wf - ln W0
S.G.R. = ---------------------x100
Tf – T0
Where: Wf: The final weight of fish in g., W0: The initial weight of fish in g.
(Tf - To): Time between the final and initial weight in days.
Ln : Logarithm to base e.
Condition factor (k): k factor was calculated for individual fish from the formula
recommended by Schreck and Moyle (1990):
W
K= ------------x100
L3
Where: W: is the wet weight in g and L: is the total length in cm.
Hepatosomatic index (HSI) = (Liver weight (g)/Body weight (g)) x 100
Biochemical analyses
A- Plasma analyses
Blood samples were centrifuged at 3000 rpm to get plasma for the following analyses:
a. The level of plasma glucose was measured using Boehringer Mannheim kits
according to Trinder (1969).
b. Total protein content was determined by Biuret test (King and Wootton, 1959).
c. Plasma aspartate aminotransferase (AST, E.N. 2.6.1.1) and alanine aminotransferase
(ALT, E.N. 2.6.1.2) activities were determined colorimetrically using transaminases
kits according to the method described by Reitman and Frankel (1957).
d. Creatinine was measured using colorimetric method described by Henry (1974).
e. Uric acid content was measured using the enzymatic reaction adopted by Barham
and Trinder (1972).
f. Plasma alkaline phosphatase activity was determined according to the method
described in Bergemyer (1974).
g. Plasma cholesterol was measured colorimetrically according to Watson (1960).
B- Muscle quality: Muscle quality was determined using the following parameters
a. Muscle water content was determined according to Sidwell et al. (1970).
b. Muscle total protein was determined using the semi-microkjeldahl method as
reported by Josyln (1950)
c. Muscle total lipids were determined by the standard method reported in AOAC
(1970).
d. Muscle ash was determined by burning samples in a muffle furnace for 16 hours at
550°C (Sidwell et al., 1970)
Histological studies
Tissue specimens from gills, liver, kidneys and spleen were taken from tilapias that were
exposed to M. oleifera by the end of chronic exposure. The specimens were fixed in 10%
formalin. They were processed by conventional method, sectioned at 5 µm and stained with
Hematoxylin and Eosin (Bancroft et al., 1996).
Statistical analysis
The results were statistically analyzed using Duncan's multiple range tests to determine
difference in means using Statistical Analyses System (SAS, 2000) and Software Program
of Statistical Analysis (SPSS, 2008). One way ANOVA test (Analysis of variance)
comparing the treated and untreated control groups in all months. Differences in all the
studied parameters were assessed by one way ANOVA.
RESULTS
Water quality characteristics of water used in the experiment are presented in Table (1) and
all data of the examined parameters were within the permissible levels of growing fishes
(Boyd, 1990). Investigations of blood indices have been suggested to be a valuable tool in
assessing the health condition of Oreochromis niloticus (Ates et al., 2008). The effect of
acute and chronic exposure of M. oleifera seed extract on hematological parameters of
Oreochromis niloticus was presented in table (2). Hematological examination showed a
significant (P<0.05) decrease in Hb, Hct, RBCs, and MCHC values in fish treated with M.
oleifera seed extract. In contrast there was a significant increase in WBCs, MCV and MCH
value when compared with their control groups (P<0.05) at the end of the experimental
periods in both exposures. The acute exposure of M. oleifera seed extract on biochemical
parameters of Oreochromis niloticus, showed a significant decrease (P<0.05) in plasma
glucose, total protein and cholesterol level while showed a significant increase (P<0.05) in
plasma creatinine and uric acid values and AST, ALT and ALP activities at the end of
exposure time when compared to control. In the chronic toxicity of M. oleifera seed extract
on biochemical parameters of Oreochromis niloticus (Table 3), the plasma glucose,
creatinine, uric acid, AST, ALT and ALP levels showed a significant increase (P<0.05) in
seed extract treated fish at the end of the experimental period while there was a significant
decrease (P<0.05) in plasma protein and cholesterol level. Concerning the chemical muscle
composition, there were significant changes in water content, total protein, total lipids and
ash composition in fish exposed to chronic exposure of M. oleifera seed extract (13.8 mg L1
) at the end of the experiment (42 days) compared to control value and (Table 4). A
significant increase occurred in the water content and ash of muscle; whereas total protein
and total lipids were significantly decreased compared with the control group. Regarding
the effect of M. oleifera seed extract (13.8 mg L-1) on tilapia fish in the chronic exposure
(42 days), the obtained results showed a decrease in body weight gain; specific growth rate,
hepatosomatic index (HIS) and condition factor (K) compared to the control values (Table
5).
Histopathological investigations
The above biochemical investigations were confirmed by the histological sections. The
histological alterations found in the gill, liver, kidney and spleen tissues of O. niloticus fish
are detailed in Figures (1-2). In the present study, the histopathological examination showed
marked deterioration in the gill, liver, kidney and spleen of fishes exposed to chronic
exposure of M. oleifera than in the controls. Control gill tissue is shown in Figure (1A). The
microscopic examination of gill sections revealed that there was hyperplasia and lamellar
fusion between the secondary lamellae which leading to decrease or blocking the
interlamellar spaces Figure (1B), congestion in the lamellar and branchial blood vessels also
detected. Degenerative changes in the form of vacuolar degeneration and necrosis also
detected in the epithelial lining the secondary lamellae Figure (1C).
Control liver tissue is shown in Figure (1D) and regarding the histopathological changes in
the liver of fishes exposed to chronic exposure of M. oleifera revealed slight degenerative
changes in some of the hepatocytes such as cloudy swelling where the heptatocytes were
slightly smaller and elongated, with finely granular easinophilic cytoplasm and apparently
normal nuclei Figure (1E & 1F).
Control kidney tissue is shown in Figure (2G) and the main pathological changes in the
kidney of examined cases were degenerative changes and necrosis were not restricted to
convoluted tubules but extended to involve the collecting tubules where the tubular
epithelium showed hydropic degeneration and necrosis. Also the interstitial haemopaeitic
renal tissue showed marked necrosis and infiltration of heterophils in the necrotic areas of
renal parenchyma Figure (1H & 1I). Control spleen tissue is shown in Figure (2J) and the
spleen of treated fish showed necrosis and depletion of lymphocytic elements associated
with increase the number and extension of melanomacrophage centers Figure (1K). Also
haemosiderin has been observed to increase considerably within melanomacropahge centers
Figure (1L).
Table 1: Physicochemical characteristics of water used in the experiment
Parameters
pH
Temperature
Dissolved Oxygen
Alkalinity (CaCO3)
Total Hardness (CaCO3)
Ammonia (NH3)
Ammonium (NH4+)
Nitrite (NO2-)
Nitrate (NO3-)
Total soluble salts
Mean
6.7
27 oC
5.6 mg L-1
145.8 mg L-1
128.7 mg L-1
0.3 mg L-1
0.6 mg L-1
0.0 mg L-1
0.8 mg L-1
264 mg L-1
Parameters
Bicarbonate (HCO3-)
Carbonate (CO3-)
Sulphate (SO4-)
Chloride(Cl-1)
Calcium (Ca++)
Magnesium (Mg++)
Potassium (K+)
Sodium (Na+)
Mean
118.7 mg L-1
0.02 mg L-1
86.3 mg L-1
14.9 mg L-1
29.6 mg L-1
6.4 mg L-1
4.9 mg L-1
35. 3 mg L-1
Electric conductivity
0.2 Mmohs cm-1
Table 2: Acute and chronic effect of M. oleifera seeds extract on some hematological
parameters of Tilapia fish (Oreochromis niloticus)
Acute (138 mg/L)
Control
Treated
1.27±0.12 a
1.07±0.11 b
a
25.12±1.18
34.17±1.88 b
a
7.14±0.27
6.01±0.19 b
a
20.88±1.16
15.37±0.94 b
a
11.22±1.6
13.87±1.13 b
a
38.21±2.71
41.71±2.35 b
a
29.84±2.29
27.95±1.89 b
Parameters
RBCS (X 106 mm-3)
WBCS (X 103 mm-3)
Hb (g/dl)
HCT (%)
MCV (fl)
MCH (pg)
MCHC (g/dl)
Chronic (13.8 mg/L)
Control
Treated
1.27±0.12 a
1.34±0.08 b
a
25.12±1.18
31.37±2.03 b
a
7.14±0.27
6.95±0.41 b
a
20.88±1.16
17.84±1.03 b
a
11.22±1.6
14.06±1.11 b
a
38.21±2.71
44.16±3.12 b
a
29.84±2.29
25.23±2.14 b
Table 3: Acute and chronic effect of M. oleifera seeds extract on some biochemical parameters
of Tilapia fish (Oreochromis niloticus).
Parameters
Glucose (mg/100ml)
Total Protein (µg/ml)
Creatinine
(mg/100ml)
Uric acid
(mg/100 ml)
Aspartate
aminotransferase (IU/L)
Alanine
aminotransferase (IU/L)
Alkaline phsphatase
(IU/L)
Plasma Cholestrol
(mg/dl)
Acute (138 mg/L)
Control
Treated
102.16±6.14 a
88.24±5.52 b
a
3.79±0.63
2.46±0.43 b
Chronic (13.8 mg/L)
Control
Treated
102.16±6.14 a
167.44±6.33 b
a
3.79±0.63
1.91±0.28 b
1.053±0.17 a
1.839±0.33 b
1.053±0.17 a
1.372±0.29 b
18.39±1.92 a
23.55±2.o6 b
18.39±1.92 a
21.93±1.88 b
29.12±3.15 a
38.17±4.22 b
29.12±3.15 a
34.87±2.94 b
20.71±2.09 a
33.95±3.11 b
20.71±2.09 a
28.77±2.66 b
17.34±1.96 a
28.66±2.26 b
17.34±1.96 a
23.05±1.77 b
179.61±8.67 a
139.27±7.44 b
179.61±8.67 a
153.12±14.45 b
Table 4: Chronic effect of M. oleifera seeds extract on chemical muscle composition of Tilapia
fish (Oreochromis niloticus)
Parameters
Water content (%)
Crude protein (% of dry weight)
Total Lipids (% of dry weight)
Ash (% of dry weight)
Chemical muscle composition
(13.8 mg/L of M. oleifera)
Control
Treated
74.78±1.2a
76.3±1.3b
a
14.6±0.79
13.3±0.91b
a
5.21±0.38
4.87±0.22b
a
5.64±0.36
5.92±0.31b
Table (5): Chronic effect of M. oleifera seeds extract on some growth indices of
Tilapia fish (Oreochromis niloticus)
Parameter
Initial body weight (g)
Final body weight (g)
Body weight gain (g)
Specific growth rate (g/day)
Hepatosomatic index
Condition factor (K)
Control
35.2±4.8
48.8±3.4
13.6±4.2
2.6±0.4
1.8±0.3
1.1±0.05
Treated
36.3±4.2
45.9±3.9
9.6±4.1
1.97±0.3
1.4±0.4
0.86±0.07
Figure 1: Photomicrographs of transverse sections of gill and liver tissue of O.niloticus (H&E x 400 )
A = Control gill tissue; B = Gill showing hyperplasia and lamellar fusion between the secondary lamellae;
C = Gill showing and degeneration changes and necrosis in the epithelial lining the secondary lamellae
associated with congestion; D = Control liver tissue; E = Liver showing thinner vascular walls, congestion as
well as early fibrosis; F = Liver showing slight degenerative changes in some of the hepatocytes.
Figure 2: Photomicrographs of transverse sections of kidney and spleen tissue of O.niloticus
(H&E x 400 )
G = Control kidney tissue; H = Kidney showing diffuse tubular vascular degeneration and nicrosis;
I = Kidney showing degenerative changes and necrosis in the tubular epithelium and the interstitial
haemopaeitic tissue associated with infiltration of heterophils in the necrotic areas of renal parenchyma;
J = Control spleen tissue; K = Spleen showing showed necrosis and depletion of lymphocytic elements
associated with increase the number of melanomacrophage centers; L = Spleen showing accumulation of
haemosiderin pigments within the melanomacropahge centers (Prusion blue stain).
DISCUSSION
In the present study, the 96 h LC50 value of M. oleifera seed extract for the freshwater fish
Oreochromis niloticus was found to be 138 mg/L which indicates that M. oleifera seed
extract is toxic to tilapia fish at higher concentrations. Kumar et al. (2010) reported that the
24, 48, 72 and 96 h LC50 values of aqueous extract of Euphorbia tirucalli latex to the fish
Heteropneustes fossilis was found to be 3.450µl/L, 2.516µl/L, 1.623µl/L and 1.315µl/L
respectively. Tiwari and Singh (2003) observed the toxicity of Nerium indicum leaf extract
to the fish Channa punctatus and indicate that the toxicity depends on the solvent used for
extraction; the LC50 value of diethyl ether, acetone, chloroform and methanol extract of N.
indicum leaf extract were found to be 17.34 mg/L, 40.01 mg/L, 40.61 mg/L and 106.37
mg/L, respectively. The 24 h LC50 value of neem leaf extract for Prochilodus lineatus was
found to be 4.8 g L-1 (Winkaler et al., 2007). The differences in the LC50 value of various
parts of plant species to fish depend on the chemicals present in the plants, fish size, age,
species and also the sensitivity of the fish used for the experiment. Behavior responses of
fish were used to examine the toxic nature of pollutants in the aquatic environment. In the
present work, copious mucous secretion, loss of equilibrium, restlessness, jerky movements,
rapid opercula beat were noted especially during acute treatment. Hematological
investigations have proven valuable for fisheries biologists for quick detection of changes in
fish health and these changes may precede changes in fish behavior and visible lesions.
In general the decrease level of RBCs count, Hb and Hct may be due to the destruction of
RBCs and erythroblastosis leading to anaemia (Wintrobe, 1978). In the present study the
decreased level of RBCs count, Hb and Hct content in fish treated with seed extract might
have resulted from hemolysis caused by this extracts. Similar observations were also noted
in Clarias gariepinus exposed to leaf extracts of tobacco, Nicotiana tobaccum and cassava
effluents (Omoniyi et al., 2002; Adeyemo, 2005). In contrast Ayotunde et al. (2004) noted
an increase in RBCs count, Hb and Hct content in O. niloticus exposed to aqueous extracts
of Moringa oleifera seeds. The decrease in Hb content during stress condition may indicate
a decrease in the rate of Hb synthesis which leads to impaired oxygen supply to various
tissues resulting decrease in the number of RBCs through haemolysis (Atamanalp and
Yanik, 2003). Moreover the lysing of erythrocytes leads to a reduction in hematocrit value
(Martinez and Souza, 2002). However the increase in these parameters during sublethal
treatment indicates adaptation of the fish to the seed extract toxicity. The observed increase
in WBCs during acute and chronic exposure may be due to stimulated lymphopoiesis and/or
enhanced release of lymphocytes from lymphomyeloid tissue as a defense mechanism of
the fish to tolerate the seed extract toxicity. The increase in leucocyte count indicates the
stimulatory effect of the toxicant on immune system and also depends on the toxicant stress
(Ates et al., 2008). The MCHC is an indicator of red blood cell swelling and the lowered
MCHC during acute treatment might have resulted from release of young erythrocytes
containing less hemoglobin into circulation. Whereas the significant increase of MCHC
value during chronic exposure may be due to congenital sphaerocytosis as suggested by
Sobecka (2001). The significant increase of MCV and MCH during acute and chronic
treatment indicates the swelling of red blood cells. Further stress related increase in the
erythrocyte volume may be another reason as suggested by Jastrzebska and Protasowickiz
(2005).
Measurement of plasma biochemical parameters is mostly used in clinical diagnosis of fish
physiology to determine the general status of health (Barnhorn and van Vuren, 2004;
Ferreira et al., 2007; Osman et al., 2010). Carbohydrates are the main source of energy in
many organisms and their reserve used to meet energy demand in stress condition. The
observed increase of plasma glucose level during chronic exposure indicates a stress
response triggered by the presence of seed extract in water or might be due to hypoxic
condition caused by the seed extract in water. However the decrease in blood glucose
during acute exposure can be attributed to high utilization of glucose for oxidation or
hypoxic conditions leading to an excess utilization of stored carbohydrates (Kavitha et al.,
2012). The decreased level of protein in this study may be due to their degradation and also
to their possible utilization for metabolic purposes (Kavitha et al., 2012). Similar
observation was also made in C. punctatus exposed to latices of Euphorbia royleana and
Jatropha gossypifolia (Singh and Singh, 2002).
Plasma creatinine and uric acid could also be used as a rough index of the glomerular
filtration rate (Maita et al., 1984). Low values of creatinine and uric acid are not significant
but increased values indicated several disturbances in the kidney (Maxine and Benjamin,
1985).
In the present investigation, fish exposed to acute and chronic concentrations of M. oleifera
showed high level of creatinine and uric acid. It might be attributed to the action of some
toxic materials of M. oleifera on the glomerular filtration rate which is altered by the
pathological changes in the kidney (Ayotunde et al., 2004; Kavitha et al., 2012).
The alterations of enzyme activity under stress condition offer one of the most important
biochemical parameter and their level provide information of diagnostic values (Barnhorn
and van Vuren, 2004; Adamu, 2009). Transaminase enzymes play an important role in
carbohydrate–protein metabolism in fish and determination of transaminases (AST and
ALT) can also be used for aquatic biomonitoring (Vutukuru et al., 2007). The enzymes
ALT and AST in blood plasma indicate organ dysfunction in aquatic organisms during
stress condition (Gabriel and George, 2005). Gabriel et al. (2009) noted elevation of both
AST and ALT in different organs of catfish hybrid exposed to aqueous extracts from
Lepidagathis alopecuroides leaves and suggested that the elevation may be due to
disturbances in the Kreb’s cycle and the elevation in ALT indicates hepatic damage caused
by this plant extracts. The elevation in serum aspartate aminotransferase in Heteroclarias
exposed to tobacco leaf dust may be due to the process of either deamination or
transamination caused by the plant dust (Adamu, 2009). In the present investigation the
significant increase in plasma AST and ALT activity during acute and chronic treatment
might have resulted from disturbances in the Kreb’s cycle caused by the seed extract.
Further structural damages in liver and kidney of the fish due to seed extract toxicity may
result leakage of these enzymes into the bloodstream and cause increased activity in plasma.
Alkaline phosphatase is an important enzyme of animal metabolism, and plays important
role in the transport of metabolites across the membranes (Vorbrodt, 1995). Changes in
alkaline phosphatase activity can affect the metabolism of the fish. Increased levels of ALP
was noted by Tiwari and Singh (2003) in C. punctatus exposed to N. indicum leaf extracts
and Tiwari and Singh (2006) in C. punctatus exposed to aqueous extracts of E. tirucalli
plant. Gabriel et al. (2009) reported an increase in ALP activity in catfish exposed to
aqueous extracts from L. alopecuroides leaves and suggested that the elevation may be due
to damage in the liver and kidney of fish with increased cell membrane permeability. In the
present study the elevation of ALP activity may be due to the cellular damage caused by
seed extract or a response to overcome toxicity of seed extract (Singh and Singh, 2005).
Effect of toxicants on the cholesterol level of fishes has been reported by many authors.
Munoz et al. (1991) studied the stress responses of juvenile rainbow trout; Salmo gairdneri
exposed to sublethal concentration of copper and found rapid elevation of plasma
cholesterol for the first 15 days and then decreased at day 21. However, El-Sabbagh (1996)
recorded reduced level of cholesterol in Nile tilapia Oreochrmis niloticus after exposure to
sublethal concentration of copper sulphate for 3 weeks.
Bentick-Smith et al. (1987) mentioned that the serum total cholesterol level in the different
species of catfish ranged from 152.0 to 212.0 mg/dl. Kirubagaran and Joy (1992) reported a
significant decrease in cholesterol in catfish exposed to 0.04 mg methyl mercuric chloride/l
for 90 days. Hilmy et al. (1980c) described an increased level of serum total cholesterol in
fish exposed to mercury. Santos and Hall (1990) didn’t find any changes in the total
cholesterol level in lead exposed fish. Holcombe et al. (1976) and Kandil (1987) explained
the toxic role of the heavy metals on liver concerning the cholesterol synthesis, estrification
and excretion. Nonetheless, saponin from different plant sources could lower the plasma
cholesterol levels in a variety of animals as well as in human subjects (Matsuura, 2001).
Large mixed micelles formed by the interaction of saponins with bile acids account for their
increased excretion when saponin-rich foods are consumed (Oakenfull and Sidhu, 1990).
The resulting accelerated metabolism of cholesterol in the liver causes its serum level to go
down. In the present study, the hypocholesterolemic response of tilapia exposed to Moringa
extract could be due to the high Neutral detergent fiber (NDF) content of the Moringa seed
extract which might have played a major role in decreasing the plasma cholesterol level
(Dongmeza et al., 2006).
Quality of meat could be measured by determining its chemical composition (Table 4).
Decreased total muscle protein and total lipids of fish exposed to chronic concentration
(13.8 mg/L) of M. oleifera might be attributed to the action of Moringa that may critically
influence the growth rate and the quality of fish meat (Dongmeza et al., 2006).
The increase in muscle water content was explained by Weatherly and Gill (1987) who
reported that depletion of body constituents (protein and lipids) results in tissue hydration of
inverse dynamic relationships between protein as well as lipids and water content in the
muscles. Sakr (2001) and Tawfeek (2004) reached similar results in some freshwater fishes.
Growth in the most general sense reflects significant changes in the metabolic processes
occurring in the organism (Glubokov, 1990) and it can be made to approach an optimum in
cultured fish by manipulating temperature, light regimes, water quality and amounts and
types of nutrients offered (Weatherly and Gill, 1987). Oreochromis niloticus exposed to
chronic concentration of M. oleifera revealed a decrease in body weight gain compared to
control group (Table 5), this could be due to reduction in food consumption and/or decrease
in gross food conversion rate. Inhibition of growth was also reported by Abdelghany
(1998). The condition factor changes (Table 5) may be found to reflect fairly the changes in
body protein and lipid content (Weatherly and Gill, 1983) and consequently growth rate
(Schreck and Moyle, 1990).
Decreasing of HSI in the present study might be due to the reduced fats absorption and
consequently reduced fat retention in the whole body, particularly in the liver. The obtained
results showed a lower body lipid content. These finding is in agreement of that of
Dongmeza et al. (2006).
The values of the condition factor "k" are estimated for comparative purposes to assess the
impact of environmental alterations on fish performance (Clark and Fraser, 1983).
Therefore, the decrease in factor "k" reflects the health condition of the fish as well as their
protein and lipid contents (Weatherly and Gill, 1983).
Decreased factor "k" of fish exposed to chronic exposure of M. oleifera might be due to the
decreased efficiency of gills, liver and kidney that showed clear hemorrhage and destruction
Figures (1-2). However, control fish group exhibited normal parameters.
The above biochemical investigations were confirmed by the histological sections. The
histopathological changes in gills may be as a result of Moringa extract in water which act
as an irritant and accumulated on the gill lamellae because the gills is a site of uptake in
freshwater fishes. The obtained results were in agreement with those of Ayotunde et al.
(2011a & b).
Control gill tissue is shown in Figure (1A) and histopathological changes in the gills after
chronic exposure to M. oleifera revealed that there was hyperplasia and lamellar fusion
between the secondary lamellae Figure (1B) and degeneration changes and necrosis in the
epithelial lining the secondary lamellae associated with congestion Figure (1C), similar
findings were previously reported by Jiraungkoorskul et al. (2003) and Ayotunde (2011b).
Control liver tissue is shown in Figure (1D) and regarding the histopathological changes in
the liver of fishes exposed to chronic exposure of M. oleifera revealed thinner vascular
walls, congestion as well as early fibrosis Figure (1E) and slight degenerative changes in
some of the hepatocytes Figure (1F). This result was in agreement with the findings of
Oluduro and Aderiye (2009) and Ayotunde et al. (2011b)
Control kidney tissue is shown in Figure (2G) and the main pathological changes in the
kidney of examined cases were diffuse tubular vascular degeneration and nicrosis Figure
(2H) and degenerative changes and necrosis in the tubular epithelium and the interstitial
haemopaeitic tissue associated with infiltration of heterophils in the necrotic areas of renal
parenchyma Figure (2I). This result was in the same line with that of Oluduro and Aderiye
(2009).
The changes in kidney tissue may be attributed to the renal tissue receive large volumes of
blood flaw and serve as a major route of excretion for metabolites of various xenobiotics
which may leading to nonspecific histopathological lesions (Ayotunde et al., 2011a).
Control spleen tissue is shown in Figure (2J) and the spleen of treated fish showed necrosis
and depletion of lymphocytic elements associated with increase the number of
melanomacrophage centers Figure (2K) and accumulation of haemosiderin pigments within
the melanomacropahge centers Figure (L). This result was in agreement with the previous
findings of Ayotunde (2011a).
CONCLUSION
Even though seed extract of M. oleifera has wide applications in aquaculture operations, the
health hazard of these plant extract to aquatic organisms has not been studied in detail. The
findings of the present study indicate that seed extract of M. oleifera has significant effect
on hematological and biochemical parameters and also cause histopathological changes of
the fish. Application of M. oleifera in aquatic activities need more investigations before
widespread in its uses and for safe applied.
REFERENCES
Abbas, H.H. and Abbas, W.T. (2011): Assessment study on the use of pawpaw; Carica papaya seeds to
control Oreochromis niloticus breeding. Pakistan J. of Biol. Sci., 14(24): 1117-1123.
Abdelghany, A. E. (1998): Feed efficiency, nutrient retention and body composition of Nile tilapia,
Oreochromis niloticus L., fed diets containing L-ascorbic acid, Lascorbyl-2-sulfate or L-ascorbyl-2polyphosphate. Aquacult. Rese., 29: 503 - 510.
Abou El-Naga EH, El-Moselhy KM and Hamed MA (2005): Toxicity of cadmium and copper and their effect
on some biochemical parameters of marine fish Mugil seheli. Egyptian J. Aquat. Res., 31(2): 60–71.
Adamu KM. (2009): Sublethal effects of tobacco (Nicotiana tobaccum) leaf dust on enzymatic activities of
Heteroclarias (a hybrid of Heterobranchus bidorsalis and Clarias gariepinus). Jordan J. Biol. Sci.,
2(4):151-158.
Adeyemo OK. (2005): Haematological and histopathological effects of cassava mill effluent in Clarias
gariepinus. Afr. J. Biomed. Res., 8:179-183.
Afuang W, Siddhuraju P. and Becker K. (2003): Comparative nutritional evaluation of raw, methanol
extracted residues and methanol extracts of moringa (Moringa oleifera Lam.) leaves on growth
performance and feed utilization in Nile tilapia (Oreochromis niloticus L.). Aquacult. Res., 34:11471159.
Allen, J. R. M. and Wootton, R. J. (1982): The effect of ration and temperature on the growth of the three
spined stickleback; Gastrosteus aculeatus. J. Fish. Biol., 20: 409 - 422.
AOAC (Association of Official Agricultural Chemists) (1970): Official Methods of Analyses, Washington,
D.C.
APHA (1998): Standard methods for the examination of water and wastewater. 20 th ed. Washington, DC:
American Public Health Association.
Astuti, D.A.; K. Becker and N. Richter (2007): "Utilization of methanol extracted of Moringa and mulberry
leaves to evaluate energy and protein balance of Nile tilapia". Proceeding of the Mini Workshop
Southeast Asia Germany Alumni Network (SEAG) (Manado, Indonesia: Kassel University Press
GmbH). ISBN 3-89958-389-2.
Atamanalp M, Yanik T. (2003): Alterations in hematological parameters of rainbow trout (Oncorhynchus
mykiss) exposed to mancozeb. Turk. J. Vet Anim. Sci., 27:1213-1217.
Ates B, Orun I, Talas ZS, Durmaz G and Yilmaz I. (2008): Effects of sodium selenite on some biochemical
and hematological parameters of rainbow trout (Oncorhynchus mykiss Walbaum, 1792) exposed to
Pb2+ and Cu2+. Fish Physiol. Biochem., 34:53-59.
Ayotunde E and Ofem BO. (2008): Acute and chronic toxicity of pawpaw (Carica papaya) seed powder to
adult Nile tilapia (Oreochromis niloticus Linna 1757). Afr. J. Biotech., 7(3):22675–32274.
Ayotunde EO, Fagbenro OA, Adebayo OT and Amoo AI. (2004): Toxicity of aqueous extracts of drumstick
Moringa oleifera seeds to Nile tilapia Oreochromis niloticus, fingerlings and adults. In: Proceedings
of 6th international symposium on tilapia.
Ayotunde, E.O.; O.A. Fagbenro and O.T. Adebayo (2011b): Histological Changes in Oreochromis niloticus
(Linnaeus I779) Exposed to Aqueous Extract of Moringa oleifera Seeds Powder. Turk. J. Fish. and
Aquat. Sci., 11: 37-43.
Ayotunde, E.O.; O.A. Fagbenro and O.T. Adebayo, (2011a): Toxicity of aqueous extract of Moringa oleifera
seed powder to Nile tilapia Oreochromis niloticus (Linne I779), fingerlings. Intern. Rese. J. Agricult.
Sci. and Soil Sci., 1(4): 142-150.
Bancroft, J.D., Stevens, A. and Turner, D.R. (1996). Theory and practice of histological technique. 4th Ed.
Churchill, Livingstone and New York.
Barham, D. and Trinder, P. (1972): Enzymatic determination of uric acid. Analyst., 97: 142-145.
Barnhorn IEJ and van Vuren JHJ. (2004): The use of different enzymes in feral freshwater fish as a tool for
the assessment of water pollution in South Africa. Ecotoxicol. Environ. Safe., 59:180-185.
Bentick-Smith, J.; Beleau, M.H.; Waterstrate, P.R.; Tucker, C.S.; Stiles, F.; Bowser, P.R. and Brown, L.A.
(1987): Biochemical reference ranges for commercially reared channel catfish. Progressive Fish
Culturist., 49:108.
Bergemyer, H.U. 1974. Methods of enzymatic analysis. Academic Press, New York.
Boyd, C.E. (1990): Water Quality in Ponds for Aquaculture. Alabama Agricultural Experiment Station,
Auburn University, Alabama, USA, 482 p.
Carceres A, Saraiva A, Rizzio S, Zabala L, De Leon E and Navy F. (1992): Pharmacological properties of
Moringa oleifera. 2 Screening for antispasmodic, anti-inflammatory and diuretic activity. J.
Ethanopharmacol., 36:233-237.
Carvalho CS and Fernandes MN. (2006): Effect of temperature on copper toxicity and hematological
responses in the Neotropical fish Prochilodus scrofa at low and high pH. Aquacult., 25:109-117.
Clark, E.R. and Fraser, J.A.L. (1983): The survival and growth of six species of freshwater fish in tap water
and diluted and undiluted effluents from sewage percolating filters. J. Fish Biol., 22: 431-445.
Compaore, W.R., Nikiema, P.A., Bassole, H.I.N., Savadogo, A., Mouecoucou, J., Hounhouigan, D.J. and
Traore, S. A. (2011): Chemical composition and oxidative properties of seeds of Moringa oleifera
and pulps of Parkia biglobosa and adonsonia digitata commonly used in food fortification in
Burkina Faso. Current Rese. J. Biol. Sci., 3(1): 64-72.
Dongmeza E, Siddhuraju P, Francis G and Becker K. (2006): Effects of dehydrated methanol extracts of
moringa (Moringa oleifera Lam.) leaves and three of its fractions on growth performance and feed
nutrient assimilation in Nile tilapia (Oreochromis niloticus L.). Aquacult., 261:407-422.
El-Sabbagh, H.S. (1996): Biochemical and haematological changes in tilapia nilotica (Oreochromis niloticus)
exposed to copper. Vet. Med. J., Giza, Vol. 44(1): 23.
Fahey, J.W. (2005): "Moringa oleifera: A Review of the Medical Evidence for Its Nutritional, Therapeutic,
and Prophylactic Properties. Part 1". Trees for Life, pp 113.
FAO (2004): Fisheries circular 886. Rev., p. 25-29.
Ferreira JG, Hawkins AJS and Bricker SB. (2007): Management of productivity, environmental effects and
profitability of shellfish aquaculture- The Farm Aquaculture Resource Management (FARM) model.
Aquacult., 264:160-174.
Ferreira PMP. (2004): Atividade Larvicida do Extrato Aquoso de Moringa oleifera Lamarck contra Aedes
aegypti Linnaeus: Identificacao Parcial e Caracterizacao Toxicologica do Principio Ativo.
Monografia de Graduacao em Ciencias Biologicas, Fortaleza. Universidade Federal do Ceara;. p. 70.
Gabriel UU and George ADI. (2005): Plasma enzymes in Clarias gariepinus exposed to chronic levels of
round up (glyphosate). Environ. Ecol., 23(2):271-276.
Gabriel UU, ObomanuFG and Edori OS. (2009): Haematology, plasma enzymes and organ indices of Clarias
gariepinus after intramuscular injection with aqueous leaves extracts of Lepidagathis alopecuroides.
Afr. J. Biochem. Res., 3(9):312-316.
Glubokov, A. I. (1990): Growth of three species of fish during early ontogeny under normal and toxic
condition. J. Voprosy Ikhtiologii., 30 (1): 137 - 143.
Gupta, P. K. (1977): Haematological Techniques. 4th ed. Syndicate, India.
HDRA (The Organic Organization), (2003): The tropical Advisory Service. Moringa oleifera A multipurpose
tree. Ryton Organic Gardens Conventry CV83LG, UK. http\\www.hdra.org.UK.
Henry, R.J. (1974): Clinical Chemistry, Principles and Techniques, 2nd ed., Harper and Row.
Hilmy, A.M.; Shabana, M.B. and Saied, M.M. (1980c): Blood chemistry levels after acute and chronic
exposure of HgCl2 in the killfish, Aphanius dispar (Rupp). Water, Air and Soil Pollution, 14: 409.
Holcombe, G.W.; Benoit, D.A.; Leonard, E.N. and Mackim, J.M. (1976): Long-term effects of lead exposure
on three generations of brook trout (Salvelinus fontinalis). J. Fish. Res. Board Canada, 33:1731.
Jastrzebska EB and Protasowickiz M. (2005): Effects of cadmium and nickel exposure on hematological
parameters of common carp, Cyprinus carpio L. Acta Ichthyol. Piscat., 35(1):29-38.
Jiraungkoorskul, W.; Upatham, E.S.; Kruatrachue, M.; Sahaphong, S.; Vichasri-Grams, S. and Pokethitiyook
P. (2003): Biochemical and histopathological effects of glyphosate herbicide on Nile tilapia
(Oreochromis niloticus). Environ. Toxicol., 18: 260-267.
Josyln, M. A. (1950): Methods in Food Analyses. Chapter 20. Academic Press, New York.
Kandil, A.E.M. (1987): Physiological studies on the grass carp, Ctenopharynogodon idella Val., under
different environmental pollutants. Ph.D. Thesis, fac. Scie, Cairo Univ., Cairo, Egypt.
Kavitha C, Malarvizhi A, Senthil Kumaran S and Ramesh M. (2010): Toxicological effects of arsenate
exposure on hematological, biochemical and liver transaminases activity in an Indian major carp,
Catla catla. Food Chem. Toxicol., 48:2848-2854.
Kavitha, C.; Ramesh, M.; Kumaran, S.S. and Lakshmi, S.A. (2012): Toxicity of Moringa oleifera seed extract
on some hematological and biochemical profiles in a freshwater fish, Cyprines carpio. Experimental
and Toxicology Pathology, 64: 681-687.
King, E.J. and Wootton, I.D.P. (1959): Determination of Total Protein. Micro-analyses in Medical
Biochemistry. Churchill, London.
Kirubagaran, R. and Joy, K.P. (1992): Toxic effects of mercury on testicular activity in the freshwater teleost,
Clarias batrachus (L.). J. Fish Biol., 41: 305.
Kumar A, Prasad MR, Mishra D, Srivastav SK and Srivastav AK. (2010): Toxicity of aqueous extract of
Euphorbia tirucalli latex on catfish, Heteropneustes fossilis. Ecotoxicol. Environ. Safe., 73(7):16711673.
Litchfield, J.T. and Wilcoxon, F. (1949): A simplified method of evaluating dose effect experiments. J.
Pharmacol. Exper. Therap. 96: 99.
Maita, M.; Shiomitsu, K. and Ikeda,Y. (1984): Health assessment by the climogram of hemochemical
constituents in cultured yellow tail. Bull. Jap. Soc. Scient., 51: 205-211.
Martinez CBR and SouzaMM. (2002): Acute effects of nitrite on ion regulation in two Neotropical fish
species. Comp. Biochem. Physiol. A, 133:151-160.
Matsuura, M. (2001): Saponins in garlic as modifiers of the risk of cardiovascular disease. J. Nutr., 131:10001005.
Maxine, M. and Benjamine, B.S. (1985): Outline of Veterinary Clinical Pathology. 3rd ed., Colorado State
University. Printed in India At Rekha printers PVT. LTD., New Delhi110020.
Melesse, A.; Yoseph G.; Kefyalew B. and Sandip B. (2013): Effect of feeding graded levels of Moringa
stenopetala leaf meal on growth performance, carcass straits and some serum biochemical parameters
of Koekoek chickens. Livestock Science, 157: 498–505.
Munoz, M.J.; Carbollo, M. and Tarazona, J.V. (1991): The effect of sublethal levels of copper and cyanide on
some biochemical parameters of rainbow trout along subacute exposition. Comp. Biochem. Physiol.
Vol. 100(3): 577.
Murakami, A.; Kitazono, Y.; Jiwajinda, S.; Koshimizu, K.; Ohigashi, H. (2007): "Niaziminin, a
Thiocarbamate from the Leaves of Moringa oleifera, Holds a Strict Structural Requirement for
Inhibition of Tumor-Promoter-Induced Epstein-Barr Virus Activation". Planta Medica, 64 (4): 319.
doi:10.1055/s-2006-957442.
Muyibi SA and Evison LM. (1995): Moringa oleifera seeds for softening hard water. Water Res., 29:10991104.
Oakenfull, D.G., Sidhu, G.S. (1990): Could saponins be a useful treatment for hypercholesterolemia? Eur. J.
Clin. Nutr., 44: 79-88.
Oluduro, A. O. and B. I. Aderiye (2009): Effect of Moringa oleifera seed extract on vital organs and tissue
enzymes activities of male albino rats. Afr. J. Microbiol. Res., 3(9): 537-540.
Olufayo MO. (2009): Hematological characteristics of Clarias gariepinus (Burchell 1822) juveniles exposed
to Derris elliptica root powder. Afr. J. Food Agric. Nutr. Sci., 9(3):920-933.
Omoniyi I, Agbon AO and Sodunke SA. (2002): Effect of lethal and sublethal concentrations of tobacco
(Nicotiana tobaccum) leaf dust extract on weight and hematological changes in Clarias gariepinus
(Burch.). J. Appl. Sci. Environ. Manage., 6(2):37-41.
Osman AGM, Koutb M and Sayed AEDH. (2010): Use of hematological parameters to assess the efficiency
of quince (Cydonia oblonga Miller) leaf extract in alleviation of the effect of ultraviolet - a radiation
on African catfish Clarias gariepinus (Burchell, 1822). J. Photochem. Photobiol. B Biol., 99:1-8.
Peixoto, J. R.O.; Silva, G.C.; Costa, R.A.; De Sousa F.; Joseíres L.V.; Gustavo H.F.; Filho, A. A.F.; Dos, F.V.
and Regine, H.S.F. (2011): "In vitro antibacterial effect of aqueous and ethanolic Moringa leaf
extracts". Asian Pacific J. Trop. Med., 4 (3): 201–4. doi:10.1016/S1995-7645(11)60069-2.
PMID 21771453.
Price M.L. (2000): The Moringa Tree. Echo Technical Note [online]. Available at
http://chenetwork.org/files_pdf/Moringa.pdf.
Rao KNV, Gopalakrishnan V and Loganathan V. (1990): Anti-inflammatory activity of Moringa oleifera
Lam. Ancient Sci. Life, 18:195-198.
Reitman, S. and Frankel, S. (1957): Determination of AST & ALT. Am. J. Clin. Pathol. 28: 56-58.
Richter, N., Siddhuraju, P. and Becker, K. (2003): Evaluation of nutritional quality of moringa (Moringa
oleifera Lam.) leaves as an alternative protein source for Nile tilapia (Oreochromis niloticus L.).
Aquacult., 217: 599-611.
Sakr, S.F. (2001): Pathologic studies on vitamin C deficiency in some fresh water fish during various ages.
PhD thesis, Faculty of Vet. Med., Zagazig University, Egypt.
Santos, M.A. and Hall, A. (1990): Influence of inorganic lead on the biochemical blood composition of the eel
(Anguilla anguilla). Ecotoxicol. Environ. Saf., 20(1):7.
SAS (Statistical Analyses System) (2000): Statistical Analyses System, Version 6.2, SAS institution in
corporation. Carry, NC27513 USA.
Schreck, C.B. and Moyle, P. B. (1990): Methods of fish biology. American Fisheries Society; Bethesda,
Maryland, USA.
Sidwell, V.D., Stillings, B.R. and Knobl, G.M. (1970): The fish protein concentration. 10-Nutritional quality
and use in foods. I. Food Technol., 14(8):40-46.
Singh D and Singh A. (2002): Biochemical alteration in freshwater fish Channa punctatus due to latices of
Euphorbia royleana and Jatropha gossypifolia. Environ. Toxicol. Pharmacol., 12:129-136.
Singh D and Singh A. (2005): The toxicity of four native Indian plants: effect on AChE and acid/alkaline
phosphatase level in fish Channa marulius. Chemosphere, 60:135-140.
Sobecka E. (2001): Changes in the iron leveling the organs and tissues of wells catfish, Silurus glanis L.
caused by nickel. Acta Ichthyol. Piscat., 31(2):127-143.
SPSS (Software Program of Statistical Analysis), (2008): Software Program of Statistical Analysis, Version
17.0 Edition for Windows. SPSS Inc., Chicago, IL, USA.
Tawfeek, D.A. M. (2004): Toxicological effects of cadmium on some physiological and biochemical aspects
of Nile tilapia (Oreochromis niloticus). PhD thesis, Fac Sci., Helwan Univ., Egypt.
Tiwari S and Singh A. (2003): Control of common freshwater predatory fish, Channa punctatus, through
Nerium indicum leaf extracts. Chemosph., 53:865-875.
Tiwari S and Singh A. (2006): Biochemical stress response in freshwater fish Channa punctatus induced by
aqueous extracts of Euphorbia tirucalli plant. Chemosph., 64:36-42.
Trinder, P. (1969): Enzymatic colorimetric method of glucose. Ann. Clin. Biochem. 6:24.
Van
Kampen, E.J.
and Zijlstra, N.C. (1961): Determination of haemoglobin. Clin. Chem. Acta., 5:
719-720.
Vorbrodt A. (1995): The role of phosphatase in intracellular metabolism. Postepy. Hig. Med. Dosw., 13:200206.
Vutukuru SS, Pauleena JS, Rao JV and Anjaneyulu Y. (2007): Architectural changes in the gill morphology of
the freshwater fish, Esomus danricus as potential biomarkers of copper toxicity using automated
video tracking system. Environ. Bioindicator, 2:3-14.
Watson, D. (1960). A simple method for the determination of serum cholesterol. Clin. Chem. Acta., 5: 637.
Weatherly, A.H. and Gill, H.S. (1983): Relative growth of tissues at different somatic growth rates in rainbow
trout; Salmo gairdneri Richardson. J. Fish Biol., 22: 43 - 60.
Weatherly, A.H. and Gill, H.S. (1987): Tissues and growth. In:"The Biology of Fish Growth". St.
Elmundsbury Press, Great Britain, pp.147-173.
Winkaler EU, Santos TRM, Machado-Neto JG and Martinez CBR. (2007): Acute lethal and sublethal effects
of neem leaf extract on the Neotropical freshwater fish Prochilodus lineatus. Comp. Biochem.
Physiol. C, 145:236-244.
Wintrobe MM. (1978): Clinical haematology. London, UK: Henry Kimpton;. p. 488.
‫‪Use of Hematological and Biochemical Parameters and Histological Changes to Assess‬‬
‫‪the Toxicity of Drumstick Tree (M. oleifera) seeds extract on Tilapia (O. niloticus) Fish‬‬
‫استخدام دالئل الدم والتغيرات الهستولوجية لتقييم سميه مستخلص بذور نبات المورينجا (مورينجا اوليفيرا) على اسماك البلطى النيلى‬
‫(اريوكرومس نيلوتكس)‬
‫‪2‬‬
‫حسام حسن عباس‪,1‬اشرف احمد البدوى محمد‬
‫‪ -1‬قسم بح وث االحياء المائية‪،‬شعبة البحوث البيطرية‪،‬المركز القومى للبحوث‪،‬الجيزة‪-‬مصر‬
‫‪ -2‬قسم البيئة‪،‬المعمل المركزى لبحوث الثروة السمكية بالعباسةشرقية‪،‬مركز البحوث الزراعية‪-‬مصر‬
‫يعتبر نبات المورينجا من اهم المصادر الغذائية لالنسان فى عديد من مناطق العالم حيث انها تعتبر مضاد للفيروسات والبكتريا ومحول جنسى‬
‫السماك البلطى النيلى ومقوى للجهاز المناعى لها‪.‬‬
‫وقد ركزت هذة الدراسة على تاثير الجرعة النصف مميتة (‪ LC50 )131ppm‬وجرعة تحت مميتة ‪ )13.8ppm) 1/10 LC50‬لمستخلص بذور‬
‫نبات المورينجا على التغيرات بدالئل الدم والبيوكيميائية والهستوباثولوجية السماك البلطى النيلى‪.‬‬
‫فقد وجد فى نهاية التعرض للتركيزين انخفاض معنوى لكال من عدد كرات الدم الحمراء والهيموجلوبن والهيماتوكريت و (‪ )MCHC‬بينما وجد‬
‫ارتفاع معنوى لكال من عدد كرات الدم البيضاء و )‪(MCV‬و )‪(MCH‬بالمقارنة بالمجموعة الضابطة ( الكنترول)‪.‬‬
‫اما التغيرات البيوكيميائية فقد انخفض مستوى الجلوكوز عند التعرض للجرعة النصف مميتة بينما ارتفع عند التعرض للجرعة التحت مميتة‪.‬‬
‫ومن خالل النتائج التى تم الحصول عليها وجد انخفاض معنوى بمستوى كال من البروتين الكلى والكولسترول ببالزما الدم لالسماك المعرضة‬
‫بكلتا التر كيزين‪ ,‬بينما وجد ارتفع معنوى لمستوى كال من اسبارتات امينوتانسفيريز والكرياتنين و حمض اليورك والفوسفاتيز القلوى ببالزما‬
‫الدم لالسماك‪.‬‬
‫كما وجد بالتحليل الكيميائى لمكونات العضالت لالسماك المعرضة للجرعة التحت مميتة ارتفاع المحتوى المائى بينما لوحظ انخفاض معنوى فى‬
‫كال من محتوى البروتين والدهون الكلية بالعضالت‪.‬‬
‫كما لوحظ عند دراسة مؤشرات النمو انخفاض معنوى فى قييم كال من )‪(BWG‬ومعدل النمو )‪ (GR‬و معامل العالقة بين الكبد ووزن الجسم‬
‫)‪.(HIS‬‬
‫وبدراسة القطاعات الهستوباثولوجية لوحظ تغيرات بانسجة كال من الخياشيم والكبد والكلى والطحال‪.‬‬
‫وقد امددتنا تلك الدراسة على معلومات توضح التاثير السام لمستخلص بذور نبات المورينجا على اسماك البلطى النيلى وباالخص عند االستعمال‬
‫العشوائي والغير مسئول بحقول المزارع السمكية‪ .‬لذا يجب تقنين استعمال االضافات ذات المصادر النباتية بحرص شديد وبعد تجارب‬
‫علمية متعددة ومتخصصة‪.‬‬
‫‪International Congress on "Estuaries and Coastal Marine Protected Areas" ECPA 2014 (Izmir - Turkey) Page 220‬‬
Vulnérabilité des Ecosystèmes Littoraux et Impacts des Changements Globaux :
Les Facteurs de Dégradation des Dunes Maritimes de l’Est-Algérois
Vulnérabilité des écosystèmes littoraux et impacts des changements
globaux : les facteurs de dégradation des dunes maritimes de l’EstAlgérois
(1)
Hanifi N.1, Benchouk N. 2 et Taguemout C.3
USTHB-Faculté des Sciences Biologiques, Laboratoire de Biologie et Physiologie des Organismes, BP 32
El-Alia, Bab-Ezzouar, Algerie; [email protected] ;
2,3
Association Ecologique de Boumerdès ; [email protected]
RESUME
Cette étude entre dans le cadre de la protection et de la réhabilitation des écosystèmes littoraux dégradés et
perturbés. Les résultats d’analyses basées sur les caractéristiques floristiques et fonctionnelles font
apparaître, au niveau du littoral de Zemmouri, des dégradations considérables, d’ordre climatique et
anthropique, préjudiciables à l’équilibre naturel. Les formations dunaires et forestières risquent de régresser
et même de disparaître si la pression se maintient et s’accroît. Les communautés végétales littorales
existantes sur les dunes maritimes de l’Est-algérois n’occupent que quelques surfaces réduites. Elles
représentent une part importante de la Biodiversité. Ces communautés sont organisées selon le niveau de
stress édaphique (granulométrie, salinité, recouvrement de la végétation) ainsi que le mode et l’intensité des
perturbations majeurs (d’origine éolienne, pâturages, tourisme de masse, piétinement, et extraction de
sable…). Afin de restaurer ce milieu dégradé, il est nécessaire de procéder à la réhabilitation de ce site par
des propositions d’aménagement et des mesures conservatoires urgentes. Des programmes d’actions
complémentaires sont proposés, pour ces écosystèmes littoraux, dans le cadre d’un développement local
durable.
Mots clés : Algérie, écosystèmes littoraux, biodiversité végétale, dégradations, réhabilitation
ABSTRACT
This study is part of the protection and rehabilitation of degraded and disturbed coastal ecosystems. The
results of analyzes based on the floristic and functional characteristics show, at the coast Zemmouri
considerable damage, climatic and human-induced detrimental to the natural balance. Dune and forest
formations may regress and even disappear if the pressure continues and grows. Existing on the coastal dunes
of East Algerian coastal plant communities occupy only a few small areas. They represent an important part
of biodiversity. These communities are organized by level of edaphic stress (size, salinity, vegetation cover)
and the mode and intensity of major disturbances (wind origin, pastures, mass tourism, trampling, and
extraction of sand ...). To restore the degraded environment, it is necessary to rehabilitate the site by
development proposals and emergency protective measures. Programs of complementary actions are
proposed for these coastal ecosystems, as part of a sustainable local development.
Keywords: Algeria, coastal ecosystems, plant biodiversity, degradation, rehabilitation.
INTRODUCTION
La végétation du littoral, en Algérie, est très peu étudiée. Les travaux, assez anciens
(Zaffran, 1960 ; Nègre, 1964 ; Thomas, 1968 ; Méziani, 1984 et Sadki et al., 1991)
décrivent les aspects syntaxonomiques et phytosociologiques des principaux groupements.
Les résultats d’analyses basées sur les caractéristiques floristiques (Sadki et al., 1991 ;
Géhu & Sadki, 1994 ; Aridj & Makaoum, 2002 ) font apparaître, au niveau du littoral de
Zemmouri (wilaya de Boumerdès) des dégradations considérables, d’ordres climatique et
anthropique, préjudiciables à l’équilibre naturel. Les formations dunaires et forestières
risquent de régresser et même de disparaître si la pression se maintient et s’accroît. De plus
les sols des dunes maritimes, relativement salés, sont généralement pauvres en matière
organique (Hammouche, 2003). À cette pauvreté du milieu s’ajoute l’action néfaste des
vents violents hivernaux et des embruns marins. Tous ces facteurs sont très contraignants
pour la vie végétale. La valeur du patrimoine phytogénétique de la zone d’étude est
évidente ; les communautés végétales littorales existantes n’occupent que quelques surfaces
réduites. Elles représentent une part importante de la diversité biologique. Ce milieu dunaire
littoral constitue un écosystème gravement perturbé par les interventions irréfléchies de
l’homme :
- le défrichement et les incendies,
- le pâturage, et l’extraction de sable,
- l’urbanisation et les activités anarchiques du tourisme de masse. Cette zone est très
fréquentée et appréciée en période estivale.
L’objectif principal de cette analyse est d’approfondir la connaissance et la protection des
patrimoines floristiques naturels de cet écosystème dunaire et de mettre en évidence les
facteurs qui déterminent la répartition des communautés végétales soumises à de fortes
pressions de perturbations. Cette contribution servira de base pour tout programme de
réhabilitation, d’aménagement et de gestion intégrée des espaces côtiers (Hanifi et al.,
2004).
Caractéristiques générales de la zone d’étude
Figure 1 : Situation géographique de la zone d’étude
La zone d’étude fait partie du littoral est-algérois (Figure, 1). Elle est limitée, au Nord par la
mer Méditerranée, au Sud par la R.N. 24, à l’Ouest par le port de Zemmouri et à l’Est par
l’Oued Isser. Le relief du Sahel est relativement plat, l’altitude moyenne est de 20 m. La
végétation psammophile du littoral est de type azonal, liée essentiellement à l’édaphisme
(Sadki et al., 1991) ; aussi le climat et le bioclimat de la zone d’étude sont analysés
brièvement, sur la base de données climatique de Seltzer (1946). Le bioclimat est de type
subhumide, variante à hiver chaud. La durée de la période sèche, est estimée à l’aide de
diagrammes ombrothermiques (Bagnouls & Gaussen, 1953), elle est de 5 mois en moyenne.
La pluviosité moyenne annuelle « p » atteint 579. La moyenne des températures minimales
du mois le plus froid « m », est de 9,3 °C ; la maximale du mois le plus chaud atteint
30,8°C ; les vents sont variables.
Méthodes d’échantillonnage
Les communautés végétales des dunes littorales sont échantillonnées de manière
systématique ; des relevés phytoécologiques (42 relevés de végétation) ont été effectués
depuis le haut de plage jusqu’au maquis pré-forestier selon des transects d’une longueur
variable de 200 à 250 mètres, perpendiculairement à la mer. L’aire minimale adoptée varie
en fonction de la physionomie et la structure de la végétation (Gounot, 1969) ; elle porte sur
des surfaces homogènes de 2 à 4 m2.
Le traitement des relevés est effectué par des analyses multivariées (Benzekri, 1973).
L’analyse factorielle des correspondances (AFC) est complétée par une classification
ascendante hiérarchique (CAH) pour les relevés et pour les espèces, en utilisant le
programme « Statistica 6.0 ». Aussi, des relevés floristiques ont été effectués dans plusieurs
parcelles. Les espèces ont été identifiées grâce à la flore de Quézel et Santa (1962). La liste
de l’ensemble des espèces présentes est établie (Tableaux, 1 & 2).
Les caractéristiques mésologiques sont déterminés et concernent les facteurs édaphiques : la
salinité, la granulométrie ainsi que la présence de matière organique (Duchaufour, 1965).
Evaluation des indices de la diversité biologique
Whittaker (1972) a défini des échelles spatiales de diversité spécifique qui sont bien cernées
pour les échelles α (échelle locale, par exemple le relevé) mais, d’après Whittaker et al.
(2001), elles restent confuses à l’échelle γ, c'est-à-dire, du paysage, ou d’une région
naturelle. Dans notre cas, nous considérons la diversité γ, à l’échelle d’un écocomplexe.
On distingue alors :
 La richesse spécifique (S) qui indique le nombre d'espèces échantillonnées par
relevé de végétation (sous la ligne ou quadrats permanents ; (Daget & Poissonnet,
1971 ; Ramade, 1989).
 L’indice de diversité spécifique α : Il correspond à la moyenne estimée des
diversités spécifiques des relevés par communauté.
 L'indice de diversité de Shannon (H’) : Il permet d'apprécier le degré d'équilibre des
populations végétales et nous apporte des précisions dans l’évaluation de l’analyse
quantitative et qualitative de la végétation. Cet indice s'exprime par la formule
suivante :
(H’) = Ish = Pi . Σ log2 Pi où Pi = n i / N ; ni = nombre
d'individus par espèce ; et N = nombre total des individus.
 L’équitabilité (E) ou « eveness » : à partir de l’indice H’ se calcule l'équitabilité,
appelée aussi « régularité » définie comme étant le rapport de la diversité spécifique
réelle à la diversité maximale. E = I sh / log2N , N = Nombre total d'espèces / Dune.
 La diversité β, c'est un indice de similitude qui exprime le taux de changement des
espèces entre communautés,
 L’indice de diversité γ représente donc la diversité spécifique totale d’un
écocomplexe. C'est-à-dire, un complexe de communautés formant une mosaïque,
avec chacun, une portion du même pool taxonomique.
RESULTATS ET DISCUSSION
Les paysages littoraux et les patrimoines floristiques naturels de Zemmouri
Il est particulièrement intéressant d'aborder l'étude paysagère de ce littoral, car de délicats
problèmes d'environnement sont posés dans le cadre d'un schéma d'aménagement. En
particulier, dans les paysages forestiers littoraux, les problèmes liés à la gestion sylvicole et
à la protection de la flore et de la végétation forestière sur les dunes littorales se posent avec
acuité.
A l'heure actuelle, du point de vue paysager, la perception visuelle que l'on peut avoir en
parcourant le secteur d'étude permet de distinguer trois principaux types de paysages
phytocoenotiques, depuis le rivage jusqu'à l'intérieur des terres :
- Le système dunaire littoral, zone aérohaline, correspondant aux groupements herbacés
psammo-halophiles,
- L'écosystème forestier et les milieux associés, encore soumis à l'influence des embruns
marins, correspondent surtout à une pineraie de pin d'Alep et à des maquis littoraux, sur une
surface d'environ
1 000 ha,
- Le système agricole (agro-écosystème), localisé sur l'arrière-plateau, correspond à des
exploitations caractéristiques des structures agraires propres à la région. Cette zone est
actuellement occupée par des vergers arboricoles (agrumes et oliviers) et des vignobles.
L’écosystème dunaire
Le cordon dunaire de cette zone présente une organisation spéciale (Hanifi, 2007) plus ou
moins parallèle au rivage et qui montre du Nord au Sud (Figure 2).
Figure 2 : Résultats de l’AFC faisant ressortir une répartition des 42 relevés en trois ensembles bien
distincts : A, B, et C dans le plan d’axes factoriels 1- 2
a- Des monticules sableux à Diotis maritima, et d’autres espèces halophiles qui jouent un
rôle de rampart biologique contre les embruns marins. Ce sont les espèces de l’ensemble C
qui constituent une végétation assez haute de 40 à 80 cm. Il s’agit d’espèces adaptées à la
salinité (436,5 mM de NaCl/100 g de sol) et au sable grossier. Ce sont des chamaephytes,
des hémi- cryptophytes et des géophytes, dotées d’un système racinaire développé s’étalant
dans tous les sens et assurant la fixation des dunes. Ces espèces sont : Ammophila arenaria,
Pancratium maritimum, Otanthus maritima, Eryngium maritimum et Medicago marina. Cet
ensemble C comporte le groupement végétal qui colonise les premières dunes
embryonnaires proches du rivage, c’est l’Otantho maritimae-Ammophiletum arenariae
(Géhu, 1992) ; il se développe le long du cordon littoral méditerranéen et peut atteindre
même les côtes atlantiques (Braun-Blanquet et al., 1952).
b- Une pelouse à Lotus creticus et Ononis variegata qui s’intercalent entre les touffes à
Pistachier lentisque. Parmi les espèces existantes, on citera aussi : Helichrysum stoeches,
Glaucium flavum et Medicago marina. Ce groupe d’espèces des dunes semi-fixées est
constituées, pour la plupart, de thérophytes stresso-tolérantes et rudérales (Grime, 2001) ;
elles sont adaptées aux perturbations climatiques (sécheresse du sol, degré d’ensoleillement,
exposition au vent) et anthropiques (pâturage et piétinement). Ce sont les espèces de
l’ensemble B ; leurs morphologies assurent une forte résistance aux vents. Le sable est
mobile, plus fin, sec en surface et humide en profondeur. On retrouve, dans cette pelouse
rase très ouverte : Lotus creticus, Ononis variegata, Silene colorata, Pseudorlaya pumila,
Hedypnois cretica et Matthiola tricuspidata. Cette association de thérophytes correspondant
au Sileno coloratae-Ononidetum variegatae (Géhu & Géhu, 1989) se développe sur sables
meubles, à l’abri des vents et des embruns marins sur le littoral tunisien et celui de Kabylie
(Géhu, 1992).
c- Des dunes internes occupées par les fourrés à Pistachia lentiscus et Ephedra fragilis qui
se densifient au sud pour rejoindre un système forestier à Pin d’Alep. C’est un matorral bas
où on trouve des espèces thermophiles telles que : Phillyrea media et Juniperus phoenicea.
Ce groupe d’espèces constituent l’ensemble A des maquis littoraux pré-forestiers et
occupent les dunes grises stabilisées, où le taux de matière organique (8.20%) est
relativement le plus élevé (Hammouche, 2003). Il s’agit: Pistacia lentiscus, Ephedra
fragilis, Phillyrea media, Quercus coccifera, Lonicera implexa et Smilax aspera (Tableau
1). La végétation se répartit sous forme de franges successives liées au gradient de salinité
et de mobilité du sable.
Tableau 1 - Liste des principales espèces des dunes littorales de l’Est-Algérois
ESPECES
Elytrigia juncea (L.) Nevski subsp. juncea
=
Agropyrum junceum
Ammophila arenaria Link subsp. australis (Mabille) Lainz
Anacyclus clavatus (Desf.) Pers.
Avena sterilis L.
Bromus diandrus Roth subsp.diandrus
[= B. madritensis ]
Cakile maritima Scop.
Centaurea sphaerocephala L.
Cistus albidus L.
Clematis flammula L.
Crepis vesicaria L.
Crucianella maritima L.
Cutandia maritima (L) Barbey
Otanthus maritimus. (L.) Hoffmanns et Link
=
Diotis maritima (L.) Sm
Echium sabulicola Pomel subsp. sabulicola
[E. confusum]
Helichrysum stoechas (L.) DC.
Ephedra fragilis Desf (= E. nebrodensis)
Eryngium maritimum L.
Euphorbia paralias L.
Genista ferox (Poiret) Dum. Cours.
Glaucium flavum Crantz
Hedypnois cretica (L.) Dum. Cours.
Juniperus turbinata (Guss.) P. Lebreton et P. Perez
subsp. turbinata = J. phoenicea L. s.l.
Lagurus ovatus L.
Linum strictum L.
Lonicera implexa Aiton
Lotus creticus L.
Matthiola tricuspidata (L.) R.Br
Type Biologique
G
Type Bio
géographique
Atl-Med
G
Th
Th
Th
Circ.Bor
Euro-Med
M.I.T
Euro.Med
Th
Hc
Nph
Nph
Th
Ch
Th
Ch
Euro-Med
Med
Med
Med
Euro-Med
Med
Med
Med-Atl
Th
Med
Ch
Ph
Hc
G
Nph
Th
Th
Ph
Atl-Med
Med
Med
Euro-Med
End-N.Af
Med
Med
Med
Th
Th
Nph
Ch
Th
Med
Med
Med
Med
Med
Medicago marina L.
Ononis variegata L.
Pseudorlaya [= Orlaya] pumila (L.) Grande subsp. pumila
Oxalis pes-caprae (L.) Thumb.
Pancratium maritimum L.
Phillyrea media L.
ESPECES
Pistacia lentiscus L.
Polygonum maritimum L.
Quercus coccifera L.
Reseda alba L.
Rubia peregrina L.
Rumex bucephalophorus L.
Salsola kali L.
Senecio leucanthemifolius Poiret
Silene colorata Poiret
Smilax aspera L.
Ch
Th
Th
Th
G
Nph
Type Biologique
Nph
Th
Ph
Th
Nph
Th
Th
Th
Th
Nph
Med
Med
Med
Cosm.
Circ.Med
Med
Type Bio géographique
Med
Cosm.
Med
EurAs.
Med-Atl
Med
Paléo-Temp.
Med
Med
Med
Types biologiques, selon Raunkier : Ph, Phanérophytes ; Nph, NanoPhanérophytes ;
Ch, Chamaephytes; Hc, Hémicryptophytes ; G, Géophytes ; Th, Thérophytes.
Types biogéographiques : Atl-Méd., Atlantique-Méditerranéenne ; Euras., Eurasiatique,
Eur-Med., Euro-Méditeranéenne ; Circ-Med., Circum- Méditerrénéenne ;
Cosm., Cosmopolite ; Méd., Méditerranéenne ; N-Af., Nord-Africaine ; Paléo-Temp.,
Paléo-tempérée ; MIT, Méditerranéo-Irano-Touranien.
Les écosystèmes forestiers
Les écosystèmes forestiers et les milieux associés correspondent surtout à une pineraie de
pin d’Alep et à des maquis littoraux. Ils sont constitués d’une végétation forestière naturelle
au niveau de la forêt du Sahel, à l’Ouest (Tableau 2) et d’un reboisement relativement
récent au niveau de Mandoura à l’Est.
La forêt du Sahel
Elle correspond aux peuplements de pin d’Alep (Pinus halepensis), au stade de futaie, sur
un fond arbustif à pistachier lentisque (Pistacia lentiscus) et à chêne kermès (Quercus
coccifera). Dans la composition floristique on y trouve des espèces indicatrices de
dégradation, telles que les cistes (Cistus salvaefolius, C. villosus, et C. albidus). Ces
dernières sont indicatrices du passage de l’incendie alors que la présence de la lavande
(Lavendula stoechas) montre une influence de type anthropozoïque.
Les maquis littoraux
L’étude de la végétation et des facteurs du milieu permet de distinguer deux (02) types de
groupement du point de vue physionomique et floristique.
Le maquis à oléastre et lentisque
Il appartient à l’oleo-lentiscetum (Sadki et al., 1991). C’est un maquis littoral parfois
extrêmement dense, taillé par les embruns marins. Il est représenté par : Pistacia lentiscus,
Phillyrea angustifolia et des lianes : Smilax aspera, La clématite (Clematis cirrhosa), et
l’éphédra (Ephedra fragilis).
Dans un autre faciès, beaucoup plus ouvert, il est représenté par l’Oléastre qui marque la
première strate arborescente. Des espèces de dégradation post-incendies sont aussi
observées : Le pin d’Alep, les cistes, les hélianthèmes (Tuberaria guttatum), et le palmier
nain (Chamaerops humilis). Cette association, qui appartient à l’étage de végétation
thermo-méditerranéen, est de type xérophile et thermophile, elle est indifférente à la nature
du sol.
La junipéraie littorale à Juniperus phoenicea et Ephedra fragilis (Zaffran, 1960)
Ce maquis dunaire à J. phenicea (= J.Turbinata) représente un climax unique à Zemmouri ;
il est aujourd’hui en voie de dégradation et totalement détruit par endroits où il occupait les
dunes mobiles internes.
Le reboisement de Mandoura
Elle correspond à une végétation forestière introduite ; les reboisements successifs ont été
réalisés durant les années 1986 1987 sur une superficie de 500 ha. Elle est représentée par le
pin d’Alep, le pin maritime, d’Acacia cyanophylla et d’Eucalyptus globulus.
Son état actuel est satisfaisant, mais la croissance des arbres est lente, en raison de la
pauvreté des sols en matière organique, de l’ensablement des sujets par l’action éolienne,
l’action mécanique des embruns marins, le manque d’entretien et d’actions sylvicoles, le
pacage fréquent, la mutilation des arbres par le passage incessant des engins transportant le
sable.
Tableau 2 : Liste des espèces inventoriées en milieu forestier à Zemmouri
Espèces arborées, arbustives et lianes
Pinus halepensis L.
Lavandula stoechas L.
Pistacia lentiscus L.
Chamaerops humilis L.
Quercus coccifera L.
Genista ferox (Poiret) Dum. Cours
Arbutus unedo L.
Ruscus hypophyllum L.
Juniperus phoenicea L.
Asparagus acutifolius L.
Phillyrea media (L.) Rouy.
Rubia peregrina L.
Olea europea L.
Clematis flammula L.
Myrtus communis M.
Clematis cirrhosa L.
Phillyrea angustifolia L.
Smilax aspera L.
Rhamnus Alaternus L
Lonicera implexa Aiton
Jasminum fruticans L.
Tamus communis L.
Cistus albidus L.
Ephedra fragilis Desf.
Cistus salvifolius L.
Bryonia dioica Jacq.
Thymelea hirsuta Coss. & Dur.
Espèces herbacées
Geranium purpureum Vill.
Anagallis arvensis L.
Rumex bucephalophorus L.
Vicia sativa L.
Lobularia maritima (L.) Desv.
Oryzopsis miliacea Asch. & Schiv.
Echium confusum Pomel
Helichrysum stoechas (L.) DC
Plantago lanceolata L.
Avena sterilis L.
Centaurea sphaerocephala L.
Polypodium australe L.
Hypochoeris radicata L.
Trifolium campestre Schreb.
Lagurus ovatus L.
Galactites tomentosa (L.) Moench.
Carex halleriana Asso.
Allium triquetrum L.
Solanum nigrum L.
Sonchus oleraceus L.
Andryala integrifolia L.
Fumaria capreolata L.
Reseda alba L.
Mercurialis annua L.
Lotus ornithopodioides L.
Brachypodium distachyum P.B.
Stachys maritima L.
Urtica membranacea Poiret
Linum strictum L.
Ononis variegata L.
Ophrys tenthredinifera Willd.
Helianthemum guttatum (L.) Mill.
Les agro-écosystèmes
Les zones de plaine comme la plaine côtière de Zemmouri, et les zones de vallée comme
celle de l’oued Isser sont des terrains à fortes potentialités agricoles, situées sur des sols
alluvionnaires, elles s’étendent sur une superficie d’environ 59.000 ha et représentent
environ 50% des 110.000 ha de la surface agricole totale de la wilaya de Boumerdès. Ce
sont des terrains riches et qui recèlent des ressources en eau importantes et sont à vocation
agricole intensive. Les usages directs sont à la base des activités humaines, comme
l’agriculture d’élevage, la pèche, et le tourisme etc.
La diversité floristique des différentes communautés végétales
Les trois communautés des dunes littorales présentent une biodiversité spécifique
intrinsèque, ou diversités α faible (Whittaker, 1972). Elle varie de 6,1 espèces, par relevé,
pour les communautés halophiles C ; à 9,8 espèces par relevé, pour les fourrés en limite de
la dune grise stabilisée où les conditions édaphiques sont les meilleures (Tableau 3).
L’analyse du tableau 3 montre que les différences entre les indices de diversité des
différentes communautés sont peu marquées. La valeur de l’indice (H’) de Shannon &
Weaver est relativement faible pour l’ensemble des 3 communautés (de 2,25 à 2,96). Il est
aussi à remarquer, que les valeurs des taux d’équitabilité (E) proches de l’unité (0,91 à 0,93)
indiquent une régularité dans la distribution des espèces ; induisant donc, une structure
spatiale relativement uniforme. Selon Médail (1996), l’uniformité de la structure entraîne
une flore homogène et peu diversifiée caractéristique d’un biotope unique. Au niveau du
maquis pré-forestier, Les indices de diversité sont plus relativement les plus élevés. Les
strates arbustives et arborescentes ont un impact non négligeable sur la composition et la
structure des interfaces limitantes, riches en espèces rudérales et thérophytes. En effet, les
phanérophytes peuvent modifier et améliorer les conditions microclimatiques de ces
écotones par leur ombre portée et leur rôle de brise-vent, mais aussi les paramètres
physicochimiques du sol (enrichissement en matière organique) en relation avec des dépôts
de litière (Médail, 1996). Les résultats obtenus montrent une certaine similitude du point de
vue indice de diversité (H’) entre les 3 communautés, malgré leur différence au plan
structural. Ces milieux peuvent être considérés comme un écocomplexe constituée d’une
mosaïque de communautés végétales (Lemauviel & Roze, 2000) aux conditions
écologiques similaires et correspondantes à un même stade dynamique. Alors, la diversité γ
représente donc la diversité spécifique totale de cet écocomplexe, au niveau du paysage ou
même à l’échelle régionale (Whittaker et al, 2001). Le pool taxonomique total ou diversité γ
semble évoluer dans le même sens que la diversité α. Elle passe de 9 espèces dans les
communautés C, à 15 espèces sur la dune de transition, constituant l’ensemble B, et atteint
28 espèces au niveau de A du maquis pré-forestier sur la dune grise stabilisée.
Tableau 3 : Les indices de diversité des communautés végétales des dunes littorales
de l’Est-Algérois (Zemmouri, Boumerdès)
Indices de
diversité α
Communauté A
Maquis pré-forestier
Dune grise stabilisée
Communauté B
Pelouse
Dune grise transitoire
Communauté C
Espèces halophiles
Dune mobile blanche
Indices de
Shannon (H’)
Equitabilité
(E)
Indices de
diversité γ
9,8
2,96
0,91
28
8,1
2,68
0,93
15
6,2
2,25
0,93
9
Les facteurs de dégradations
Le littoral de Zemmouri, draine chaque année des milliers de vacanciers et de touristes, eu
égard à la beauté de ses paysages boisés et des innombrables possibilités de repos et de
promenades sur ces plages.
La forêt dite du « Sahel » est librement accessible aux citadins et parcourue annuellement
(chaque été surtout) par des centaines de milliers de personnes. Cette forêt est un des
incitants touristiques majeurs de notre région où elle se développe naturellement.
Malheureusement, cette forêt du Sahel est soumise constamment à diverses actions
naturelles ou anthropiques néfastes.
Les délits les plus répandus sont :
- Les défrichements et déboisements illicites des parcelles forestières par les riverains
pour augmenter leur surface agricole ou pour un but pastoral,
- le surpâturage, car cette forêt est utilisée comme zone de parcours, les coupes de
bois en délits,
- les incendies qui chaque année pratiquement (depuis 1996 à 2010) ravagent
plusieurs hectares ;
- les estivants qui la fréquentent par milliers chaque année,
- extraction de sable,
- dégradation du sol et de la végétation, suite à l'exploitation du sable en forêt et au
passage incessant des camions transportant le sable des plages,
- abandon de toutes sortes de détritus dans la forêt, en particulier à la fin de la saison
estivale (risque de pollution du sol et de la nappe phréatique par les nitrates),
- attaque parasitaire par la chenille processionnaire du pin d'Alep (risque d'allergie et
d'urticaire par les poils),
Les mesures de réhabilitation et de valorisation de l'écosystème littoral
Programme d'actions à entreprendre au niveau de la forêt du sahel
(Zemmouri)
Pour répondre à ces divers facteurs de régression du couvert forestier, l'administration
forestière a élaborer un programme ambitieux d'actions de grande envergure sur ce massif
littoral de 1000 ha pour l'année 2010, qui souffre pour sa réalisation effective sur le terrain
d'un manque de ressources financières. Les différentes actions envisagées sont :
- Reboisement sur 200 ha au niveau de la forêt du sahel,
- Travaux sylvicoles (élagage, nettoyage) sur une surface de 400 ha,
- Ouverture de pare-feux sur une longueur de 5 kms,
- Ouverture de piste forestière pour la lutte anti-incendie (sur 50 ha),
- Lutte mécanique contre la chenille processionnaire sur 500 ha,
- Plantation fruitière sur 500 ha à la périphérie de la forêt
- Correction torrentielle des oueds (Merdja, Bergouga et Isser).
Gestion durable des ressources de la biodiversité
Un autre programme d'actions complémentaire qui prévoient pour ces écosystèmes les
aspects suivants (Hanifi et al., 2004):
- Tester de nouvelles formules pour soutenir des modèles de développement durable et
d'équilibre écologique dans un environnement forestier et rural,
- Intégration des aspects environnementaux avec des aspects productifs et récréatifs,
- Instauration de modèles de gestion durable en tenant compte des nouveaux besoins
socio-économiques des populations locales.
CONCLUSION
Le diagnostic de l’état de l’environnement a mis en évidence la richesse de l’écosystème de
Zemmouri sur le plan du patrimoine naturel : la diversité des types d’espaces naturels au
niveau du littoral, et une végétation remarquable (dunaire et forestière).Ce patrimoine
exceptionnel, situé dans un milieu sans cesse sujet à des perturbations, doit être protégé
d’un risque de disparition lié à l’extension de l’urbanisation, mais aussi à de simples erreurs
de gestion et d’exploitation de ses ressources. Ces sites littoraux abritent plusieurs espèces
rares qui méritent d’être protégées ce sont : Calystegia soldanella, Cakile maritima ssp
aegyptiaca, Medicago marina, Polygonum maritimum, Sporobolus arenarius. La pineraie
littorale, de la forêt du Sahel comporte plusieurs espèces rares ou remarquables qui méritent
aussi d’être protégées, ce sont notamment l’orchidée (ophrys tenthredinifera), une fougère
(Polypodium australe), le jasmin (Jasminum fruticans) et le fragon (Ruscus hypophyllum).
Les formations végétales du littoral de Zemmouri sont soumises à de fortes pressions
climatiques et anthropiques. Les sols des dunes maritimes, relativement salés, sont
généralement pauvres en matière organique. A cette pauvreté du milieu s’ajoute l’action
néfaste des vents violents hivernaux et des embruns marins. Tous ces facteurs sont très
contraignants à la vie végétale. Pour répondre à ces divers facteurs de dégradations de la
végétation, et afin de protéger et de’ conserver ce patrimoine biologique, il est nécessaire
de procéder à la réhabilitation de ce site par des propositions d’aménagement et des mesures
conservatoires urgentes telles que la mise en défens de certaines communautés et rares
biotopes très riches du point de vue floristique ; l’implantation d’espèces naturelles
fixatrices de dunes comme l’Oyat (Ammophila arundinacea) ; enfin, le reboisement, par des
essences bien adaptées à ces milieux littoraux forestiers comme les conifères,
principalement du genre Pinus (P. maritimum, P. pinea, et P. halepensis) ; ainsi que des
arbres fourragers (Medicago arborea, Fraxinus sp…).
[1] Aridj A., Makaoum M. – Stratégies adaptatives des espèces végétales du littoral Est-algérois : cas de
Zemmouri-El-Bahri. Thèse d’Ing. D’état en Ecologie végétale, Fac.Sci.Biol. U.S.T.H.B., Alger, 78 p.
2002.
[2] Bagnouls F. & H. Gaussen - Saison sèche et indice xérothermique. Bull.Soc.Hist.Nat. Toulouse, 88, 193239.1953.
[3] Benzecri J. P. – L’analyse des données. 2 vol., Durand (ed.), Paris, 615 p. + 619 p. 1973.
[4] Braun – Blanquet J. – Les groupements de la France méditerranéenne. C.N.R.S. Montpellier 297 p. 1952.
[5] Daget P. & J. Poissonnet - Une méthode d’analyses phytologique des prairies, Ann. Agron. 22, 5-41.
1971.
[6] Duchaufour P. - Précis de Pédologie. Masson (Ed.), Paris, 438 p. 1965.
[7] Emberger L. - Une classification biogéographique des climats. Trav. Lab. Bot. Zool. Fac. Sci. Serv. Bot.
Montpellier, 7 : 3-43. 1955.
[8] Gehu J.M. & J. Gehu – Données nouvelles sur la végétation littorale psammophile et halophile du Sud
Tunisien. Coll. Phytosoc. 19, Bailleul, 677-723. 1989.
[9] Gehu J.M. – Végétation et qualité de l’environnement côtier en Méditerranée. Coll. Phytosoc. 19, Bailleul,
760 p. 1992.
[10] Gehu J.M. & N. Sadki – Remarques de phytosociologie et de synchorologie comparées sur le littoral
Algérois. Doc. Phytosoc., 15, Camerino, 16 p. 1994.
[11] Gounot M. – Méthodes d’études quantitatives de la végétation. (ed.), Masson, Paris, 314 p. 1969.
[12] Grime, J.P. – Plant strategies, vegetation processes, and ecosystem properties. J. wiley & Sons, (Eds.),
Chichester, 417 p. 2001.
[13] Hammouche S. – Les stratégies d’adaptation à la salinité des espèces des dunes littorales de Zemmouri El-Bahri (Boumerdès, algérie). Thèse d’Ing. d’Etat en Ecologie végétale, Fac.Sci.Biol. U.S.T.H.B.,
Alger, 48 p. 2003.
[14] Hanifi N., Benchouk N., Taguemout C. & R. Bendaoud - Réhabilitation, valorisation, aménagement de
l’écosystème de Zemmouri, y compris la zone côtière. AEB-Life Pays-tiers, TCY 99/DZ/136,
(Algérie-CEE). 64 p. 2004.
[15] Hanifi N., Kadik, L. & G.G. Guittonneau - Organisation des phytocénoses des dunes littorales dégradées
de Zemmouri (Boumerdès, Algérie), Acta Botanica Gallica, 154, (2), 239-245. 2007.
[16] Lemauviel S. & F. Roze - Ecological study of pine forest clearings along the French Atlantic sand dunes:
perspectives of restoration. Acta Oecol., 21, (3), 179-192. 2000.
[17] Medail F. - Structuration de la biodiversité de peuplements végétaux méditerra- néens en situation
d’isolement. Thèse de Doct. Es-Sci. Univ. d’Aix-Marseille III, 290 p. + ann. 1996.
[18] Meziani K. - Le cordon dunaire de la région de Mostaganem (Algérie). Etude et proposition
d’aménagement. Thèse de Doct.-Ing., Univ. Sci. Tech. d’Aix-Marseille, 213 p. 1984.
[19] Negre R. - Notice de la carte de Tipaza au 1/50 000ème. Mém.Soc.Hist.Nat. Afr. Nord. N.S. 8, 69 p.
1964.
[20] Quezel P. & Santa S. – Nouvelle flore d’Algérie et des régions méridionales, (ed.) C.N.R.S, 2 tomes,
1170 p. 1962 –1963.
[21] Ramade F. - Eléments d'écologie, Ecologie appliquée, Marc Graw Hill (Ed.), Paris, 578 pages. 1989,
[22] Sadki N., Khelifi H., & S. Djebaili – La végétation des dunes maritimes de l’Est-Algérois. Coll.
Phytosoc., 20 : Phytodynamique et biogéographie historique des forêts. Bailleul 1991 : 369-376.
1991.
[23] Seltzer P. - Le climat de l'Algérie. Inst. Météorol. et de la Phys. du Globe, Univ. d'Alger, 218 p. + 1 carte.
1946.
[24] Thomas J.P. – Ecologie et dynamisme de la végétation de la dune littorale dans la région de Djidjelli.
Bull.Soc.Hist.Nat.Afr.Nord, 59 (1.2.3.4.), 37-38. 1968.
[25] Whittaker R.H., Willis K.J. &. R. Field - Scale and species richness: towards a general, hierarchical
theory of species diversity. Journal of Biogeography, 28, 453-470. 2001.
[26] Whittaker R.H. - Evolution and measurement of species diversity. Taxon, 21, 213-251. 1972.
[27] Zaffran I. – Formations à Juniperus phoenicea L. du littoral algérois. Bull.Soc.Hist. Nat.Afr.Nord, 46 (12), 48-80. 1960.
Impact de la Pollution sur Donax trunculus dans la Baie d’Annaba (Algerie): Croissance
et Mesure de Biomarqueurs durant Deux Années
Impact de la pollution sur Donax trunculus dans la baie d’Annaba
(Algerie): croissance et mesure de biomarqueurs durant deux années
1
Soltani Noureddine1, Amira Akila1, Sifi Karima1
Laboratoire de Biologie Animale Appliquée, Faculté des Sciences, Département de Biologie, Université Badji
Mokhtar, E-mail: [email protected] - [email protected] - [email protected]
RESUME
La présente étude, en continuité avec les travaux antérieurs, vise l’évaluation de l’impact de la pollution sur
la croissance et la réponse de quelques biomarqueurs du stress environnemental (acétylcholinestérase,
glutathion S-transférase et catalase) chez D. trunculus. Les échantillons ont été collectés mensuellement
durant deux années (mars 2009 à février 2011) au niveau de deux sites (Sidi Salem et El Battah) différents par
leur niveau d’exposition aux sources polluantes. Le site de Sidi Salem étant relativement plus pollué
comparativement à celui d’El Battah. L’étude biométrique a montré des différences significatives entre les
deux sites pour la majorité des paramètres biométriques avec des effets sites et temps hautement significatifs.
Les analyses biochimiques révèlent une inhibition de l'activité de l'acétylcholinestérase et une induction de la
glutathion S-transférase et la catalase très élevées chez les individus de Sidi Salem comparativement aux
réponses des individus d'El Battah. L'ensemble des résultats suggère les variations et les différences
observées dans les réponses biologiques entre les deux sites seraient dues à l'intensité et à la durée du stress
induit par la pollution dans la baie. La population de D. trunculus du site de Sidi Salem est exposée à un
niveau de pollution plus élevé en rapport avec la proximité des sources de pollution. Néanmoins, une baisse
dans le niveau de pollution est constatée durant la deuxième année de la biosurveillance.
Mots clés : Pollution, Biosurveillance, Baie d’Annaba, Bioindicateur, Donax trunculus, Croissance,
Biomarqueurs.
INTRODUCTION
Les zones côtières sont des écosystèmes importants non seulement pour la productivité
biologique, mais aussi pour l'activité économique [1]. Cependant, celles-ci sont soumises à
des facteurs de stress anthropiques car recevant de grandes quantités d'effluents urbains
transportés par les rivières et des rejets industriels et agricoles [2]. La baie d'Annaba en est
affectée par ces contaminants [3]. Les travaux antérieurs ont mis en évidence une pollution
métallique prépondérante [4, 5]. Des métaux lourds ont été particulièrement détectés dans
les sédiments et les tissus d'une espèce comestible abondante dans la baie, Donax trunculus
L. (Mollusca, Bivalvia) [6, 4]. Cette espèce a été utilisée comme bioindicateur de la qualité
des eaux côtières marines [7, 8, 9, 10, 4, 11]. La biosurveillance de la qualité de
l'environnement côtier repose essentiellement sur l'utilisation de marqueurs biologiques
[12]. Parmi ces biomarqueurs, l’acétylcholinestérase (AChE, EC: 3.1.1.7), une enzyme
vitale dont le rôle majeur est d’hydrolyser l’acétylcholine (ACh), un ester libéré dans
l’espace synaptique lors de la transmission de l’influx nerveux d’une cellule nerveuse à une
autre [13, 14]; ce biomarqueur est couramment utilisé pour détecter la pollution de
l'environnement causée par des composés neurotoxiques [15]. La glutathion-S-transférase
(GST, EC: 2.5.1.18 impliquée dans la phase II du processus de détoxification est utilisée
comme biomarqueurs de pesticides organochlorés et de les polychlorobiphényles (PCB)
chez les invertébrés [16]. La catalase (CAT, EC1.11.1.6), une enzyme anti-oxydante non
spécifique à un groupe de contaminant, est considérée comme un biomarqueur du stress
oxydatif [17].
Dans ce contexte, la présente étude, en continuité avec les travaux antérieurs, vise à évaluer
l’impact de la pollution sur la croissance et la réponse de biomarqueurs (AChE, GST, CAT)
du stress environnemental chez D. trunculus dans la baie d’Annaba. L'échantillonnage a été
réalisé mensuellement durant deux années (mars 2009 à février 2011) au niveau de deux
sites différents selon leur niveau de contamination, sachant que le site de Sidi Salem est
relativement plus pollué comparativement à celui d’El Battah.
Présentation des sites d’échantillonnage
Le golfe d’Annaba est situé à l'extrême Nord Est du littoral algérien, limité par le cap Rosa
(8°15’ E et 36° 58’ N) à l’Est, et par le cap de Garde (7° 16’ E et 36° 58’ N) à l’Ouest. El
Battah (36°50’ N et 7° 56’ E) se situe à 20 km de l’Est d’Annaba. Ce site est éloigné des
sources polluantes et est soumis à un régime hydrodynamique important, Le second site,
Sidi Salem, se trouve à environ 1 km de la ville d’Annaba et il est exposé aux différents
rejets (urbains, agricoles et industriels).
Collecte des échantillons
La collecte de D. trunculus est effectuée mensuellement de mars 2009 jusqu’à février 2011.
Les échantillons sont ensuite transportés au laboratoire dans des bacs en plastiques
contenant de l’eau de mer. Selon les différents objectifs de l'étude, deux types
d'échantillonnage ont été effectués. Pour l'étude des variations temporelles et inter-sites des
biomarqueurs, des bivalves ayant une taille standard de 26 ± 1 mm ont été recueillis des
deux sites, tandis que pour l’étude biométrique, 100 individus ont été collectés d’une
manière aléatoire pour chaque temps et par site. La dissection et le prélèvement du manteau
sont réalisés le jour même de la pêche pour éviter l’effet du jeûne et une émission
éventuelle des gamètes due au stress pouvant diminuer le poids de la masse molle totale
[18].
Etude biométrique
Les individus de D. trunculus sont mesurés à l’aide d'un pied à coulisse (précision de 1/10
mm) afin de déterminer les paramètres linéaires suivants: la longueur (L) qui correspond à
la plus grande distance séparant le bord antérieur du bord postérieur de la coquille, la
hauteur (H) qui va de la charnière dorsale au bord ventral et de I‘épaisseur (E) qui est la
largeur maximale de la convexité des deux valves réunies.
Procédures biochimiques
L’activité spécifique de l'AChE a été déterminée [19] selon la méthode décrite
précédemment [20]. La moitié de chaque manteau est homogénéisé dans 1 ml de solution
détergente. Après centrifugé (9000 tours/mn, 15 mn), une fraction aliquote du 100 µl du
surnageant est récupérée et additionnée à 100µl de DTNB et 1ml de tampon Tris (0,1M ;
pH7). Au bout de 3 à 5 mn de repos, 100µl du substrat acéthylthiocholine sont ajoutés. La
lecture des absorbances est effectuée toutes les 4 mn pendant 20 mn à une longueur d’onde
de 412 nm. Le dosage de la GST est réalisé selon une méthode conventionnelle [21]
rapportée précédemment. [22]. Les tissus sont homogénéisés dans 1 ml du tampon
phosphate (0,1 M, pH 6). L'homogénat obtenu est centrifugé (14000 tours/mn; 30 mn) et le
dosage est effectué dans une fraction aliquote de 200 µl du surnageant additionné de 1,2 ml
du mélange [CDNB (1mM) - GSH (5 mM)] dans 20 ml du tampon phosphate 0,1 M, pH 6).
Les absorbances sont mesurées toutes les minutes pendant 5 min à 340 nm.
L’activité de la CAT est réalisée selon le protocole de Claiborne [23]. La moitié de chaque
manteau est homogénéisée dans 1 ml de tampon phosphate (100 mM, pH 7,4), puis
centrifugée (15000 trs/min, 10 mn). Le dosage est effectué sur une fraction aliquote de 50
µl du surnagent à laquelle on ajoute 750 µl de tampon phosphate (100 mM, pH 7,4), et 200
µl H2O2 (500 mM) [1,42 ml eau oxygénée à 30 volumes (garder en chambre froide), 25 ml
tampon phosphate (100 mM pH 7,4)]. La lecture est effectuée toutes les 5 sec pendant 30
sec à 240 nm. Les protéines ont été quantifiées [24] en utilisant le bleu brillant de
Coomassie (BBC) comme réactif et l’albumine sérum de bœuf (BSA) comme protéine
standard. Les absorbances sont lues à une longueur d’onde de 595 nm.
ANALYSE STATISTIQUE
Les résultats obtenus ont été exprimés par la moyenne arithmétique plus au moins l'écarttype (m ± SD) et différents tests statistiques ont été réalisés à l'aide du logiciel MINITAB
version 16 (PA State College, USA). Les moyennes ont été comparées deux à deux par le
test t Student. Une analyse de la variance multivariée (paramètres biométriques, la réponse
des biomarqueurs) a été effectuée. Le seuil de signification est p< 0,05.
RESULTATS
Biométrie et croissance en fonction des sites et du temps
Les données biométriques (longueur, hauteur, épaisseur et poids total frais) sont résumées
dans le tableau 1. Elles font apparaître des différences entre sites et d'une année à l'autre. En
effet, les valeurs moyennes enregistrées à El Battah sont significativement supérieures à
celles de Sidi Salem et ceci pour les deux périodes considérées. L’analyse de la variance
multivariée (MANOVA) révèle des effets temps et site durant les deux années. On
enregistre un effet mois et un effet site hautement significatifs (p<0,001), l’interaction
mois/site présente également un effet hautement significatifs (p<0,001).
Tableau 1. Variations annuelles des paramètres biométriques mesurés chez D. trunculus pêché
dans deux sites du golfe d’Annaba (El Battah, Sidi Salam) au cours de la période mars 2009février 2011 (m ± s; n=1200;
Pour un même paramètre et une même période, les moyennes suivies d'une même lettre en minuscule ne sont
pas significativement différente, tandis que pour un même paramètre et un même site, les moyennes suivies
d'une même lettre en majuscule ne sont pas significativement différente à (p> 0,05).
Paramètres
Année
mars 2009-février 2010
Longueur (cm)
Hauteur (cm)
Epaisseur (cm)
Poids total frais (mg)
El Battah
2,58 ± 0,29 a
A
2,57 ± 0,36 a
A
1,40 ± 0,14 a
A
1,38 ± 0,18 a
B
0,85 ± 0,10 a
A
0,83 ± 0,13 a
B
2,16 ± 0,70 a
A
2,31 ± 0,88 a
B
Sidi Salem
2,47 ± 0,30 b
A
2,54 ± 0,33 b
B
1,35 ± 0,14 b
A
1,38 ± 0,17 a
B
0,81 ± 0,10 b
A
0,83 ± 0,13 a
B
1,89 ± 0,63 b
A
2,15 ± 0,77 b
B
Réponses des biomarqueurs du stress environnemental
Le suivi mensuel de l’activité AChE au cours de la première année (mars 2009 à février
2010) montre des valeurs maximales au mois d’octobre (90,01 ± 3,44 à d’El Battah et 80,40
± 4,74 µM/mn/mg de protéines à Sidi Salem), tandis que les valeurs minimales sont
enregistrées au mois de novembre (46,21 ± 3,42 à El Battah et 31,66 ± 5,5 µM/mn/mg de
protéines à Sidi Salem) (Fig. 1 A). La comparaison des moyennes révèle une inhibition
significative de l’activité AChE chez les individus de Sidi Salem comparativement à ceux
d’El Battah aux mois d’avril (p= 0.005), mai (p= 0,006), juin (p< 0.001) juillet (p< 0.001),
septembre (p< 0.001), octobre (p= 0,006) et novembre (p= 0,006), respectivement (Fig. 1
A). Les activités moyennes de l’AChE au cours de la deuxième année (mars 2010 à février
2011) présentent des valeurs maximales au mois d‘août à El Battah (60,46 ± 4,77
µM/mn/mg de protéines) et au mois de décembre à Sidi Salem (40,33 ± 3,59 µM/mn/mg de
protéines). Par contre, les valeurs minimales sont enregistrées au mois de janvier à El
Battah et au mois de décembre à Sidi Salem (Fig. 1 B). L’activité AChE est significative
significativement différente entre les deux sites durant les mois de mars (p= 0.008), mai (p=
0.003), juin (p< 0.001), juillet (p< 0.001), août (p< 0.001), septembre (p< 0.001), novembre
(p= 0.008) et décembre (p= 0.004) (Fig. 1 B).
Mois
Figure 1. Variations mensuelles de l’activité spécifique de l’acétylcholinestérase (µM/mn/mg de
protéines) au niveau du manteau de D. trunculus pêché dans la baie d’Annaba de mars 2009 à février
2010 (A) et mars 2010 à février 2011 (B) (m±SD; n= 6) (*: différence significative; **: différence très
significative; ***: différence hautement significative).
L’activité GST présente au niveau des deux sites un maximum au mois de septembre 2009
(El Battah: 11,78 ± 2,68 µM/min/mg de protéines; Sidi Salem: 19,78 ± 3,79 µM/min/mg de
protéines), et un minimum au mois d’août 2010 (El Battah: 1,65 ± 0,46 µM/min/mg de
protéines; Sidi Salem: 1,57 ± 0,48 µM/min/mg de protéines) (Fig. 2). La comparaison des
moyennes indique des différences significatives (p< 0,05) aux mois de juillet et février
2009, septembre et décembre 2010; des différences très significatives (p< 0,01) ont été
notées aux mois de septembre, novembre et décembre 2009 et aux mois d’août et octobre
2010, et enfin des différences hautement significatives (p< 0,001) aux mois d’avril, mai,
juin et octobre 2009 et pour les mois avril et mai en 2010.
Figure 2. Variations mensuelles de l’activité spécifique de la glutathion S-transférase (µM/mn/mg de
protéines) au niveau du manteau de D. trunculus pêché dans la baie d’Annaba au cours de la période
mars 2009 - février 2010 (A) et mars 2010 - février 2011 (B) (m±SD; n= 6) (*: différence significative;
**: différence très significative; ***: différence hautement significative).
L’activité CAT fluctue selon le site et le temps. D’après les résultats obtenus, le site d’El
Battah présente une valeur minimale (0,141 ± 0,085 µM/mn/mg de protéines) au mois de
septembre 2010 et une valeur maximale (2,411 ± 0,168 µM/mn/mg de protéines) au mois de
mai 2010; alors que le site de Sidi Salem présente une activité qui varie entre 0,192 ± 0,04
µM/mn/mg de protéines au mois de septembre 2010 comme valeur minimale et 2,496 ±
0,403 µM/mn/mg de protéines au mois de janvier 2010 comme valeur maximale (Fig. 3).
La comparaison entre les deux sites révèle une différence hautement significative (p<
0,001) aux mois d’août et novembre 2009, mars, juin et août 2010; très significative (p<
0,01) aux mois juin et juillet 2009; et une différence significative (p< 0,05) en décembre
2009 et aux mois de février et mai 2010, par contre aucune signification (p> 0,05) n’est
enregistrée pour le reste des mois (Fig. 3).
A
B
Figure 3. Variations mensuelles de l’activité spécifique de la catalase (µM/mn/mg de protéines) au
niveau du manteau de D. trunculus pêché dans la baie d’Annaba au cours de la période mars 2009 février 2010 (A) et mars 2010 - février 2011 (B) (m±SD; n= 6) (*: différence significative; **: différence
très significative; ***: différence hautement significative).
DISCUSSION
Biométrie et croissance
La croissance de l'individu est l'une des principales caractéristiques de la plupart des
organismes et un paramètre important dans la dynamique des populations. La croissance
des bivalves dépend de l’efficacité de leur métabolisme qui peut être affecté par les
xénobiotiques [25, 26]. La croissance de D. trunculus est contrôlée par l'interaction de
plusieurs facteurs écologiques tels que la température, la densité, la disponibilité de la
nourriture et la granulométrie du sédiment [27] mais également la reproduction et la
pollution par divers xénobiotiques [28]. Notre étude sur la croissance (longueur, hauteur,
épaisseur et poids total frais) de D. trunculus au niveau des deux sites de la baie d'Annaba
révèle des différences significatives. En effet, les individus d’El Battah ont relativement une
meilleure croissance par rapport à ceux de Sidi Salem. En effet, il a été mis en évidence la
présence de métaux lourds (Plomb, Nickel, cuivre et Zinc) à des concentrations supérieures
au niveau de Sidi Salem par rapport à El Battah [3]. En accord avec les travaux antérieurs
[29, 30], l’exposition aux polluants peut affecter la croissance et le succès de la
reproduction chez les bivalves marins. En effet, l’altération de la croissance peut être
induite par les contaminants ou autre stress pouvant conduire à utiliser l’énergie destinée à
la croissance pour le système de détoxification (Lucas & Beninger, 1985; Nicholson &
Lam, 2005). D’après Fishelson et al. (1999) la croissance des populations de D. trunculus
collectés dans un site non pollué est meilleure que celle des individus collectés dans un site
pollué par des huiles et des résidus pétrochimiques dans la baie de Haifa (Palestine). Le
suivi des différents paramètres biométriques (la longueur, l’épaisseur, la hauteur et le poids
total frais) montrent une meilleure croissance au cours de la deuxième année (mars 2010février 2011) chez les individus de Sidi Salem.
Activité des biomarqueurs
Les contaminants produits par les activités anthropiques se retrouvent dans les milieux
aquatiques, en particulier estuariens et/ou côtiers et affectent les organismes [31, 32]. Ceuxci développent diverses stratégies physiologiques et biochimiques face à la toxicité des
polluants chimiques [33]. L’analyse des résultats de l’activité spécifique de l’AChE chez D.
trunculus échantillonnée au niveau des deux sites dans le golfe d’Annaba sur une durée de
deux années, montre une inhibition de l’activité de l’AChE chez les individus de Sidi Salem
comparativement à ceux d’El Battah. L’acétylcholinestérase est le meilleur révélateur de
contamination du milieu par les pesticides organophosphorés et les carbamates [36].
Toutefois, d’autres contaminants tels que les métaux lourds, les détergents et les toxines
algales peuvent inhiber l’AChE [34, 35]. Ceci confirme l’inhibition relativement plus
importante de l’AChE chez les individus provenant de Sidi Salem, un site contaminé par
des déchets industriels provenant du complexe FERTIAL, spécialisé dans la production des
fertilisants, et par des déchets domestiques véhiculés par l'oued Seybouse, ainsi que par des
métaux lourds [3, 6]. L’inhibition de l’AChE a été déjà rapportée chez D. trunculus
collectés dans la baie d'Annaba [4, 10, 36] et dans le golfe de Tunis [9].
Notre étude révèle une induction de l’activité GST plus marquée chez les individus de D.
trunculus collectés à Sidi Salem, comparativement à ceux d’El Battah, confirmant les
travaux antérieurs réalisés sur la même espèce [37, 10, 4, 38]. Cette induction de l’activité
GST est fonction de la pollution de l'eau [3] et peut être causée par des contaminants
organiques [39]. Une activité GST plus élevée est enregistrée chez M. galloprovincialis
collectés dans des sites pollués comparativement à un site de référence sur les côtes
espagnoles [39]. De plus, plusieurs études réalisées sur M. galloprovincialis montrent une
corrélation positive entre l’activité GST et la concentration en métaux lourds (Hg, Cd et Pb)
dans le sédiment [39].
L’activité CAT chez D. trunculus montre relativement le même profil que celui de la GST
avec une augmentation chez les bivalves collectés de Sidi Salem, suite à une exposition aux
différents contaminants dans l'environnement, sachant que ce site est contaminé par des
rejets urbains, agricoles et industriels. L’augmentation de l’activité CAT constitue une
réponse à la présence de ces contaminants. L'activité catalasique présente des avantages
évidents en tant que biomarqueur; cependant, la présence de grandes quantités de polluants
peut surpasser le système oxydant, ce qui va provoquer une peroxydation lipidique des
membranes cellulaires par un taux élevé en malondialdéhyde (MDA) chez les individus de
Sidi Salem comparativement à ceux d’El Battah [11]. Des travaux antérieurs montrent la
présence de métaux lourds dans le sédiment [3] et chez D. trunculus du golfe d’Annaba [6].
La catalase est souvent l'une des premières enzymes anti-oxydantes à être induites [40]. En
effet, une induction de l'activité CAT est enregistrée chez M. galloprovincialis due aux
métaux lourds [41] ainsi que chez P. viridis due au HAP et aux pesticides organochlorés
[42]. Nos résultats sont comparables à ceux observés sur D. trunculus collectés dans deux
sites différents sur le golfe de Tunis par [9] et Ruditapes decussatus collecté dans plusieurs
sites sur la côte tunisienne suivant un gradient de pollution [43].
La comparaison inter-sites des activités moyennes annuelles (AChE, GST, CAT) chez D.
trunculus montre une variation spatiale et temporelle des activités enzymatiques due au
niveau de pollution et aux différents facteurs environnementaux. Les individus collectés à
Sidi Salem présentent une inhibition de l’activité AChE, due à la présence de composants
neurotoxiques issus du complexe FERTIAL spécialisé dans la production des fertilisants et
des produits phytosanitaires. L’induction de l'activité GST est en relation avec la présence
plus importante de xénobiotiques dans le site de Sidi Salem stimulant ainsi le système de
détoxification. Concernant la CAT une augmentation significative est observée seulement
au cours de la période (mars 2009 - février 2010). Les individus de Sidi Salem subissent un
stress environnemental dû à la présence de différents contaminants. L’analyse de la variance
multivariée au niveau des deux sites et pour les trois biomarqueurs étudiés, révèle un effet
site et un effet mois pour les deux années d’étude.
CONCLUSION
La comparaison des différents paramètres biométriques mesurés chez D. trunculus révèle
une altération de la croissance dans le site de Sidi Salem par rapport à celui d'El Battah. La
mesure des biomarqueurs du stress environnemental montre une inhibition de l’activité
AChE et une induction du système de détoxification représenté par l’augmentation de
l’activité GST plus marquée à Sidi Salem en rapport avec la présence de polluants
neurotoxiques tels que les carbamates, les organophosphorés et les métaux lourds rejetés
dans la baie. Enfin, l’augmentation de l’activité CAT chez les individus indique un stress
oxydatif en rapport avec le niveau de pollution dans ce site. La présente étude montre que le
site de Sidi Salem est relativement le plus pollué. De plus, le niveau de pollution est
relativement stable d'une année à une autre à l’exception d’une augmentation dans
l’inhibition de l’activité AChE durant la période mars 2010-février 2011 par rapport à
l'année précédente (mars 2009 - février 2010) pouvant être expliquée par la présence de
pesticides et autres contaminants comme les métaux lourds.
REMERCIEMENTS
Cette étude a été réalisée au Laboratoire de Biologie Animale Appliquée dans le cadre de
deux projets (CNEPRU et PNR, Pr. N. Soltani) et a bénéficié du financement du Fonds
National Algérien de la Recherche et du Ministère de l’Enseignement Supérieur et de la
Recherche Scientifique.
REFERENCES
[1] El Jourmi, L. Amine, A. Mrani Alaoui, M. Lazar, S.Hmyene, A. El Antri, S.: Assessment of Water
Quality in Coastal Environments of Mohammedia Applying Responses of Biochemical Biomarkers
in the Brown Mussel Perna perna. Inter. J. Comp. Sci. 9(1): 1694-0814, 2012.
[2] Tlili S, Minguez L, Giamberini L, Geffard A, Boussetta H, Mouneyrac C.: Assessment of the health status
of Donax trunculus from the Gulf of Tunis using integrative biomarker indices. Ecolo. Indica. 32:
285–293, 2013.
[3] Abdennour C, Drif F, Boulakoud M.S, Ounissi M.: Trace metals in the mussel Donax trunculus of
Annaba estuaries, Algeria. Oceano. 1(6):15-20, 2010.
[4] Soltani N, Amira A, Sifi K. & Beldi H.: Environmental monitoring of the Annaba gulf (Algeria):
measurement of biomarkers in Donax trunculus and metallic pollution écotoxicologie. Bull. Soc.Zool.
Fr. 137(1-4): 47-56, 2012.
[5] Larba R, Soltani N.: Use of the land snail Helix aspersa for monitoring heavy metal soil contamination in
Northeast Algeria. Environ Monitor & Asses. 186 (8): 4987–4995, 2014.
[6] Beldi H, Gimbert F, Maas S, Scheifler R, Soltani N.: Seasonal variation of Cd,Cu,Pb and Zn in the edible
mollusk Donax trunculus (Mollusca, Bivalvia) from the gulf of Annaba ,Algeria. Afric. J. Agri .
Res.1(4): 85-90, 2006.
[7] Moukrim A.: Donax trunculus as a sentinel species for environmental monitoring of sandy beaches on
Morocan coasts. Bull. Environ. Contam. Tox. 73 (4): 674-681, 2004.
[8] Neuberger-Cywiak L, Achituv Y, Mizrahi L.: The ecology of Donax trunculus Linnaeus and Donax
semistriatus Poli from the Mediterranean coast of Israël. J. Exp. Mar. Biol. Ecol. 134: 203-220,
1990.
[9] Tlili S, Métais I, Boussetta H, Mouneyrac C.: Linking changes at sub-individual and population levels in
Donax trunculus: assessment of marine stress. Chemosphere, 81: 692–700, 2010.
[10] Amira A, K Sifi, Soltani N.: Measure of environmental stress biomarkers in Donax trunculus (Mollusca,
Bivalvia) from the gulf of Annaba (Algeria). Euro. J. Exper. Biol. 1(2): 7-16, 2011.
[11] Sifi K, Amira A, Soltani N.: Oxidative stress and biochemical composition in Donax trunculus
(Mollusca, Bivalvia) from the gulf of Annaba (Algeria). Adv. Environ. Biol, 7(4): 595-604, 2013.
[12] Fossi Tankoua O, Buffet P.E, Amiard J.C, Berthet B, Mouneyrac C, Amiard Triquet C.: Integrated
assessementof estuarinesediment quality based on multibiomarker approach in the bivalve
Scrobicularia plana. Ecotoxicol. Environ. Saf. 88:117-125, 2013.
[13] Bainy A.C.D, Medeiros M.H.G, Di Mascio P, Almeida E.A.: In vivo effects of metals on the
acetylcholinesterase activity of the Perna perna mussel’s digestive gland. Biotemas. 19:35-39, 2006.
[14] Moser V.C, Padilla S.: Esterase metabolism of cholinesterase inhibitors using rat liver in vitro.
Toxicology. 281 (1-3):56-62, 2011.
[15] Cailleaud K, Maillet G, Budzinski H, Souissi S, Forget-Leray J.: Effects of sali-nityand temperature on
the expression of enzymatic biomarkers in Eurytemora affinis (Calanoida, Copepoda). Comp.
Biochem. Physiol A. 147: 841-849, 2007.
[16]Roméo M, Hoarau P, Garello G, Gnassia Barelli,M, Girard J.P.: Mussel transplantation and biomarkers as
useful tools for assessing water quality in the NW Mediterranean. Environ. Pollut, 122: 369-78,
2003.
[17] Richardson B.J, Mak E, De Luca-Abbott S.B, Martin M, McClellan K, Lam P.K.S.: Antioxidant
responses to polycyclic aromatic hydrocarbons and organochlorine pesticides in greenlipped mussels
(Perna viridis): do mussels ‘‘integrate” biomarker responses? Mar. Pollut. Bull., 57: 503-514, 2008.
[18] Beninger P.G, Lucas A.: Seasonal variation in condition, reproductive on estuarine bivalve Molluscs in
the field. P. 57-58. In:Biology of benthique organisms (ed. B. F. Keegan, P. O., Ceidigh and P.J.S
Boaden). Pergamon Press, Oxford, 63 p, 1984.
[19] Ellman G.L,Courtney K.D, Andres V, Featherstone R.M.: A new and rapid colorimetric determination
of Acetylcholinesterase activity. Biochem Pharmacol. Physiol.Pharm., 38, 84, 1961.
[20] Zaidi,N-Soltani,N: Laboratory evaluation of environmental risk assessment of pesticides for mosquito
control: toxicity of dimilin on a larvivorous fish, Gambusia affinis. Advances in Environmental
Biology, 7(4): 605-613, 2013.
[21] Habig W.H, Pabst M.J, Jacobi W.B.: The first enzymatic step in mercapturic acid formation. J. Biol
.chem, 249: 7130-7139, 1974.
[22] Zaidi N, Soltani N.: Environmental risks of two chitin synthesis inhibitors on Gambusia affinis: chronic
effects on growth and recovery of biological responses. Biological. Control. 59 (2): 106-113, 2011.
[23] Claiborne A., In: R.A. Greenwald (Ed.). Handbook of Methods for Oxygen Radical Research CRC Press,
Boca Raton, FL., 283, 1985.
[24] Bradford M.M.: A rapid and sensitive method for the quantification of microgram quantities of protein
utilizing the Principe of protein-dye binding. Anal. Biochem., 72: 278-254, 1976.
[25] Ait Ayad M, Ait Fdil,M, Mouabad,A.: Effectsof Cypermethrin (Pyrethroid Insecticide)on the Valve
Activity Behavior, Byssal Thread Formation, and Survival in Air of the Marine Mussel Mytilus
galloprovincialis. Arch. Environ. Contam. Toxicol. 60: 462-470, 2011.
[26] Jiang Z, Wang G, Fang J, MAO Y.: Growth and food sources of pacific oyster Crassostrea gigas
integrated culture with Sea bass L ateolabrax japoncus in Ailian Bay, China. AquacultInt. 21:45-52,
2013.
[27] La Valle P, Nicoletti L, Finoia M.G, Ardizzone,G.D.: Donax trunculus (Bivalvia: Donacidae) as a
potential biological indicator of grain-size variations in beach sediment. Ecolo. Indic, 1426-1436 pp,
2011.
[28] Tezuka N, Kanematsu M, Asami K, Sakiyama K, Hamaguchi M, Usuki H.: Effect of salinity and
substrate grain size on larval settlement of the asari clam (Manila clam, Ruditapes philippinarum). J.
Exp. Mar. Biol. Ecol, 2013.
[29] Neudecker T.: Sex determination and maturation of the Pacific oyster (Crassostrea gigas) of the German
coast. European Mariculture Society. 6: 249-254, 1981.
[30] Steele S, Mulcahy M.F.: Gametogenesis of the oyster Crassostrea gigas in southern Ireland. J. Mar. Biol.
Ass. U.K, 79: 673-686, 1999.
[31] Langston W.J, Pope N.D, Jonas P.J.C, Nikitic C, Field M.D.R, Dowell B, Shillabeer N, Swarbrick R.H,
Brown A. R.: Contaminants in fine sediments and their consequences forbiota of the Severen
Estuary. Mar. Poll. Bull, 61: 68-82, 2010.
[32] Freitas R, Ramos Pinto L, Sampaio M, Costa A, Silva M, Rodrigues A.M, Quintino V, Figueira E.:
Effects of depuration on the element concentration in bivalves: Comparison between sympatric
Ruditapes decussatus and Ruditapes philippinarum. Estuar. Coast. Shel. Sci. Vol 110, p.43(11), 2012.
[33] Jebali J, Ben Khedher S, Ghedira J, Kamel N, Boussetta H.: Integrated assessment of biochemical
responses in Mediterranean crab (Carcinus maenas) collected from Monastir Bay, Tunisia. J.
Environ. Sci. 23(10): 1714–1720, 2011.
[34] Amiard-Triquet C.: Behavioral disturbances: the missing link between suborganismal and supraorganismal responses to stress? Prospects based on aquatic research. Hum. Ecol. Risk. Assess, 15: 87–
110, 2009.
[35] Lehtonen K.K, Kankaanpa H, Leiniِ S, Sipi V.O, Pflugmacher S, Sandberg Kilpi E.: Accumulation of
nodularin-like compounds from the cyanobacterium Nodularia spumigena and changes in
acetylcholinesterase activity in the clam Macoma balthica during short-term laboratory exposure.
Aquat. Toxicol. 64: 461–476, 2003.
[36] Tim-Tim A.L.S, Morgado F, Moreira S, Rangel R, Nogueira A.J.A, Soares A.M.V.M, Guilhermino:
Cholinesterase and glutathione S-transferase activities of three mollusc species from the NW
Portuguese coast in relation to the ‘Prestige’ oil spill. Chemosphere. 77: 1465–1475, 2009.
[37] Sifi K, Chouahda S, Soltani N.: Biosurveillance de l’environnement par la mesure de biomarqueurs chez
Donax trunculus dans le golfe d’Annaba (Algérie). Mésogée., 63: 11, 2007.
[38] Bensouda L, Soltani Mazouni N.: Measure of Oxidative Stress and Neurotoxicity Biomarkers in Donax
trunculus from the Gulf of Annaba (Algeria): Case of the Year 2012, 4(12):1902-1914, 2014.
[39] Vidal Liňán L.: Utilizaciِn de biomarcadores enzim‫ل‬ticos en mejillِn (Mytilus galloprovincialis) en la
evaluaciِn de la contaminaciِn de las R‫ي‬as de Vigo y Pontevedra. Advanced Studies Diploma,
University of Vigo, 2010.
[40] Cossu C, Doyotte A, Jacquin M.C, Vasseur P.: Biomarqueurs du stress oxydant chez les animaux
aquatiques. In: Lagadic, L., Caquet, T., Amiard, J.C., Ramade, F. (Eds.), Biomarqueurs en
écotoxicologie: Aspects fondamentaux. Masson, Paris, 149-163 pp, 1997.
[41] Vlahogianni T, Dassenakis M, Scoullos M.J, Valavanidis A.: Integrated use of biomarkers (superoxide
dismutase, catalase and lipid peroxidation) in mussels Mytilus galloprovincialis for assessing heavy
metals’ pollution in coastal areas from the Saronikos Gulf of Greece. Mar. Poll. Bull. 54: 136-171,
2007.
[42] Jebali J, Banni M, De Almeida E.A, Boussetta H.: Oxidative DNA damage levels and catalase activity in
the clam Ruditapes decussatus as pollution biomarkers of Tunisian marine environment. Environ
Monitor. Assess. 124(1-3): 195-200, 2007.
Le Barbeau de la Soummam Est-il Sterile ?
Le Barbeau de la Soummam est-il sterile ?
Djoudad-Kadji H.1,2, Rahmani A.1, Chevalier C.2, Kadji B.1, Exbrayat J. M2, Mouhoub C.1
Université A-Mira de Béjaïa, Targua Ouzammour 06000, Laboratoire de Zoologie Appliquée et
Physiologie Animale, Faculté des Sciences de la Nature et de la Vie., Algérie - [email protected];
[email protected]; [email protected]; [email protected]).
2
Université de Lyon, UMRS 449, Laboratoire de Biologie Générale, UCLy;
Laboratoire de Reproduction et Développement Comparé, EPHE, 25 rue du Plat,
([email protected]; [email protected]; [email protected]).
1
RESUME
Barbus callensis soupçonné stérile
Dans le cadre d’une étude portant sur le cycle sexuel de Barbus callensis (Valenciennes, 1842) de l’oued
Soummam, il a été constaté, chez certains individus, des cas d’hermaphrodisme synchrone. Les observations
macroscopiques des gonades mettent en évidence 18 cas d’hermaphrodisme parmi les 722 individus
examinés. Le but de ce travail est de vérifier la fonctionnalité ou non des individus intersexués. A cet effet,
une comparaison entre des gonades intersexuées (portions femelles) et des gonades femelles normales a été
établi par l’application de plusieurs méthodes statistiques sur des mensurations microscopiques effectuées sur
des coupes histologiques d’ovaires. Les résultats obtenus ont démontré une différence significative entre les
gonades normales et intersexuées, en se basant sur l’activité d’ovogenèse, ce qui nous ramène à soupçonner
la non fonctionnalité des gonades hermaphrodites de B. callensis.
Mots clés : Barbus callensis, intersexe, stérilité, fonctionnalité, oued Soummam.
INTRODUCTION
L'eau recouvre 71 % de la surface terrestre et l’eau douce nécessaire à tous les aspects de la
vie n’en, représente que 2.8 %. Ces eaux comprennent les cours d'eau, les lacs et les eaux
souterraines [1]. Malheureusement, ces milieux sont devenus la première cible pour
l'Homme qui les a modifiés et altérés par ses différentes activités. Il est responsable de la
défragmentation et la disparition des habitats, en raison de la surexploitation des ressources
due à la pêche et l’accélération du processus polluant par l’introduction de diverses toxines
industrielles, agricoles et urbaines, ce qui fragilise d’avantage les écosystèmes [2].
Les eaux continentales d’Algérie sont soumises à d'importantes perturbations anthropiques.
Ces écosystèmes dulçaquicoles sont devenus le réceptacle final de toutes sortes de
pollutions (physiques, chimiques ou biologiques), par conséquent, les êtres vivants dans ces
eaux sont les premiers à être exposés à de fortes concentrations de toxiques, induisant des
modifications profondes des communautés ichtyologiques [3].
Le Barbeau Barbus callensis (Valenciennes, 1842) très fréquent dans l'oued Soummam [3],
est aussi affecté par ces xénobiotiques [4]. Ce poisson est considéré comme un parfait
bioindicateur de la pollution [5]. Ce type de pollution, qui appartient à la catégorie des
« perturbateurs endocriniens PE» produit une altération du système reproducteur de
l'espèce, en causant d’apparentes mutations et transformations, par exemple des reversions
du sexe « Hermaphrodisme ou Intersexe » menaçant ainsi l'équilibre démographique, la
qualité génétique et l’évolution des populations animales, en général et des poissons en
particulier [6].
En effet, cet hermaphrodisme touchant les organes reproducteurs des poissons, causé par les
perturbateurs endocriniens, a été signalé dans le monde entier, y compris chez des
populations sauvages telles que celles du gardon Rutilus rutilus (Linnaeus 1758) [6,7,8,9],
du goujon Gobio gobio (Linnaeus 1758) [10] en Angleterre, de la brème Abramis brama
(Linnaeus 1758) aux Pays Bas [11], du teilapia Oreochromis mossambicus (Peters 1852) en
Afrique du Sud [12] et du barbeau Barbus callensis (Valenciennes 1842) à Béjaïa en
Algérie [4].
C’est dans cette problématique que s’inscrit cette étude qui vise à vérifier l’état et la
fonctionnalité des gonades intersexuées synchroniques (présence simultanée des ovaires et
testicules au sein d’un même individu) de Barbus callensis, en comparant la partie femelle
des gonades intersexuées à des ovaires normaux obtenus à partir d’individus ne présentant
que l’appareil reproducteur femelle.
Présentation de la zone d’échantillonnage
Les gonades ont été prélevées à partir d’individus femelles de Barbus callensis normaux et
intersexués échantillonnés dans l’oued Soummam, très connu pour sa grande prévalence en
divers polluants provenant de plusieurs sources [13,14,15,16,17].
L’oued Soummam se trouve dans la région de Béjaïa et représente l’un des principaux cours
d’eau algériens, il parcourt toute la vallée de la Soummam sur environ 90 km [18].
Préparation des lames histologiques
La technique appliquée pour la préparation histologique des coupes de gonades de Barbus
callensis est celle qui a été adaptée par Djoudad-Kadji & al. [19].
Mensurations
Nous avons effectué des mensurations sur les diamètres ovocytaires ainsi que les noyaux,
en plus nous avons compté le nombre d’ovocytes normaux présents sur chaque coupe
histologique. Ce travail a été réalisé de manière identique sur des parties femelles
intersexuées et normales.
Variation mensuelle du nombre d’ovocytes sains
En figure 01 on observe une diminution remarquable du nombre d’ovocytes sains dans le
cas normal durant les mois de mai et juin. A partir du mois d’août on constate une
augmentation de ce nombre qui régresse à partir de décembre. Un phénomène opposé a été
enregistré pour les ovaires hermaphrodites,. En effet, durant les mois de mai et juin le
nombre était maximal et diminuait à partir du mois d’août. A la période de reproduction, les
ovocytes grossissent chez les femelles normales et atteignent leurs tailles maximales
occupant ainsi de plus en plus d’espace sur les coupes étudiées, ce qui a comme
conséquence une diminution de la proportion en ovocytes sur les champs d’observation, ce
qui avait été démontré préalablement à cette étude. Chez les individus hermaphrodites; les
ovocytes sont moins évolué ce qui a comme conséquence la présence d’un nombre élevé
d’ovocytes sur un champ d’observation microscopique. Pendant la période du repos sexuel,
les ovocytes des femelles normales sont en regénération et présentent leurs premiers stades
d’évolution ; ils sont de petite taille, ce qui a comme conséquence une occupation minimale
de l’espace sur les coupes étudiées et une augmentation de leur nombre sur les coupes. La
diminution du nombre d’ovocytes dans ce cas à partir de décembre est due à la préparation
d’une nouvelle période de fraie [20,21,22].
Par contre, dans les ovaires hermaphrodites la présence d’une augmentation du nombre
d’ovocytes durant la saison de reproduction montre des ovocytes avec un petit diamètre aux
premiers stades d’évolution qui occupent un espace réduit sur les coupes observées. La
diminution du nombre des ovocytes durant le repos sexuel peut être expliquée par
l’apparition de la régénération du tissu mâle à la place de cellules femelles, ce qui
évidemment diminue l’espace disponible pour les ovocytes. Ce phénomène crée une
désorganisation marquante de l’évolution des portions femelles chez les hermaphrodites.
Un déséquilibre hormonal causé par des perturbateurs endocriniens pourrait expliquer ce
phénomène [6,7,8,9].
Figure 1 : Variations mensuelles du nombre d’ovocytes sains chez les femelles normales (NBR_OVSN)
et hermaphrodites (NBR_OVSH) de B. callensis pêchées dans l’oued Soummam.
Variation mensuelles des diamètres ovocytaires
Les diamètres ovocytaires des ovaires normaux sont à leur maximum en mai (Figure 02),
puis une régression est observée jusqu’au mois de décembre où on une nouvelle
augmentation de leur diamètre est constatée.
Des observations comparables sont ressorties de l’examen de la courbe de variation des
ovocytes du cas hermaphrodite, mais avec des diamètres inférieurs par rapport au cas
normal et cela durant la période de reproduction.
L’accroissement des diamètres ovocytaires, durant le mois de mai pour le cas normal, est dû
au stockage de protéines vitellines dans l'ovocyte [23], sachant que ce mois représente la
période intense d’activité sexuelle de B. callensis à laquelle les ovocytes connaissent leur
développement maximal. La diminution de ces diamètres à partir du mois de juin n’est
qu’une conséquence de la ponte. Pendant la phase du repos sexuel à partir du mois d’août,
les diamètres ovocytaires corrélativement à la régénération de la plupart des ovocytes
réduits aux stades primaires. A partir de décembre, la reprise de l’augmentation des
diamètres, est liée à la préparation d’un nouveau cycle de reproduction (apparition des
stades plus évolués) [20,21,24].
L’augmentation exceptionnelle des diamètres durant le mois d’octobre peut être expliquée
par la présence d’individus à reproduction tardive.
Les diamètres des ovocytes chez les hermaphrodites suivent la même cinétique que ceux
des cas normaux mais avec des valeurs de mesure inférieures. Cela n’est pas au hasard
puisque les ovocytes des individus hermaphrodites connaissent une évolution moindre par
rapport aux cas normaux. Pendant la phase du repos, cependant, la superposition des deux
courbes de cinétique est liée à la présence de stades d’évolution identiques au sein des deux
types d’ovaires.
Figure 02 : Variations mensuelles des diamètres d’ovocytes sains chez les femelles normales
(DIA__OVSN) et hermaphrodites (DIA_OVSH) de B. callensis pêchées dans l’oued Soummam
Variation mensuelle des diamètres des noyaux nucléaires
Les variations des diamètres des noyaux (Figure 03) rappelle parfaitement les variations des
diamètres ovocytaires dans les deux types d’ovaires. Les diamètres des noyaux des animaux
hermaphrodites ont suivi la même cinétique que dans les cas normaux mais toujours avec
des tailles réduites. Effectivement, la figure 03 ci dissous montre bien qu’au sein des deux
types d’ovaires, les variations sont parallèles : le diamètre du noyau augmente avec le
diamètre ovocytaire. Le diamètre des ovocytes et celui des noyaux chez les individus
normaux sont toujours supérieurs à ceux des hermaphrodites. Le diamètre nucléaire atteint
sa taille maximale au moment de la maturation de l’ovocyte en raison de la synthèse intense
d'ARN [24].
Figure 03 : Variations mensuelles des diamètres du noyau chez les femelles normales (DIA__NN) et
hermaphrodites (DIA_NH) de B. callensis pêchées dans l’oued Soummam.
CONCLUSION
L’analyse des différentes illustrations graphiques a permis de mettre en évidence des
différences marquantes entre les individus normaux et les hermaphrodites. Chez les
femelles normales, les diamètres des ovocytes et des noyaux sont à leur taille maximale
pendant la saison de reproduction, avec un nombre d’ovocytes apparemment minimal sur
les coupes. Pendant la période de repos sexuel et de régénération des gamètes, ces
paramètres sont inversés. Pour les ovaires sectionnés à partir d’individus intersexués les
coupes histologiques montrent une désorganisation du tissu femelle qui est envahi par du
tissu germinal mâle. En ce qui concerne les paramètres liés à l’activité ovogénique ont été
enregistrés : (1) une légère augmentation des diamètres des ovocytes et des noyaux pendant
la saison de reproduction, qui se limite qu’au premier ou deuxième stade d’évolution et
rarement au troisième ; (2) une évolution anormale sur coupes du nombre d’ovocytes si l’on
se réfère aux diamètres des ovocytes et des noyaux. Ce nombre augmente durant la saison
de reproduction parallèlement aux diamètres, ce qui n’est pas le cas lors de l’ovogénèse. La
phase du repos est caractérisée par la diminution du nombre d’ovocytes par l’occupation de
l’espace par un tissu germinal mâle en pleine activité régénératrice. Ces déductions résultant
d’une comparaison entre les gonades intersexuées (portions femelles) et les gonades
femelles normales laissent soupçonner une carence dans la fonctionnalité des gonades
hermaphrodites. Des études plus approfondies sont maintenant indispensables pour
confirmer la stérilité des individus intersexués de Barbus callensis de l’oued Soummam, en
examinant tous les aspects liés à l’activité sexuelle depuis la qualité du substrat jusqu’aux
modalités de la régulation hormonale.
BIBLIOGRAPHIE
[1] Sylla,I-. « Rumeurs et frayeurs autour de l'eau dans le monde ». ENDA Lead Africa, Senegal, 1-2 (2011).
[2] Trachsel,M-. « Perturbateurs endocriniens dans les eaux usées et dans le milieu aquatiquesé ». Programme
national de recherche, Fondation National de Suisse, document final 1, 16p (2008).
[3] Bacha,M- Amara, R- : « Les poissons des eaux continentales d’Algérie. Etude de l’ichtyofaune de la
Soummam ». Cybium, 3(3) : 351-358 (2007).
[4] Djoudad-Kadji,H- Benslimane,S- Chevalier,C- Kadji B- Exbrayat,JM- Iguer-Ouada,M-: “First observation
of intersex in barbel Barbus callensis (Valenciennes, 1842) collected in Soummam River (Algeria)”.
Cybium, 36 (4): 531-538 (2012a).
[5] Barbier,G- : «Rapport sur les perturbateurs endocriniens, le temps de la précaution». Assemblée Nationale
N° 3662, Sénat n° 765. Paris, 41p (2011).
[6] Jobling,S- Nolan,M- Tyler,CR- Brighty,G- Sumpter,JP- : “Widespread sexual disruption in wild fish”.
Environ. Sci. Technol., 32: 2498-2506 (1998).
[7] Jafri,SIH-: “Occurrence of an intersex condition in the roach Rutilus rutilus L.”. J. Fish. Biol., 14: 547-549
(1979).
[8] Purdom,CE- Hardiman,PA- Bye,VJ- Eno,NC- Tyler,CR- Sumpter,JP-: “Estrogenic effects of effluent from
sewage treatment works”. Chem. Ecol., 8: 275-285 (1994).
[9] Beresford,N- Jobling, S- Williams,R- Sumpter,JP- : “Endocrine disruption in juvenile roach from English
rivers: a preliminary study”. J. Fish. Biol., 64: 580-586 (2004).
[10] Van Aerle,R- Nolan,M- Jobling,S- Christian Sen,LB- Sumpter,JP- Tyler,CR-: “Sexual disruption in a
second species of wild cyprinid fish (the gudgeon, Gobio gobio) in United Kingdom freshwaters”.
Environ. Toxicol. Chem., 20: 2841-2847 (2001).
[11] Lahr,J- Kuiper,RV- Van Mullem,A-: “A field survey of estrogenic effects in freshwater and marine fish
in the Netherlands”. Soc. Environ. Toxicol. Chem., 6: 151-178 (2006).
[12] Barnhoorn,IEJ- Van Dyk,JC- Pieterse,GM-Bornman,MC- : «Intersex in feral indigenous freshwater
Oreochromis mossambicus, from various parts in the Luvuvhu River, Limpopo Province, South
Africa». Ecotoxicol. Environ. Saf., 73 (7):1537-1542 (2010).
[13] Dahdouh,NE- : « Situation de l’assainissement dans la willaya de Bejaia ». Communication Assises de
l’Eau, Béjaïa : 12p (1994).
[14] Mouni,L- Merabet,D- Arkoub,H- Moussaceb,K- : « Étude et caractérisation physico-chimique des eaux
de l’oued Soummam (Algérie) ». Sécheresse, 20: 360-366 (2009).
[15] Boudoukhana,H- : « Impacts des margines sur les eaux de oued Bouchtata (wilaya de Skikda). Mémoire
Magist. Univ. Skikda : 101p (2008).
[16] Maane-Messai,S- Laignel,B- Motelay-Massei,A- Madani,K- Chibane,M-: “Spatial and Temporal
Variability of Water Quality of an Urbanized River in Algeria: The Case of Soummam Wadi”. Water
Environ. Res., 82 (8): 742-749 (2010).
[17] Haffaf,S- : « Quelle perspective pour une gestion durable de la zone industrielle de Taharacht (Akbou) ».
Communication, Colloque International sur les Comportements des Entreprises Economiques
face aux enjeux du Développement Durable et de l’Equité Sociale (2012).
[18] Benhamiche,N- : « Modélisation de la relation pluie-relief en vue de la cartographie par Krigeage : cas du
bassin versant de la Soummam ». Mémoire magist., Inst. National Agronomique El- Harrach, Alger :
180p (1997).
[19] Djoudad-Kadji,H- Benslimane,S- Chevalier,C- Kadji B- Exbrayat,JM- Iguer-Ouada,M-: « Visualisation
des coupes histologiques des follicules ovariens de Barbus callensis: variation de fixateurs et de
colorants ». Rev. Fr. Histotechnol., 24 (1): 21-28 (2011).
[20] Bouhbouh,S- : « Bio-ecologie de Barbus callensis (Valencienne 1842) & Barbus fritschi (Günther 1874)
au niveau du reservoir Allal El Fassi (Maroc) ». Thèse Doct. Maroc : 168p (2002).
[21] Djoudad-Kadji,H- Benslimane,S- Chevalier,C- Kadji B- Exbrayat,JM- Iguer-Ouada,M- : « Description
histologique des différents stades de développement ovocytaire de Barbus callensis (Valenciennes,
1842) dans l’oued Soummam (Algérie) ». Rev. Fr. Histotechnol., 25 (1), 11-19 (2012b).
[22] Ould-Rouis,S- Ould-Rouis,A- Micha,JC- Arab,A-: « Biologie de la reproduction du Cyprinidae, Barbus
callensis dans le lac de barrage Hamiz (Algérie) ». Tropicultura, 30 (2) : 88-93 (2012).
[23] Tyler,CR- Sumpter,JP-: “Oocyte growth and development in teleosts”. Rev. Fish Biol. Fisch., 6: 287-318
(1996).
[24] Chevalier,C- : « Étude histologique du développement sexuel de l’apron du Rhône Zingel asper L.,
percidé endémique menacé d’extinction ». Thèse Doc. EPHE. Paris: 211p (2007).
Décontamination Biologique des Eaux Résiduaires de l’Oeud Méboudja par Elimination
des Microorganismes Sous l'Effet Epurateur d'un Hydrophyte : Elodea canadensis
Décontamination biologique des eaux résiduaires de l’Oeud Méboudja
(Annaba, Algérie) par élimination des microorganismes sous l'effet
épurateur d'un hydrophyte : Elodea canadensis
Lechekhab S.1, Lechekhab H.2, Belaz A.3
1
Département de Médecine, Faculté de Médecine. Université Badji Mokhtar - [email protected]
2
Département des Sciences Naturelles. Université d’El Tarf - [email protected]
3
Département de Biologie, Faculté des Sciences. Université Badji Mokhtar [email protected]
RESUME
Les analyses bactériologiques effectuées sur les eaux de l’Oeud Méboudja (Annaba, Nord-Est Algérien),
caractérisées par des rejets ménagers, agricoles et industriels, montrent qu'elles sont affectées à des taux
élevés par des Germes totaux, Coliformes fécaux, Streptocoques fécaux, Clostridiums et E. coli. Ces
microorganismes sont essentiellement des indicateurs de la pollution fécale, leur présence est due à la
pollution urbaine des agglomérations environnantes et au rassemblement des unités industrielles avec leur
composante humaine. L'utilisation d'Elodea canadensis (Michaux, 1803), caractérisé par son rôle
purificateur, a permis de constater une décontamination totale de ces eaux résiduaires en éliminant tous les
germes de façon définitive après 15 jours d’expérimentation. Ceci s’explique par l’épuisement du milieu en
éléments nutritifs par cet hydrophyte (compétition entre les bactéries et la plante), ce qui va empêcher, à long
terme, les microorganismes de survivre dans le même biotope.
Mots-clés : Pollution, eaux résiduaires, Elodea canadensis, purification, microbiologie, Oued Méboudja,
Annaba - Algérie.
ABSTRACT
Bacteriological tests on the waters of Oued Méboudja (Annaba, Algeria), characterized by household,
agricultural and industrial wastewater, show that they are affected at high levels by total germs, fecal
Coliforms, fecal Streptococci and E. coli. These microorganisms are mainly indicators of faecal pollution,
their presence is due to urban pollution of the surrounding towns and gathering industrial units with their
human component. The use of Elodea canadensis (Michaux, 1803), characterized by its purifying role, has
allowed to observe a total decontamination of wastewater by eliminating all germs permanently after 15 days
of experiment. This is due to the exhaustion of nutrients by this hydrophyte (competition between bacteria and
plants), which will prevent, long term, the microorganisms to survive in the same biotope possibly releasing
secondary metabolites capable change the physicochemical characteristics of the external water environment.
After this experiment proving the good purification yield of E. canadensis, water collected Oued Méboudja
became purified and thus classified as waters of acceptable quality, especially knowing that this is one of the
tributaries in the Mediterranean through Oued Seybouse.
Key words: Pollution, waste water, Elodea canadensis, purification, microbiological parameters, Oued
Méboudja, Annaba - Algeria.
INTRODUCTION
Les rejets urbains, industriels et agricoles représentent les causes essentielles de la pollution
des sources hydriques dans la région d’Annaba, Nord-Est Algérien. C’est le cas de l’Oeud
Méboudja, un affluent de l’Oeud Seybouse déversant en Méditerranée, menacé par
l’abondance de production des eaux usées non contrôlées et non traitées. L’utilisation de ces
eaux usées notamment dans l’irrigation par les riverains nécessite un contrôle et un
traitement préalable afin d’éviter les dangereuses répercutions sur la santé publique [1].
Plusieurs méthodes sont utilisées pour le recyclage des eaux résiduaires tel que l’utilisation
des traitements biologiques d’épuration comme l’introduction des plantes à capacité de
filtration, de bioaccumulation et rôle purificateur [2]. Les élodées, hydrophytes à effet
dépuratif, totalement immergés, sont utilisés dans des milieux hydriques polluées, propices
à leurs proliférations [3]. Les colonisations de ces milieux aquatiques engendrent souvent
des modifications de certains paramètres environnementaux, physiques et/ou chimiques [4].
Les capacités d’épuration biologique d’Elodea canadensis sont mises en évidence par la
décontamination microbienne des eaux résiduaires de l’Oeud Méboudja.
Matériel biologique
Elodea canadensis (Michaux, 1803) (Fig. 1) est un hydrophyte de la famille des
Hydrocharitacées, totalement immergé au sein de la masse d’eau. C’est une plante herbacée
vivace à longue durée de vie. Elle présente de longues et fines tiges ramifiées pouvant
atteindre 1 m de long et possède un feuillage vert sombre avec des feuilles verticillées par
trois [5]. Des racines adventives peuvent apparaître sur la tige présentant, à l’état frais, des
apex de couleur blanchâtre à verdâtre [6].
Figure 1. Elodea canadensis (Michaux, 1803)
Pour l’étude de son rôle purificateur des eaux, 15 g de ce macrophyte sont introduits dans
1,50 l respectivement d’eau déchlorée (témoin) et des eaux échantillonnée au niveau des 4
sites de prélèvement de l’Oeud Méboudja (à raison de 1 g de plante / 100 ml d’eau).
Sites de prélèvement
Oued Méboudja (36°47'10.43"N et 7°45'26.76"E) localisé dans la région d’Annaba NordEst Algérien se déverse dans la mer méditerranée par le biais de l’Oeud Seybouse sans
traitement préalable [7].
Quatre points de prélèvement ont été choisis le long de l’Oeud Méboudja selon le type de
pollution par rapport aux sources des rejets résiduaires industriels agricoles et urbains (Fig.
2) :
 Site 01 : caractérisé par une pollution urbaine et agricole au début de l’Oeud
Méboudja à son embouchure au lac Fetzara (36°47'30,09"N et 7°29'11,73"E),
 Site 02 : caractérisé par une pollution urbaine (présence de rejets des réseaux
d’assainissement des agglomérations limitrophes) et par une pollution agricole
(abondance des terres des exploitations environnantes).
 Site 03 : caractérisé par une pollution industrielle (sortie des rejets du pôle
d’industrie métallurgique Arcelor-Mittal).
 Site 04 : caractérisé par une pollution industrielle et lieu de stagnation des eaux
selon sa topographie.
Figure 1 : Localisation des sites de prélèvement le long de l’Oeud Méboudja (Annaba, Nord-Est
Algérien)
Méthode de prélèvement des eaux résiduaires
Les échantillons des eaux usées sont effectués en Avril 2010 au niveau des 4 sites de
prélèvement de l’Oeud Méboudja selon la norme d’échantillonnage AFNOR 90-512, 1988 à
une distance suffisante des points de rejets, en tenant compte de la dilution, afin d’obtenir
des prélèvements homogènes et représentatifs [8].
Analyse bactériologique des eaux
L’étude microbiologique est effectuée par l’identification qualitative et quantitative des
bactéries en recherchant les Coliformes totaux, Escherichia coli, les Streptocoques fécaux,
les Clostridiums et les Germes totaux. Les analyses bactériologiques des eaux résiduaires
échantillonnées ainsi que l’eau témoin déchlorée sont effectuées avant l’introduction
d’Elodea canadensis puis après 7 et 15 jours d’expérimentation. La méthode d’analyse
utilisée dans le cas des Coliformes totaux, E. coli et des Streptocoques fécaux est basée sur
le test de fermentation des tubes multiples, afin de déceler le nombre le plus probable (NPP)
de germes dans 100 ml d’eau et ce par incubation dans des milieux liquides. Quant aux
Clostridiums et aux Germes totaux la méthode d’analyse et celle de la culture en milieu
gélosé (TGEA) [9].
RESULTATS
Les Coliformes fécaux
Avant l’introduction d’E canadensis, les Coliformes fécaux sont uniquement détecté à un
ordre croissant dans les eaux prélevées respectivement au niveau des sites 1, 4 et 2.
Cependant, après 7 jours d’expérimentation, ces bactéries évoluent considérablement
atteignant particulièrement des taux très élevés dans l’eau témoin déclorée et celle du site 4.
En revanche une baisse très significative des Coliformes fécaux est observée au 15 ème jour
d’épuration dans l’ensemble des eaux analysées (Fig. 2).
Figure 2 : Variation du taux des Coliformes fécaux au niveau des eaux analysées
Escherichia coli
La présence d’E. coli a été détectée le jour du prélèvement à des taux croissants dans les
eaux résiduaires respectivement des sites de prélèvement 1, 4 et 2 alors que l’eau témoin et
celle du site 3 n'en contenaient pas. À partir du 7 ème jour d’expérimentation, E. coli n’est
plus détectée dans l’eau du 1er site, alors qu’elle persiste dans celle du 2 ème site et envahit le
milieu témoin, l’eau du site 3 et encore plus celle du site 4. Au 15ème jour, le taux de cette
bactérie est réduit dans l’eau du 3 ème site, elle n’est plus aperçue en revanche dans les
analyses du milieu témoin et des sites 2 et 4 (Fig. 3).
Figure 3 : Variation du taux d’E. coli au niveau des eaux analysées
Les Streptocoques fécaux
L'analyse bactériologique indique que si l’eau témoin est totalement dépourvue des
Streptocoques fécaux, les eaux résiduaires des 4 sites de prélèvement en sont fortement
contaminées. Cette bactérie régresse à partir du 7ème jour d’expérimentation de ces milieux
hydriques qui deviennent totalement décontaminés au 15 ème jour (Fig. 4).
Figure 4 : Variation du taux des Streptocoques fécaux au niveau des eaux analysées
Les Clostridiums
Le jour de prélèvement et après 7 jours d’épuration l’intensité des Clostridiums les rend
indénombrable (supérieurs à 8000) dans les eaux usées des 4 sites, alors qu'après 15 jours
leur nombre subi une chute considérable dans l'ensemble des eaux résiduaires pour
n’atteindre qu’une spore dans les sites 1, 3 et 4 et deux spores dans le site 2. Pour l'eau
témoin, cette bactérie n'a pas été détectée (Fig. 5).
Figure 5 : Variation du taux des Clostridiums au niveau des eaux analysées
Les Germes totaux
Le taux des Germes totaux pendant l'épuration expérimentale varie selon les milieux
hydriques étudiés. Les analyses des eaux des sites 1 et 3 présentent une diminution
progressivement du taux de ces germes pendant l’expérience. Cependant, au niveau de l’eau
témoin ainsi que dans celle des sites 2 et 4, cette bactérie devient plus abondante au 7 ème
jour d’expérience pour décliner au 15ème jour (Fig. 6).
Figure 6 : Variation du taux des Germes totaux au niveau des eaux analysées
DISCUSSION
Les analyses bactériologiques effectuées le jour du prélèvement montrent l’absence de
Coliformes fécaux dans les eaux échantillonnées à l'exception celle du site 2 due aux rejets
urbains des agglomérations environnantes et du site 4 caractérisé par le rassemblement des
unités industrielles avec leur composante humaine. Ceci expliquerait aussi les taux élevés
d’E. coli détectés au niveau de ce dernier site ainsi que les sites 1 et 2 concernés par une
pollution urbaine. De même pour les Germes totaux qui sont largement quantifiés dans les
eaux des sites 1 et 3 à rejets urbains et moins dans ceux à rejets industriels. Quant aux
Streptocoques fécaux ils sont fortement présents dans l'ensemble des eaux résiduaires
analysés. Ces micro-organismes sont des indicateurs de la pollution fécales leur présence
est due aux rejets urbains [10].
Le taux indénombrable de Clostridiums dans l’ensembles des eaux analysées est due à une
combinaison entre des rejets domestiques et animaliés provenant des fermes implantées le
long de l’Oeud Méboudja. Il reflètent également une contamination probablement due aux
cadavres des animaux rejetés dans ce cours d’eau [11].
Les élodées se développent dans des eaux relativement riches en nutriments et en minéraux
qui lui assurent un développement optimal [12]. Ces hydrophytes possèdent une capacité
élevée de libération d’O2 dissous par la photosynthèse après l’épuisement total des
nutriments du milieu [13].
Elodea canadensis est beaucoup plus réactive aux Nitrates et aux Phosphates présents dans
les eaux polluées issues des activités humaines [14] et utilise au mieux la disponibilité des
nutriments comme le Phosphore, l’Azote et le Carbone [15]. Ces macrophytes caractérisés
de "nitratophiles" sont des plantes très productives lors de dépollution de sites [5].
L’effet purificateur d’E. canadensis est démontré par les résultats des analyses
microbiologiques des eaux obtenus après 15 jours d’épuration biologique, par la
dégradation totale des populations bactériennes. Ceci s’explique par la libération d’O 2
dissous et l’épuisement du milieu nutritif (compétition entre les bactéries et la plante) alors
que l’augmentation du taux des bactéries durant les 7 premiers jours est probablement due à
l’enrichissement du milieu nutritif [16]. En effet, la colonisation des milieux aquatiques par
les hydrophytes engendre souvent des modifications de certains paramètres
environnementaux et sont généralement le fait d’une espèce ou d’un petit groupe d’espèces
adaptées à ces modifications [4]. Ces plantes présentent une large amplitude trophique et se
comportent comme des agents de rétention temporaire d’éléments et nutriments des eaux,
tel que le Phosphore et les Nitrates [17]. Elles épuisent les éléments nutritifs en se
développant ce qui va empêcher les autres espèces, tels que les microorganismes, de
survivre dans le même biotope en dégageant des métabolites secondaires capables de
modifier les caractéristiques physicochimiques du milieu externe [18] [19].
CONCLUSION
La décontamination des eaux résiduaires par l’action d’Elodea canadensis s’explique par
l’épuisement du milieu en éléments nutritifs par cet hydrophyte (compétition entre les
bactéries et la plante), ce qui va empêcher, après 15 jours de leur introduction, les
microorganismes de survivre dans le même biotope, en modifiant ainsi les caractéristiques
physicochimiques du milieu hydrique. Les eaux de l’Oeud Méboudja sont devenues
purifiées ce qui prouve le bon rendement d’épuration d’E. canadensis.
BIBLIOGRAPHIE
[1] Boudjema N., Nacef K. & Abderrahmani A. : Valorisation des eaux usées traités en irrigation; Laboratoire
de traitement des eaux usées, Université des Sciences et de la Technologie Houari Boumediene
Alger, 26 p. (2006).
[2] Valiron F. : La réutilisation des eaux usées. Edition de BRGM. BP 6009. F 45060. Orléons Cedex ISBN et
technique et documentation Lavoisier F 75384 Paris Cedex 08.ISBN. 37-129. (1983).
[3] Peltre M.C., Petitdidier D., Leglize L. & Muller S. : Proliférations macrophytiques sur le plan d’eau de
Madine (Meuse). Estimation quantitative et possibilités de gestion. 16ème Conférence du COLUMA.
Reims. Ann. ANPP, III, 1401-1409. (1995).
[4] Dutartre A., Haury J. & Planty-Tabacchi A.M. : Introductions de macrophytes aquatiques et riverains dans
les hydrosystèmes français métropolitains : essai de bilan. Bull. Fr. Pêche Piscic., 344/345, 407-426.
(1997).
[5] Saint-Maxent T. : Gestion des Ressources Naturelles Renouvelables. Diplôme d’Etudes Supérieures
Spécialisées. 16-20. (2002).
[6] Barbe J. & Barthelemy R. : Conditions de développement et gestion des proliférations de cyanobactéries
sur le Vieux Rhône de Belley. Rapport d’étude CNR, 26 p. (1994).
[7] Hamdaoui S. : L’interaction entre sels solides et métaux lourds (Pd) dans les sédiments de l’oued
Méboudja et l’étude d’une séquence temporelle. Mémoire d’ingénieur en écologie et
l’environnement, Univ. Annaba, 15 p. (2000).
[8] Rodier J., Champsaur H., Bazin C., Broutin J.P., Chanbon P. & Rodi L. : Analyse des eaux : eaux
naturelles, eaux résiduaires et eaux de mers. Ed Dunod, 8 e Edition, Paris, 1383 p. (2005).
[9] Rejsek R. : Analyse des eaux – Aspects réglementaires et techniques, biologie technique CRDP
d’Aquitaine, 55-120. (2002).
[10] Bourgeois C.M. : Technique d'analyse et de contrôle sans les industries agroalimentaire. Technique et
documentation, Paris. Vol. 3. 90-224. (1980).
[11] Le Cann P. & Gourmelon M. : Contamination microbienne en mer par les rejets urbains et agricoles.
Docuement IFREMER. 120 p. (2006).
[12] Blake G. : Rôle des végétaux aquatiques vis-à-vis du phosphore dans les écosystèmes et les systèmes
d'épuration in Le phosphore, ses dérivés et leur comportement dans le milieu naturel, Dijon, 22-24
novembre 1988, 1-14. (1988).
[13] Daniel H. & Haury J. : Les macrophytes aquatiques : une métrique de l’environnement en rivière.
Cybium, 20 (3 suppl.), 129-142. (1996).
[14] Rolland T. : Approche écophysiologique du rôle de l'azote ammoniacal dans la répartition de deux
macrophytes aquatiques, Elodea canadensis (Michaux) et Elodea nuttallii (St. John.) Impact sur
l'Activité Nitrate Reductase et l'Activité Photosynthétique. Thèse de Doctorat, Strasbourg, 1-303.
(1995).
[15] Dlstenholme R. & Bayes D. : An evaluation of nutrient removal by the reed been treatment system at
valley field, file, Scotland pergmon press, lawprc conference “Advances in water pollution control”,
193-148. (1990).
[16] Wolverton B.C. : Aquatic plant /microbial filters for treating septic tank effluent. Ed. Donald A. Hammer,
compte rendue de conferences : Constructed wetlands for waster treatment municipal ,industrial and
agricultural. 173-178. (1990).
[17] Robach F., Merlin S. & Tremolieres M. : Relations entre la végétation aquatique et la qualité de l'eau en
plaine d'Alsace. Rôle particulier du phosphore. Rapport Agence de l'eau Rhin-Meuse, 1-122. (1996).
[18] Brix H. : Fonctions of macrophytes in Constructed. Wat. Sci. Tech 29. 71-78. (1994).
[19] Weisner S.E.B., Eriksson P.G., Graneli W. & Leonardson L. : Influence of macrophytes on nitrate
removal in wetlands Ambio 23: 363-366. (1994).
Evaluation of the Sea Water Quality of Mostaganem Bay through the Sea Urchin
Paracentrotus lividus (Lmk) Bioindicator
Evaluation of the sea water quality of Mostaganem bay through the sea
urchin Paracentrotus lividus (Lmk) bioindicator
Oulhiz A.1, 2, Soualili D. L.1 ; Mezali K.1
1
Department of Marine Science and Aquaculture, 2Department of Biology, Faculty of Natural
Science and life, Abdelhamid Ibn Badis University of Mostaganem (UMAB), 27000,PO Box 300,
Algeria. Email: [email protected]
SUMMARY
Since the last decade, the use of biological indicators in assessing the quality of the environment has become
one of the latest methods in the history of environmental science. Indeed, any human activity (industrial,
agricultural or tourism development) cause a very important environmental pressure on coastal marine
species assemblage. For this, we chose to test the quality of sea waters off the coast of Mostaganem, using the
test of larval development of the purple sea urchin Paracentrotus lividus (Lamarck, 1816), species widely
used for this type of analysis. In fact, the sensitive phase of embryonic and larval development of the sea
urchin is used as a bioindicator of the health of the marine environment. Two sites situated in the
Mostaganem coastline (Stidia and Kharouba) were selected. This choice is based on their exposure to
different sources of pollution. The use of the echinoid P. lividus revealed a higher degree of disturbance at the
site of Kharouba marked by a relatively low rate of normal larvae (71.2%) against the highest rate (84.1 %)
obtained at Stidia station. The analysis was thorough two years later, by studying the ability of the sea urchins
to normal and viable larvae (tests of fertilization and larval development), at the site of Kharouba. Also, the
temporal comparison of the obtained results during the two years (2011-2013) confirmed that the site of
Kharouba is in state of continuous disturbance; caused by the pressure originating from various
anthropogenic activities.
Key words: Biological indicators, Paracentrotus lividus, larval development, pollution, Mostaganem.
INTRODUCTION
The Mediterranean coastal area has long been known to serious environmental problems
caused by human activities such as fishing, industrialization and urban development [1]
(KEBIR, 1996). Mostaganem is one of the major Algerian coastal cities affected by the
anthropogenic pressure that causes varying degrees of environmental disturbances. In this
regard, the evaluation of the quality of the coastal marine environment requires a provision
of tools for biomonitoring such as a testing protocol using the marine invertebrates’
embryo-larval development. This is the case for the purple sea urchin Paracentrotus lividus,
a species used as biological indicators to determine the health status of the shallow water
area [2] (Chapman et al., 1991; 1992).
Study sites
Two sites were selected: Stidia and Kharouba (Fig. 1). The sites were chosen according to
their exposure to different sources of pollution.
Figure 1. Map of the coast of Mostaganem showing the situation of both studied sites
(Stidia and Kharouba).
Sampling
The biological material
Ten (10) individuals of P. lividus (ranging from 4cm to 6cm in size) were collected from
the site of Stidia at a depth ranging from -1 to -3 meters during two months (June and
October 2011). In June 2013, another sampling (10 individuals of P. lividus) was carried
out at Kharouba station (Fig. 1). In the laboratory, we use the color of the gonadal liquid for
sex identification (orange in the female, white in male) (Fig. 2).
Figure 2. Distinction between female (A) and male (B) of the purple sea urchin P. lividus
using the color of the gonadal liquid
Sediment and seawater
The surface sediment of each studied site (where P. lividus individuals were collected) is
removed, stored in plastic bag, transported using a cooler (4 °C) and processed immediately
upon arrival at the laboratory. The seawater used for this type of analysis is sampled from
each site, filtered and stored at 4 °C.
Methods of analysis
To test the quality of larval development of P. lividus, we used the protocol of Quiniou et
al. (1999) adapted by Soualili (2008). The analysis was performed for 5 fertilizing eggs by
females individually pooled from 3 male sperm. Once fertilized eggs are obtained, they are
able to develop in contact with the sediment originating from the different studied sites.
Fertilized eggs are then incubated for 72h at loboratory temperature, then some drops of
formalin (35%) are added. Stages of development are performed on the basis of the four
categories defined by Pagano et al. (1988) (NL: normal larvae; ANL: abnormal larvae; DL:
delayed larvae; BL: blastula larvae). The percentages of each stage are then calculated and
tested by ANOVA single factor (Site, P <0.05), followed by Dunnett's test.
Biological evaluation of the quality of the marine environment of the different studied
sites
Given the high percentage of normal larvae obtained in the test of larval development of P.
lividus to assess the quality of coastal waters (Tab.1), the site of Stidia, could be considered
the least disturbed site compared to Kharouba site (Fig.3).
Table 1. Frequencies of different types of larvae obtained after exposure of Paracentrotus
lividus embryos to sediment originating from the studied sites. NL: normal larvae; ANL:
abnormal larvae; DL: delayed larvae; BL: blastula larvae.
Control
Stidia
Kharouba
NL
94.9
84.1
71.2
ANL
0
8.3
17.1
BL
0
1.5
2.4
DL
5.1
6.1
9.3
Figure 3. Percentages of normal larvae of P. lividus exposed to the sediments
originating from the different studied sites.
The analysis shows that the lowest percentage of normal larvae is obtained in the site of
Kharouba (71.2%). In contrast, the highest value is obtained in the control (94.9%). We also
note at the site of Stidia that the value of the normal rate of larvae is near to the control.
There isa significant difference between the sites and the control (P = 0.024 < 0.05).
The statistical tests (Dunnett and Tukey HSD) applied to normal larvae showed a difference
with those obtained with the control at the site of Kharouba (P = 0.01 < 0.05), while for the
site of Stidia, no significant difference of the different categories of larvae with the control,
was detected (P ≈ 0.05 ). Therefore, we could classify the degree of disturbance of the
studied sites according to the following gradient:
Sites
Stidia
Kharouba
(-)
(+)
Degree of disturbance of the sediment quality of the studied sites.
Biological assessment of marine environmental quality of Kharouba site in 2013.
The results obtained in 2011, discriminate the site of Kharouba as the most disturbed site
compared to Stidia environment. In 2013, a long-term monitoring was performed on the site
of Kharouba to assess the ecological status of its marine environment. We studied the water
quality of this site in the same manner as the tests (larval development of P.lividus) carried
out in 2011, subjecting the fertilized eggs of Kharouba water of their own station.
Monitoring of embryonic development revealed a normal rate of pluteus larvae (51.16%,
Tab.2).
It is noticed that P. lividus poulation of Kharouba site, have the capacity to produce viable
pluteus larvaes at fairly significant values. However, these values are lower than those
observed in 2011 when P. lividus has a high percentage of normal larvae (71.2%, Tab.2).
The latter was considered as a disturbed site.
Table 2. Mean requencies of the obtained larvaes categories (2011-2013) NL: normal larvae;
ANL: abnormal larvae; BL: blastula larvae; DL: Delayed larvae.
Kharouba (2011)
Kharouba (2013)
NL
71.2
51.16
ANL
16.1
48.9
BL
5.4
0.3
DL
7.3
0
We can conclude that the current environmental status of the Kharouba site has a strong
effect on the inhibition of larval development of P. lividus.
CONCLUSION
This study assessed the quality of the marine environment of the coast of Mostaganem
through the purple sea urchin Paracentrotus lividus, a species widely used as bioindicator.
The results showed that the larval development quality of P. lividus, revealed and
confirmed a general satisfactory condition at Stidia site. However, the Kharouba site, shows
a signs of environmental degradation caused by human activities (tourism, coastal
management…).
REFERENCES
[1] Kebir L., 1996. Mediterranean Institutions: the Action Plan for the Mediterranean (PAM).
http://base.dph.info/en/fiches/premierdph/fiche-premierdph-2229.html.
[2] Chapman P. M., Power E. A., Dexter R. N., Andersen H. B., 1991. Evaluation of effects Associated with
year oil platform using the sediment quality triad. Environ. Toxicol. Chem., 10: 407-424.
[2] Chapman P. M., Swartz R. C., Roddie B., Phelps H. L., Van den Hurk P., Butler R., 1992. An international
comparison of sediment toxicity tests in the North Sea. Mar. Ecol. Prog. Se., 91: 253-264.
[3] Quiniou F., Guillou M., A. Judas, 1999. Arrest and delay in embryonic development in sea urchin
populations of the Bay of Brest (Brittany, France); link with environmental factoring. Mar. Pollut.
Bull., 38 (5): 401-406.
[4] Soualili D. L., 2008. Natural populations of sea urchins: an evaluator tool of the state of health of the Bay
of Algiers. PhD thesis. University of Algiers, 130p.
[5] Pagano G., Cipollaro M., Corsale G., Esposito A., Giordano G. G., Ragucci E., Trieff N. M., 1988.
Comparative toxicities of Benzene, Chlorobenzene Dichlorobenzene and Sea Urchin Embryos and to
Sperm. Bull. Environ. Contam. Toxicol., 40: 481-488.
Risque Environnemental du Cadmium chez Donax trunculus (Mollusca, Bivalvia) :
Effet Sub-Létal sur le Taux des Acides Nucléiques dans les Gonades
Risque environnemental du cadmium chez Donax trunculus (Mollusca,
Bivalvia) : effet sublétal sur le taux des acides nucléiques dans les gonades
1
Merad Isma1, Soltani Noureddine2
Laboratoire de Biologie Animale Appliquée, Faculté des sciences, Département de Biologie, Université
d’Annaba, E-mail: [email protected])
2
Professeur, Laboratoire de Biologie Animale Appliquée, Faculté des sciences, Département de Biologie,
Université d’Annaba, E-mail: [email protected]
RESUME
Les travaux antérieurs ont mis en évidence une contamination majeure par le cadmium dans le golfe
d’Annaba (Nord-Est Algérien). Ce polluant très toxique a été détecté dans les tissus de Donax trunculus
(Bivalvia, Donacidae) avec un effet site et saison significatif. L’objectif de cette étude est d’évaluer l’impact
du cadmium sur les taux des acides nucléiques (ADN et ARN) au niveau des gonades de D. trunculus au cours
de la période de repos (sexe non séparé) et de reproduction printanière (sexe séparé). Les échantillons ont été
collectés à El Battah, un site éloigné des sources de pollution et élevés au laboratoire dans des conditions
contrôlées. Le cadmium a été additionné à l’eau d’élevage à deux concentrations sublétales (CL10 et CL2596h). L’analyse des acides nucléiques (ADN et ARN) a été effectuée à différents temps d’expositions (0, 24,
48, 72 et 96h). Nos résultats révèlent qu’on période de repos sexuel le cadmium ne manifeste pas d’effet sur
les taux d’ADN, mais affecte significativement (p<0,05) le taux d’ARN. En période d’activité sexuelle ce
xénobiotique provoque une réduction significative des taux d’ADN uniquement chez les femelles, alors que les
taux d’ARN diminuent chez les deux sexes. Une analyse de la variance (ANOVA) à 2 critères de classification
a été réalisée en période de repos, elle révèle un effet temps pour les taux d’ADN et des effets temps et
traitement pour le taux d’ARN. L’ANOVA à 3 critères de classification en période de reproduction révèle des
effets temps, traitement sexe pour les deux acides nucléiques.
Mots clés: Golfe d’Annaba, Donax trunculus, Reproduction, Repos, Cadmium, ADN, ARN.
INTRODUCTION
Le golfe d’Annaba est le plus important pôle touristique et économique installé sur la côte
Est algérienne. Toutefois, Ses ressources halieutiques sont menacées par une pollution liée à
une activité économique en plein essor. Les travaux antérieurs ont permis la mise en
évidence d’une contamination métallique dans cette région par le cadmium [1, 2]. En effet,
ce polluant très toxique, aux propriétés cumulatives et non biodégradables [3] a été détecté
dans les tissus de Donax trunculus (Bivalvia, Donacidae) [4, 1]. De plus, des études menées
au laboratoire ont montré que le cadmium peut affecter l’équilibre entre les systèmes pro- et
anti-oxydant et causer ainsi un stress oxydatif chez cette espèce [5] utilisée dans la
biosurveillance de la qualité des eaux du golfe [6, 7, 8]. Son cycle reproducteur a été
examiné précédemment [9]. Dans ce contexte, notre travail vise a évaluer l’effet sublétal du
cadmium (CL10 et CL25-96h) sur les taux des acides nucléiques (ADN et ARN) au niveau
des gonades de D. trunculus au cours de la période de repos (sexe non séparé) et de
reproduction printanière (sexe séparé).
Matériel biologique et conditions expérimentales
Donax trunculus (Linnaeus, 1758) est un Mollusque Bivalve, sédentaire et filtreur très
répandu dans le golfe d’Annaba [10] et est consommé par les populations locales. La
récolte des échantillons a été faite au niveau du site El Battah (36°50’ N et 7° 56’ E), situé à
environ 30 kilomètres à l'Est d'Annaba et est caractérisé par son éloignement de toute
source de pollution et un régime hydrodynamique important. L’échantillonnage de D.
trunculus a été effectué d’une manière aléatoire à l’aide d’un râteau à main lors de la
période de reproduction printanière et avant la ponte des gamètes (mars 2013) et durant le
repos sexuel (novembre 2013). Les animaux sont transportés au laboratoire dans des bacs
en plastique, puis 100 individus de taille moyenne 25 ± 2 mm et dont le sexe est séparé
préalablement en période d’activité sexuelle sont sélectionnés. La différence entre les deux
sexes chez D. trunculus est basée sur la couleur de la gonade durant la période d’activité
sexuelle uniquement. Les mâles présentent une gonade blanche ou jaunâtre à produit sexuel
blanc et visqueux, alors que les femelles montrent une gonade d’un bleu intense à produit
sexuel bleu granuleux [11, 12]. Les individus sont élevés dans des aquariums munis de
pompes à air (Nirox X5), remplis d’environ 10 cm de sable, et 30L d’eau de mer dont les
paramètres physico-chimiques en période de reproduction sont les suivants: température:
15,60 ± 1,42 °C, salinité: 33,35 ± 1,06 g /L, pH: 8,09 ± 0,00, oxygène dissous: 1,86 ± 0,44
mg/L. Durant le repos sexuel ces conditions sont: température 13,80 ± 1,22 °C; salinité
30,10 ± 1,00 g /L; pH 7,19 ± 0,02 et oxygène dissous 1,39 ± 0,31 mg/L. La phase
d’acclimatation des individus dure 48h avant d’être traités à deux concentrations sublétales
du cadmium (CL10 et CL25-96h) préalablement déterminées (Tableau 1).
Tableau 1. Toxicité du cadmium (mg/L) chez D. trunculus : détermination de la CL10, CL25
(IC: intervalle de confiance) (96h)
Traitement
CL10 (IC)
CL25 (IC)
En période de reproduction
Mâles
Femelles
1,15 (0,89-1,47)
0,94 (0,74-1,18)
2,02 (1,57-2,58)
1,60 (1,26-2,01)
En période de repos sexuel
2,03 (1,52-2,69)
3,85 (2,89-5,12)
Extraction et dosage des acides nucléiques
Un dosage individuel biochimique des acides nucléiques est effectué au niveau des gonades
prélevées des séries témoins et traitées au cadmium (CL10 et CL25 96 h) à différents temps
d’exposition (0, 24, 48, 72, 96h). Les acides nucléiques ont été extraits selon le procédé de
Shibko et al. [13] et dosés selon des méthodes colorimétriques décrites précédemment [14,
15]. L’ARN a été quantifié en utilisant l'orcinol comme réactif [16] et l'’ADN comme
réactif la diphénylamine [17].
ANALYSE STATISTIQUE
Les données sont représentées par la moyenne plus ou moins l’écart-type (m ± SD). Elles
ont été traitées statistiquement à l'aide du logiciel Minitab Software (Version 16, PA State
College, USA). Une analyse de la variance à deux critères de classification (temps,
traitement) a été effectuée pour les données enregistrées en période de repos tandis qu'une
analyse de la variance à trois critères de classification (temps, traitement, et sexe) pour
celles obtenues en période de reproduction. Les tests t de Student et de Tukey ont été
également utilisés. Le niveau de signification est p<0,05.
RESULTATS
Le cycle de reproduction de D. trunculus montre d’importantes variations en fonction des
facteurs climatiques saisonniers. On observe une période de repos durant l’automne et
l’hiver et une période d’activité qui débute en hiver et qui se termine en été. Plus
spécifiquement, la période de repos sexuel sur la côte d’Annaba s'étale de septembre à
novembre, quant à la période d'activité durant laquelle nous pouvons distinguée les sexes,
elle s'étale de décembre à août [18].
Effet du cadmium sur le taux des acides nucléiques gonadiques en période de repos
sexuel
En période de repos sexuel, les taux d’ADN ne sont pas affecter par le traitement au
cadmium (Fig. A), alors que les taux d’ARN sont significativement réduits avec la
concentration la plus élevée (CL25) à partir de 72h, et également après exposition à la CL10 à
la fin de l’expérimentation (96h) (Fig. 1 B). L’analyse de la variance à 2 critères de
classification (temps, traitement) révèle un effet temps (F4, 60= 4,43; p= 0,003) pour les taux
d’ADN et des effets temps (F4, 60= 12,48; p< 0,001) et traitement (F2, 60= 5,56; p= 0,006)
pour le taux d’ARN.
Taux d'ADN (µg/mg de tissu)
16
14
12
10
8
6
4
2
0
0
8
Taux d‘ARN (µg/mg de tissu)
Témoins
CL10
CL25
A
24
48
72
Temps d’exposition (heures)
96
Témoins
CL10
CL25
B
7
6
*
5
**
4
3
2
1
0
0
24
48
72
Temps d’exposition (heures)
96
Figure 1. Effet du cadmium sur le taux d’ADN (A) et d’ARN (B) au niveau des gonades de D. trunculus
pendant la période de repos sexuel (m ± SD, n=5)
Effet du cadmium sur le taux des acides nucléiques gonadiques en période de
reproduction
Chez les mâles de D. trunculus, les taux d’ADN ne varient pas significativement au cours
du temps d'exposition au cadmium (Fig. 2A), alors que chez les femelles, les taux d’ADN
sont significativement réduits avec la concentration la plus élevée (CL25) au terme de
l’exposition (Fig. 2B). L’ANOVA à 3 critères de classification révèle des effets temps (F4,
120= 6,02; p< 0,001), traitement (F2, 120= 4,76; p= 0,010) et sexe (F1, 120= 1009,16; p< 0,001)
significatifs.
45
40
35
30
25
20
15
10
5
0
Témoins
CL10
Taux d'ADN (µg/mg de
tissu)
A
0
30
24
48
72
Temps d'exposition (heures)
96
Témoin
s
B
Taux d'ADN (µg/mg de
tissu)
25
**
20
15
10
5
0
0
24
48
72
Temps d'exposition (heures)
96
Figure 2. Effet du cadmium sur le taux d’ADN chez les mâles (A) et les femelles (B) de D. trunculus
pendant la période de reproduction (m ± SD, n=5)
Chez les individus mâles de D. trunculus, les taux d’ARN diminuent après traitement à la
CL25 dés 48h (Fig. 3A), alors que chez les femelles, les taux d’ARN sont significativement
réduits seulement avec la concentration la plus élevée (CL25) et à partir de 72h (Fig. 3B).
L’ANOVA à 3 critères de classification révèle des effets temps (F4, 120= 10,73; p< 0,001),
traitement (F2, 120= 9,73; p< 0,001) et sexe (F1, 120= 1173,07; p< 0,001).
Taux d'ARN (µg/mg de
tissu)
12
Témoin
s
A
10
8
*
6
*
*
4
2
0
0
16
14
12
10
8
6
4
2
0
24
48
72
Temps d'exposition
(heures)
96
Témoin
s
Taux d'ARN (µg/mg de
tissu)
B
**
**
0
24
48
72
96
Temps d'exposition
Figure 3. Effet du cadmium sur le taux(heures)
d’ARN chez les mâles (A) et les femelles (B) de D. trunculus
pendant la période de reproduction (m ± SD, n=5)
DISCUSSION
L'ADN est une composante essentielle de toute matière vivante et contient le code
génétique d'un organisme. La plupart de l'ADN est contenue dans le noyau de la cellule, et
quelques pour cent du total sont présents dans les mitochondries et les centrioles. L’ARN
assure le transfert du code génétique de l'ADN nucléaire au cytoplasme, et la synthèse des
protéines. La synthèse de l’ARN à partir de l’ADN est assurée par l’ARN polymérase,
l’enzyme dirigeant la transcription. Alors que l’ADN polymérase intervient dans la
réplication de l’ADN au cours du cycle cellulaire, mais aussi dans des processus de
réparation et de recombinaison de l'ADN [19, 20, 21]. Les travaux antérieurs ont montré
que la pollution métallique est prépondérante à Annaba, notamment par le cadmium [18].
Ce métal lourd a une toxicité prononcé même à de faibles concentrations. Dans le milieu
aquatique, il s’accumule à de haut niveau de la chaîne alimentaire, vu qu’il est considéré
comme un métal non redox. Enfin, il est connu pour avoir des effets sur la croissance et la
reproduction de D. trunculus [22, 23]. Le cycle sexuel de D. trunculus dans la baie
d’Annaba présente une période d’activité sexuelle s’étalant du mois de décembre jusqu'au
mois d’août, et une période de repos sexuel automnal. Deux périodes de recrutements ont
été révélées, l’une au printemps et l’autre en automne [18]. Dans notre étude, les valeurs
des acides nucléiques chez les individus D. trunculus varient en fonction de l’activité
sexuelle et du sexe au cours d'une exposition au cadmium à des concentrations sublétales.
En période de repos, les taux d’ADN ne sont pas affecter par le traitement au cadmium,
alors que les taux d’ARN sont significativement réduits avec la concentration la plus élevée.
En période de reproduction, les taux d’ADN restent stables chez les mâles après exposition
au cadmium, alors que chez les femelles, ils sont significativement réduits avec la CL 25,
suggérant une plus grande sensibilité des femelles en présence ce toxique. Pour les taux
d’ARN, une diminution après traitement à la CL25 est observée chez les deux sexes. Ceci
est en accord avec une autre étude réalisée sur D. trunculus, dans laquelle une réduction des
taux d’ADN au niveau du manteau est observée durant les périodes de repos et de
reproduction, tandis qu'une diminution des taux d’ARN est enregistrée uniquement en
période de reproduction à Sidi Salem, un site touché par la pollution métallique [24, 25].
Chez un autre Bivalve, Placopecten magellanicus, en plein période de différenciation des
gamètes, et exposé à de faibles doses de cuivre et de cadmium, une diminution des
concentrations d’ARN et d’ADN est notée chez les deux sexes [26], confirmant ainsi nos
résultats en période de reproduction. Les taux d’acides nucléiques varient en fonction du
cycle reproducteur, de la disponibilité de la nourriture et de la température de l’eau de mer
dans laquelle se trouvent les individus [27]. En effet, la température est un facteur important
ayant un impact directe sur la fonction des enzymes, et D. trunculus n’a pas la capacité de
réguler sa température et dépend entièrement de la température de son environnement qui
peut modifier sa physiologie et sa biochimie, et sachant que la température modifie
également les caractéristiques chimiques des métaux, ceci pourrait expliquer la différence
de réponse des acides nucléiques au cadmium en fonction des périodes de repos (novembre)
et de reproduction (mars) [28, 29]. Une fois dans la cellule, les métaux vont rapidement
s’accumuler dans le noyau. A ce niveau, ils vont stimuler la synthèse d’ARNm codant pour
les métallothionéines (MTs), inhiber l’activité de l’ARN polymérase I et II responsable de
la synthèse de l’ARNr et l’ARNm respectivement, notant que l’ARNr forme 85-90% de
l’ARN totale du noyau et du cytoplasme. Ils peuvent altérer la structure et le métabolisme
de l’ADN et causer des anomalies au niveau des chromosomes [30, 31, 32]. La génotoxicité
du chlorure de cadmium à de faibles concentrations à été démontrée chez les organismes
aquatiques [33], Les mécanismes de génotoxicité de ce métal restent encore mal connus et
plusieurs hypothèses sont avancées. Il pourrait produire des dommages à l’ADN en créant
des cassures simple brin [34] ou indirectement par la production de radicaux libres [35], ou
encore une inhibition des enzymes de réparation de l’ADN [36]. La formation d’espèces
réactives de l’oxygène (ROS) peut attaquer les deux acides nucléiques et entraîner ainsi une
destruction et un dysfonctionnement de leurs fonctions [37]. L’effet sexe mis en évidence
pour les deux acides nucléiques en période de reproduction et où les femelles semblent être
plus sensible peut s’expliquer par le fait que les protéines sont plutôt mobilisées durant la
reproduction pour la synthèse de vitellines [38], alors que les protéines peuvent servir
comme source d’énergie par l’utilisation des acides aminés dans la synthèse du glucose par
néoglucogenèse durant une exposition aux polluants [39].
CONCLUSION
Les analyses biochimiques réalisées chez D. trunculus exposé à des concentrations
sublétales de cadmium révèlent que ce métal induit en période de repos une diminution
significative des taux d’ARN uniquement. En période de reproduction, nous avons observé
une réduction du taux d’ADN chez les femelles seulement et de l’ARN chez les deux sexes
avec un effet plus marqué chez les femelles. L’ARN qui est précurseur essentiel de la
synthése des protéines répond rapidement aux changements des conditions
environnementales, du cycle reproducteur et de la croissance de l’individu et de son état
nutritionnel. En effet, les taux d’ARN semblent généralement plus variables que les taux
d’ADN vu qu’ils sont restés stables après traitement au cadmium, sauf chez les femelles en
période d’activité sexuelle. L'étude électrophorètique des protéines gonadiques et l'analyse
des acides gras par chromatographique en phase gazeuse en cours apporteront des
informations complémentaires.
REMERCIEMENTS
deux projets (CNEPRU et PNR, Pr. N. Soltani) et a bénéficié du financement du Fonds
National Algérien de la Recherche et du Ministère de l’Enseignement Supérieur et de la
Recherche Scientifique.
REFERENCES
[1] Beldi,H-Gimbert,F-Maas,S-Scheifler,R-Soltani,N: Seasonal variation of Cd,Cu,Pb and Zn in the edible
mollusk Donax trunculus (Mollusca, Bivalvia) from the gulf of Annaba, Algeria. Afric. J. Agri . Res.,
1(4): 85-90, 2006.
[2] Abdennour,C-Drif,F-Boulakoud,M.S-Ounissi,M: Trace metals in the mussel Donax trunculus of Annaba
estuaries, Algeria. Oceanogr., 1(6):15-20, 2010.
[3] Opuene,K-Okafor,E,C-Agbozu,E: Partitioning Characteristics of Heavy Metals in a Non Tidal Freshwater
Ecosystem. Int. J. Environ. Res., 2(3): 285-290. 2008
[4] Drifi,F-Abdennour,C: Trace Metals in the Mussel Donax trunculus Linnaeus 1758 from Urban and
Industrial Contaminated Locations. J. Appl. Sci. Res., 6(12): 2063-2067, 2010.
[5] Belabed,S-Soltani,N: Acute toxicity of cadmium on Donax trunculus: acetylcholinesterase, glutathione Stransferase activities and pattern of recovery. Europ J of Exp Biol., 3(2): 54-61, 2013.
[6] Amira,A-Sifi, K-Soltani,N: Measure of environmental stress biomarkers in Donax trunculus (Mollusca,
Bivalvia) from the gulf of Annaba (Algeria). Euro. J. Exper. Biol., 1(2): 7-16, 2011.
[7] Soltani,N-Amira,A-Sifi ,K- Beldi,H: Environmental monitoring of the Annaba gulf (Algeria):
measurement of biomarkers in Donax trunculus and metallic pollution écotoxicologie. Bull.
Soc.Zool., Fr. 137(1-4): 47-56, 2012.
[8] Sifi,K-Amira,A-Soltani,N: Oxidative stress and biochemical composition in Donax trunculus (Mollusca,
Bivalvia) from the gulf of Annaba (Algeria). Adv. Environ. Biol., 7(4): 595-604, 2013.
[9] Hamdani,A-Soltani-Mazouni,N: Changes in Biochemical Composition of the Gonads of Donax trunculus
L. (Mollusca, Bivalvia) from the Gulf of Annaba (Algeria) in Relation to Reproductive Events and
Pollution. Jordan J. Biol. Sci., 4 (3): 149-156, 2011.
[10] Beldi,H: Etude de Gambusia affinis (Poisson, Téléostéen) et Donax trunculus (Mollusque, Pélécypode) :
écologie, physiologie et impacts de quelques altéragènes. Thèse de doctorat d’état en Sciences
Naturelles, mention Biologie Animale, Université d’Annaba. p. 105, 2007.
[11] Lucas,A: Recherche sur la sexualité des Mollusques Bivalves. Thèse, Rennes,
135p. In : Mouëza
M., 1971. Contribution à l’étude de l’écologie et de la biologie de Donax trunculus L. (Mollusque :
Lamellibranche). Thèse de Doctorat en Sciences Biologiques, mention Océanographie. p.130, 1965.
[12] Mouëza,M- Frenkiel-Renault,L: Contribution à l’étude de la biologie de Donax trunculus L. (Mollusque
Lamellibranche) dans l’Algérois: la reproduction. Cah. Biol. Mar., 14: 261-283, 1973.
[13] Shibko,S-Koivistoinen,P-Tratyneck,C-Newhall,A-Freidman,L: A method for thevsequential quantitative
separation and glycogen from a single rat liver homogenate or from avsub cellular fraction. Anal.
Biochem., 19: 415-428,1966.
[14] Soltani-Mazouni,N-Soltani,N: Diflubenzuron affected DNA synthesis in the ovaries ofTenebrio molitor.
Inv. Rep. Dev., 25(1): 19-21, 1994.
[15] Soltani-Mazouni,N-Hami,M: Effets de deux agonistes des ecdystéroïdes sur la reproduction chez
Ephestia kuehniella (Insectes, Lépidoptères): dosage des acides nucléiques et des protéines ovariens.
O. Himmi (Ed.). Actes de la CIFE VI, Travaux de l’Institut Scientifique, Série Zoologie, Rabat.,
47(1): 153-156, 2010.
[16] Burton,A: Study of the condition and mecanisme of the diphenylamine reaction for the colorinetric
estumation of desoxyribonucleic acid. Biochimy., 62: 315-323, 1956.
[17] Schneider,W ,C: Determination of nucleic acids in tissues by pentose analysis. In methods in enzymology
(Ed. by Colowick S. P. and Kaplan N. O.). Acad. Press, N. Y., 3: 680-684, 1957.
[18] Hamdani,A: La reproduction chez un mollusque bivalve Donax trunculus L. dans le golfe d’Annaba.
Rapport entre les aspects cytologique et biochimique et la pollution. Thèse de Doctorat en Biologie
Animale, option: Reproduction et Développement, Université d’Annaba. p. 333, 2013.
[19] Granick,S-Gabor,A: The DNA of chloroplasts, mitochondna, and centrioles. LN. Davidson and W.E.
Cohn, Eds. Progress in nucleic acid research and molecular biology., 6: 143 - 186 In:Academic
Press, Inc., New York, N.Y, 1967.
[20] Devi,A-Lindsay,P-Sarker,N,K: Synthesis and breakdown of proteins and ribonucleic acid in Triboiium
confusum, Duval. Experientia., 19:344-345, 1963.
[21] Munro,H,N-Fleck,A: The determination of nucleic acids, D. Glick, [ed.] Methods of éiochemical
analysis. Interscience Publishers, New York, W., 14: 423-525, 1966.
[22] Leung,K,M,Y- Furness R,W: Survival, growth, metallothionein and glycogen levels of Nucella lapillus
(L.) exposed to sub-chronic cadmium stress: the influence of nutritional state and prey type. Mar.
Environ Res., 52: 173–94, 2001.
[23] Neuberger-Cywiak,L-Achituv,Y-Garcia,E,M : Effects of Sublethal Zn++ and Cd++ Concentrations on
Filtration Rate, Absorption Efficiency and Scope for Growth in Donax trunculus (Bivalvia;
Donacidae). Bull Environ Contam Toxicol., 79:622–627, 2007.
[24] Hamdani,A : Caractérisation biochimique des populations de Donax trunculus vivant dans deux sites d
golfe d’Annaba: analyse quantitative des acides nucléiques et qualitative et quantitative des
protéines. Mémoire de magister, option : protection de l’environnement, Université d’Annaba. p. 76,
2007.
[25] Khati-Amira,A: Utilisation de Donax trunculus pour l’évaluation de l’état de santé du golfe d’Annaba et
impact de la pollution métallique. Thèse de doctorat en Biologie Animale, Université Badji Mokhtar,
Annaba. p. 182, 2014.
[26] Gould,E-Thompson,R,J-Buckley,L,J-Rusanowsky,D-Sennefelder,G,R: Uptake and effects of copper and
cadmium in the gonad of the scallop Placopecten magellanicus: concurrent metal exposure. Mar
Biol., 97: 217-223, 1988.
[27] Norkko,J-Norkko,A-Thrush,S,F-Cummings,V,G: Seasonal variations in the nucleic acid content and
RNA:DNA ratio of the gonad of the scallop Pecten maximus. J. Exp. Mar. Biol. Ecol., 326: 144–156,
2005.
[28] Dame,R,F: Ecology of Marine Bivalves an Ecosystem Approach. CRC Press: Boca Raton., 19–26, 1992.
[29] Mubiana,V,K-Blust,R: Effects of temperature on scope for growth and accumulation of Cd, Co, Cu and
Pb by the marine bivalve Mytilus edulis. Mar. Environ. Res., 63: 219–235, 2007.
[30] Bryan,S,E-Hidalgo,H,A: Nuclear cadmium: uptake and disappearance correlated with cadmium –binding
protein synthesis. Biochem. Biophys. Res. Commun., 68: 858-865, 1976.
[31] Young,V,R: The role of skeletal muscle and cardiac muscle in the regulation of protein metabolism. pp
585-674 In: H.N. Munro [Ed.] Mamrnalian protein metabolism, Vol. N. Acadernic Press, New York,
NY, 1970.
[32] Viarengo,A-Pertica,M-Mancinelli,G-Palmero,S-Orunesu,M: Effects of Cu++ on nuclear RNA
polymerase activities in mussel digestive gland. Mar. Biol. Lett., 3: 345-353, 1982.
[33] Sanchez-Galan,S-Linde,A,R-Garcia-Vazquez,E: Brown trout and European Minnow as target species for
genotoxicity tests: differential sensitivity to heavy metals. Ecotoxicol. Environ. Saf., 43, 301–304,
199.
[34] Hassoun,E.A-Stohs,S,J: Cadmium-induced production of superoxide anion and nitric oxide, DNA single
strand breaks and lactate dehydrogenase leakage in J774A.1 cell cultures. Toxicol., 112(3): 219-226,
1996.
[35] Zhong,Z-Troll,W-Koenig,K,L-Frenkel,K : Carcinogenic Sulfide Salts of Nickel and Cadmium Induce
H2O2 Formation by Human Polymorphonuclear Leukocytes. Cancer Research., 50(23): 7564-7570,
1990.
[36] Hartwig,A: Carcinogenicity of metal compounds: Possible role of DNA repair inhibition.Toxicology
Letters 102-103: 235-239, 1998.
[37] Cossu,C-Doyotte,A-Jacquin,M,C-Vasseur,B : Mécanismes de formation et effets des espèces réactives de
l’oxygène », pp.125-147 dans L. Lagadic, T. Caquet, J.-C. Amiard, et F. Ramade (eds), «
Biomarqueurs en écotoxicologie : aspects fondamentaux », Masson, Paris. P.419, 1997.
[38]
Johnson,L-Casillas,E-Mistitano,D-Collier,T-Stein,J,E,B-Cain,M,C-Varanasi,V:
Bioindicators
of
reproductive impairment in female English sole (Parophyrus vetulus) exposed to environmental
contaminants. In: Oceans 89, vol. 2, Ocean Pollution Marine Technology Society, Oceanic
Engineering Society of the IEEE Seattle, Washington, DC, 391-396 pp, 1989.
[39] Vijayavel,K-Anbuselvam,C-Balasubramanian,M,P-Deepak-Samuel,V-Gopalakrishnan,S: Assessment of
biochemical components and enzyme activities in the estuarine crab Scylla tranquebarica from
naphthalene contaminated habitants. Ecotoxicol., 15(5): 469-476, 2006.
Isolation of Multiresistant Opportunistic Bacteria from Estuarine Waters in Algiers
Isolation of multiresistant opportunistic bacteria from estuarine waters in
Algiers
Djouadi L.N.1, Arab D.1, Boularaf M.1, Bouacem K.1, Bouanane-Darenfed A.1, Abderrahmani A .1,
Fardeau M.L.2, Nateche-Metiaz F. 1
1
Laboratory of Cellular and Molecular Biology, Microbiology team, Faculty of Biological Sciences,
USTHB Bab-ezzouar - Corresponding author: [email protected]
2
Aix-Marseille Université, Université du Sud Toulon-Var, CNRS/INSU, IRD, MIO, UM 110, 13288,
Marseille, cedex 09, France
SUMMARY
Two strains known as opportunistic bacteria belonging to the species Brevundimonas vancanneytii and
Bordetella bronchiseptica were isolated from two different estuarine waters in Algiers and identified by 16s r
RNA gene sequencing. Their resistance to heavy metals and antibiotics was tested. Both strains showed high
levels of resistance towards most of the antibacterial molecules tested. These results prove the presence of
multiresistant opportunistic pathogen bacteria in Algerian estuaries, implying consequences on marine
wildlife and Human health.
Keywords: Estuary, Opportunistic bacteria, Antibiotic resistance, Heavy metal resistance, Human health.
INTRODUCTION
Brevundimonas has been reported in multiple cases of infections in patients with cancer and
in subjects in aplasia. It is, thus, considered as an opportunistic bacterium [1]. Bordetella
bronchiseptica has been recognized as a respiratory tract pathogen of mammals since 1910
[2]. It is also known as an opportunistic bacterium for humans since it causes diseases on
immunodepressed subjects [3]. Opportunistic bacteria, as described by Von Graevenitz [4],
are normally non virulent bacteria that take advantage on an immune system depression to
express their pathogenicity. Thus, they can cause severe infections in weakened subjects.
A major part of these bacteria are ubiquitous since they possess a great potential to adapt to
various environments, as polluted and non polluted waters, soils and many other ecological
niches. Besides, opportunistic bacteria are particularly hard to eradicate as they are often
found to be multiresistant to antibiotics.
Surface waters in Algiers often receive domestic, industrial and hospital effluents, leading
to the presence of antibiotics and heavy-metals in these environments. The contaminants
present in surface waters constitute a selective force in bacterial communities which may
become resistant to different antibiotics and heavy metals. Indeed, several studies suggest
that genes encoding resistance to heavy metals can be located together with antibiotic
resistance genes on either the same genetic structure (such as plasmids or integrons), or
different genetic structures within the same bacterial strain [5-6-7-8].
Moreover, resistance to heavy metals has been reported to enhance the antibiotic resistance
ability of bacteria [9]. Antibiotics overused in hospitals and heavy metals used in industry
and household products are creating a selective pressure in the environment that lead to
mutations in bacteria that will allow them better survive and multiply.
Oued El-Harrach, in east Algiers, and Oued Beni-Messous, in ouest Algiers, both receive
effluents from many industries and hospitals and from domestic sewage. This two rivers
discharge directly into the Mediterranean Sea, without any treatment. The aim of this study
was to investigate the presence of multiresistant opportunistic bacteria in these two estuaries
in Algiers allowing us to estimate the bacteriological pollution threat to immunodepressed
human subjects and to the marine wildlife.
METHODOLOGY
Sample collection:
The estuaries samples were collected from Oued Beni-Messous and Oued El-harrach
outfalls (pouring into the Mediterranean Sea) in sterile glass bottles and were transported to
laboratory where they were processed within 4 hours.
Bacteria isolation:
The multiresistant opportunistic bacteria isolation was made on Luria-Bertani agar (LBA)
supplemented with three antibiotics, an antifungal and an antiseptic. 50 mL of water sample
were concentrated by centrifugation at 6000 rpm for 20 minutes. The pellets were recovered
and inoculated on BHIA plates. Cultures were incubated at 30°C for 24 hours to 7 days.
Bacteria Identification:
After growth, isolates were analyzed by Gram staining, activities of oxidase, catalase,
nitrate reductase, VP-MR test, motility, indole production, citrate utilization and respiratory
type according to Bergey’s manual of systematic Bacteriology [10].
Our isolates were, then, identified by API 20 E and API 20 NE galleries (API system,
Biomerieux, France).
A confirmative molecular identification was carried out by 16s r DNA sequence analysis.
After DNA extraction, a fragment of the 16s r RNA gene was amplified by PCR using
universal primers F (5’ AGAGTTTGATCCTGGCTCAG 3’) and R (5’ AAG GAG
GTGATCCAGCCGCA 3’). Purified amplicons were sequenced and 16s r RNA sequences
were aligned and compared with other 16s r RNA genes using the NCBI basic local
alignment search tool (BLASTn) program [11].
Determination of antibiotic resistance
Disk diffusion method on Mueller-Hinton agar plates, as described by Bauer et al. [12], was
used to test the resistance or sensitivity of the bacterial strains towards 34 antibiotics. The
following antibiotic disks (Bio-Rad, Hercules, CA, USA and Hi-media, India) were used
(μg or International Unit “IU”/disk): : Amoxicillin+ clavulanic acid (AMC) 30 µg,
Ampicillin (AMP) 10 µg, Amoxicillin (AMX) 25µg, Amikacin (AK) 30 µg, Bacitracin (B)
10UI, Chloromphenicol (C) 30µg, Ceftazidime (CAZ) 30µg, Cefixime (CFM) 5µg,
Cefoperazone (CFP) 75µg, Cephalotin (CH) 30µg, Ciprofloxacin (CIP) 5µg, Cefaclore (CJ)
30µg, Colistin (CS) 10µg, Céfotaxim (CTX) 30µg, Céfazolin (CZ) 30µg, Erythromycin (E)
15µg, Cephoxitin (FOX) 30µg Imipenem (IMP) 10µg, Lincomycin (L) 15µg, Mezlocillin
(MZ) 75µg, Neomycin (N) 30UI, nalidixic acid (NA) 30µg, Nitroxolin (NI) 20µg,
Novobiocin (NV) 30µg, Oxacillin (OX) 5µg, Pénicillin (P) 10UI, pipémedic acid (PI)
20µg, Pristinamycin (PT) 15µg, Streptomycin (S) 10µg, Spiramycin (SP) 100µg,
Sulphonamid (SSS) 300 µg, Tetracyclin (TE) 30µg, Vancomycin (VA) 30µg, Virginamycin
(VI) 15µg.
The results were interpreted according to the guidelines of the Antibiogram Committee of
the French Society for Microbiology. E. coli ATCC 25922 was used as a control strain for
antimicrobial susceptibility testing.
Determination of minimum inhibitory concentrations of heavy metals
Minimum inhibitory concentrations (MIC) of heavy metals were determined by spot plate
method as described by Malik and Aleem [7]. The metals Hg 2+, Pb2+, Cd 2+, Cr 6+, Co 2+,
Cu 2+, Zn 2+ and Li+ were added to Mueller-Hinton agar at varying concentrations, ranging
from 50 to 3000 µg/mL, where test strains were spot-inoculated. The plates were incubated
at 30°C for, at least, 48 hours. The MIC was defined as the minimum concentration of
heavy metal which inhibits the growth of the test strain [7-8].
Isolation and identification of multiresistant opportunistic bacteria
For the selective isolation of multiresistant opportunistic bacteria, a rich medium (LB agar)
supplemented with five antimicrobial molecules, was used. Two estuaries samples located
in Algiers were cultured.
After the incubation period, one isolate of each estuary sample was selected and purified by
repeated transfers on fresh medium plates. Morphological and biochemical characters were
then studied showing two Gram negative, aerobic, non fermentative, motile, rod shaped
bacteria. An identification was, therefore, carried out by Api 20 NE gallery showing that
strains R2 (Oued El-Harrach) and HBA2 (Oued Beni-Messous) belonged to the genera
Bordetella and Brevundimonas, respectively.
Biochemical identification was confirmed by the analysis of the16s r DNA sequences with
BLAST database. Based on the phylogenetic analysis, strain R2 showed 97% homology
with Bordetella bronchiseptica while strain HBA2 showed 97% homology with
Brevundimonas subvibrioides (Table 1). The genus Bordetella has been reported as having
a great survival capacity in lakes and sea waters [13] and Brevundimonas species have
already been isolated from wastewater [14-15], sea water [16] and hot-spring water [17].
Both Bordetella and Brevundimonas are also known as opportunistic bacteria since they
have been reported in multiple infection cases in humans [1-3].
Microbial aquatic ecosystems, mainly those integrating the urban water cycle, represent
important vehicles for the dissemination of human-associated bacteria. They can also
constitute a reservoir for the dissemination of resistance genes.
Study of multiresistance
An antibiogram was carried out for the two isolates towards 34 molecules representing 12
different antibiotic families (Table 1).
The strain R2 showed resistance towards 18 antibiotics while strain HBA2 was resistant to
16 antibiotics. Both strains displayed resistance to most of the Bêta-Lactam antibiotics
tested (11/15 and 10/15 for R2 and HBA2, respectively) including cephalosporins. Strain
HBA2 was AMC resistant (amoxicillin+ clavulanic acid), an antibiotic frequently
prescribed in case of Bêta-Lactam resistant bacterial infections. Furthermore, both strains
were resistant to vancomycin (VA) and nalidixic acid (NA) .This observation proves the
existence of circulating vancomycin-resistance genes in the environment, which could
represent a difficulty in the treatment of MRSA (methicillin-resistant Staphylococcus
aureus) related infections.
Many studies have reported multi antibiotic resistant Brevundimonas and Bordetella species
in nosocomial infections and environment [18-19].
In the present study, antibiotic resistance profiles showed that both estuary isolates were
multi antibiotic resistant. Similar results have been obtained in other studies with Gram
negative bacteria isolated from wastewater or river water [7-8-20].
Microorganisms resistant to antibiotics and heavy metals appear as the result of exposure to
metal contaminated environments which cause coincidental co-selection of resistance
factors for antibiotics and heavy metals. Heavy metal tolerance in the environment may
contribute to the maintenance of antibiotic resistance genes by increasing selective pressure
of the environment. Our two isolates showed multiple metal resistance ability (Table 1).
According to Malik and Aleem [7], resistant ranges for heavy metals are: 12, 5 µg/ml for
mercury, 200µg/ml for cadmium and copper and 100 µg/ml for zinc, lead, chrome, cobalt
and lithium.
Strains R2 and HBA 2 were found to be both resistant to Cobalt, Lithium, zinc, copper,
mercury and lead. However, strain HBA2 was resistant to chrome and cadmium while
strain R2 was not. Besides, for both strains, MICs of 3000µg/mL were recorded for lead and
lithium, whereas MICs for cobalt, zinc, copper and mercury reached 1000µg/mL (Table 1).
Multi heavy metal resistant bacteria in wastewater and surface water have been reported in
other studies [7-8-20-21] and Brevundimonas and Bordetella genera have already been
described as Heavy metal resistant bacteria [22-23].
The combined resistance to heavy metals and antibiotics was also reported in many studies
[7-8-20-21-23] which showed a correlation between metal tolerance and antibiotic
resistance in bacteria because of the likelihood that resistance genes to both antibiotics and
heavy metals may be located closely together in the same plasmid, and are thus more likely
to be transferred together in the environment.
CONCLUSION
This study proves the existence of multiresistant opportunistic bacteria in Algerian surface
waters that are directly discharged in the Mediterranean Sea. Our isolates of Bordetella
bronchiseptica and Brevundimonas vancanneytii showed resistance to 18/34 and 16/34
antibiotics, respectively and presented a high level of resistance towards most of the heavy
metals tested. These results suggest the presence of circulating resistance genes in estuarine
waters leading to the spread of antibiotic resistance and implying consequences on human
health and marine wildlife.
REFERENCES
[1] Segers, P- Vancanneyt, M - Pot, B- Torck, U- Hoste,B- Dewettinck, D - Falsen, E- Kersters, K- De Vos, P:
Classification
of Pseudomonas diminuta Leifson
and
Hugh
1954
and
Pseudomonas vesicularis Büsing, Döll, and Freytag 1953 in Brevundimonas gen. nov.
as Brevundimonas diminuta comb. nov. and Brevundimonas vesicularis comb. nov., respectively. Int.
J. Syst. Bacteriol., 44, 499-510. 1994.
[2] Ferry, N. S: Preliminary report of the bacterial findings of canine distemper. American Veterinary Review.,
37, 499-503. 1910.
[3] Weaver, R.E- Hollis, D.G- Clarck, W.A and Riley P: The identification of unusual pathogenic Gram
negative bacteria (revisited tables). Centers for disease control, Atlanta. 1983.
[4] Von Graevenitz, A: The role of opportunistic bacteria in human disease. Annu. Rev. Microbiol., 31: 447471. 1977.
[5] Guardabassi, L- Dijkshoorn, L- Collard, J.M- Olsen, J.E- Dalsgaard A : Distribution and in-vitro transfer
of tetracycline resistance determinants in clinical and aquatic Acinetobacter strains. J Med
Microbiol,. 49, 929-36. 2000.
[6] McArthur, J.V- Tuckfield, R.C: Spatial patterns in antibiotic resistance among stream bacteria: effects of
industrial pollution. Appl Environ Microbiol., 66, 3722-6. 2000.
[7]: Malik, A- Aleem, A: Incidence of metal and antibiotic resistance in Pseudomonas spp. from river water,
agricultural soil irrrigated with wastewater and groundwater. Environ Monit Assess., 178, 293-308.
2011.
[8] Alam, M.- Imran M: Multiple antibiotic resistances in metal tolerant E.coli from hospital wastewater.
Bioinformation., 10, 267-272. 2014.
[9] Edlund,C- Björkman,L- Ekstrand, J- Sandborgh Englund, G- Nord, C.E: Resistance of the normal human
microflora to mercury and antimicrobials after exposure to mercury from dental amalgam fillings.
Clin Infect Dis., 22, 944-950. 1996.
[10] : Holt, J.G- Sneath, P.H.A- Staley, J.T- Williams, S.T : Bergey’s manual of determinative bacteriology
(9th ed.). Baltimore: William and Wilkins. 1994.
[11] Benson, D.A- Karsh-Mizrachi, I: Genbank. Nucleic acids Res., 28, 15-18. 2000.
[12] Bauer, A.W- Kirby, W.M- Sherris, J.C- Turck, M: Antibiotic susceptibility testing by a standardized
single disc diffusion method. American Journal of Clinical Pathology, 45,494-496. 1966.
[13] Porter,J.F- Parton, R- and Wardlaw, A.C: Growth and survival of Bordetella bronchiseptica in natural
waters and in buffered saline without added nutrients. Appl Environ Microbiol., 57, 1202–1206.
1991.
[14] Bing Hua, Y- Hai Jun, Y- Jian Hong, W- Lin, L: Isolation from Tannery Wastewater and
Characterization of Bacterial Strain Involved in Nonionic Surfactant Degradation. Advanced
Materials Research, 22,183-185. 2011.
[15] Wang,C- Zhang, M- Cheng, F- Geng, Q: Biodegradation characterization and immobilized strains’
potential for quinoline degradation by Brevundimonas sp. K4 isolated from activated sludge of
coking wastewater. Biosci Biotechnol Biochem. , 1, 1-7. 2014.
[16] Fritz, I.- Strömpl, C- Nikitin, D.I- Lyensco, A.M- Abraham, W.R: Brevundimonas mediterranea sp. nov.,
a non-stalked species from the Mediterranean Sea. Int J Syst Evol Microbiol., 55, 479-486. 2005.
[17] Masoudzadeh, N- Zakeri, F- Lotfabab, T.B- Sharafi, H- Masoomi, F- Zahiri, H.S- Ahmadian,G- Noghabi,
K.A : Biosorption of cadmium by Brevundimonas sp. ZF12 strain, a novel biosorbent isolated from
hot-spring waters in high background radiation areas. J Hazard Mater. ,15, 197:198. 2011.
[18] Kadler, K- Kehenberg, C- Schwarz,S: Efflux-mediated resistance to florfenicol and/or chloramphenicol
in Bordetella bronchiseptica: identification of a novel chloramphenicol exporter. J Antimicrob
Chemother., 59,191-196. 2007.
[19] Chun-Cheng, Z- Hui-Jine, H- Chien-Ming,L- Brevundimonas vesicularis bacteremia resistant to
trimethoprim-sulfamethoxazole and ceftazidime in a tertiary hospital in southern Taiwan. J Microbiol
Immunol Infect. 45,448-52. 2012.
[20] Filal, B.K- Taoufik, J- Zeroual, Y- Dzairi, F.Z- Talbi, M- Blaghen,M: Wastewater bacterial isolates
resistant to heavy metals and antibiotics. Current Microbiology. 41, 151-156. 2000.
[21] Yilmaz, F- Orman,N- Serim, G- Kochan, C- Ergene, A- Icgen,B: Surface water-borne multiresistant and
heavy metal-resistant Staphylococcus isolates characterized by 16s rDNA sequencing. Bull Environ
Contam Toxicol.91, 697-703. 2013.
[22] Bian, G- Zhang, Y- Qin, S- Xing, K- Xie,H- Jiang, J: Isolation and biodiversity of heavy metal tolerant
endophytic bacteria from halotolerant plant species located in coastal shoal of Nantong. Wei Sheng
Wu Xue Bao., 51, 1538-1547. 2011.
[23] Akkan,T- Kaya, A- Dinçer,S: Antibiotic levels and heavy metal resistance in Gram negative bacteria
isolated from sea water, Iskenderum organized industrial zone.Journal of Biological Sciences. 7, 1014. 2013.
Qualité Menaçante des Eaux de l’Oued Méboudja (Annaba, Nord-Est Algérien) Affluant
dans la Méditerranée
Qualité menaçante des eaux de l’Oued Méboudja (Annaba, Nord-Est
Algérien) affluant dans la Méditerranée
1
Lechekhab S.1, Lechekhab H.2, Belaz A.3, Terfaya M.3
Département de Médecine, Faculté de Médecine. Université Badji Mokhtar- . [email protected]
2
Département des Sciences Naturelles. Université d’El Tarf - [email protected]
3
Département de Biologie, Faculté des Sciences. Université Badji Mokhtar
[email protected] - [email protected]
RESUME
Les surfaces hydriques de la région d'Annaba (Nord-Est Algérien) sont menacées par l'abondance des
éléments polluants des eaux résiduaires non contrôlées et non traitées, d'origine multiple, urbaine, agricole et
industrielle. C'est le cas de l'Oued Méboudja, se déversant directement dans la mer méditerranée par le biais
de l'Oued Seybouse sans traitement préalable. Des prélèvements et des analyses, selon les normes AFNOR,
sont réalisés au niveau des principales sources potentielles de pollution déversant dans les eaux de cet oued.
Les résultats obtenus, comparés aux normes OMS des eaux de rejets dans les sites naturels, ont révélé que les
eaux superficielles de l’Oued Méboudja sont polluées par des éléments considérés d'origines ménagères,
agricoles et surtout industrielles. Parmi les paramètres physico-chimiques analysés, la température, le pH, la
demande chimique en oxygène (DCO), la demande biochimique en oxygène (DBO), le Nitrate et le Phosphore
total, se situent dans les normes, alors que les taux des matières en suspension (MES), la conductivité, la
salinité, le Nitrite, l'Orthophosphate, le Phosphate total et les métaux lourds principalement le Fer sont
supérieurs à la norme au niveau de l'ensemble des sites de prélèvement.
Mots-clés : Pollution aquatique, eaux résiduaires, paramètres physico-chimiques, Oued Méboudja, Annaba,
Algérie.
SUMMARY
The hydric surfaces of Annaba region (North-Eastern of Algeria) are threatened by the abundance of polluted
elements of uncontrolled wastewater and untreated of multiple origins, agricultural and industrial, urban
origins. This is the case Oued Méboudja, flowing directly into the Mediterranean Sea through Oued Seybouse
without treatment, infecting the marine habitat and threatening the biology and physiology of animals
including aquatic species. The study of the pollution of the river cannot be restricted to a simple observation
of water degradation quality but requires a major pollutants analysis, their sources, their pathways and their
effects on the aquatic environment. A preliminary investigation is initiated at the state of the river, on its
geographical location and an inventory of the existing sources discharges is performed. Sampling and
analysis, according to the AFNOR standards are achieved downstream of the main potential sources of
pollution that thrive in the region. The results compared to standard water discharges into natural sites,
showed that surface waters of oued Meboudja are polluted by elements considered a household origins,
agricultural and especially industrial. Among physicochemical analyzed parameters, temperature, pH,
chemical oxygen demand (COD), biological oxygen demand (BOD), the total Phosphorus and Nitrate, are
within the standards, while the rates of suspended solids (TSS), conductivity, salinity, Nitrite, Orthophosphate,
total Phosphate and heavy metals mainly Iron are higher than the norm at all sampling sites.
Key words: aquatic Pollution, waste water, physico-chimecal parameters, oued Méboudja, Annaba, Algeria.
INTRODUCTION
La pollution est un phénomène qui s'est accentué avec l’accroissement et la diversité des
activités humaines ainsi que l’augmentation de la consommation des énergies [1].
Cependant, l’eau, source de la vie, semble être le premier élément à montrer des signes
visibles de pollution. Ainsi l’état et le déclin des ressources hydriques s’avèrent être les
problèmes dominants des siècles à venir. En Algérie, la quantité des eaux usées rejetées
annuellement est estimée à environ cinq cent millions de mètres cubes par an. De ces
quantités, seulement 6 % des eaux urbaines et 15 % des eaux industrielles sont actuellement
épurées [2]. La plaine d’Annaba, située à l’extrême Nord-Est Algérien, est intensément
soumise à une pollution, essentiellement industrielle. Cette dernière a vraiment commencé à
devenir inquiétante à partir des années quatre-vingt-dix, lorsque la crise économique a
poussé certaines unités industrielles à sacrifier le critère environnement au profit de la
production. Divers rejets, urbains, agricoles et industriels, vont rejoindre directement le
milieu récepteur sans aucun traitement préalable ou du moins sans réduire les quantités de
polluants selon les normes admises [3]. Les effluents chimiques fortement colorés et
toxiques rejoignent principalement Oued Méboudja polluant ainsi les eaux de surface ainsi
que les eaux souterraines par infiltration pour être déversés en fin de parcours en
Méditerranée. L'estimation de la pollution de ces cours d’eau ne peut se restreindre à une
simple constatation de la dégradation de la qualité de l’eau mais exige une analyse des
principaux polluants, leurs sources, leurs cheminements et leurs effets sur le milieu
aquatique. L’étude de la pollution au niveau de l’Oued Méboudja est réalisée par
l’évaluation quantitative et qualitative de certains polluants caractérisant ses eaux
résiduaires, infectant le biotope marin et constituant une menace sur la biologie et la
physiologie des espèces aquatiques notamment animales.
Présentation de la zone d’étude
L’emplacement géomorphologique de l’Oued Méboudja (36°47'10.43"N et 7°45'26.76"E)
l’expose à une pollution multiple engendrée par des rejets abondants, non contrôlés et non
traités [4] rejoignant ainsi Oued Seybouse à environ 8 Km de son embouchure dans la mer
Méditerranée. Il chemine une région connue essentiellement pour sa vocation agricole,
reçoit également sur son parcours les rejets urbains de plusieurs agglomérations et constitue
la limite ouest d’une zone industrielle notamment le complexe Arcelor-Mittal (pôle
international d’industrie métallurgique) [5].
Sites de prélèvement
Quatre points de prélèvements ont été choisis le long de l’Oued Méboudja selon le type de
pollution, par rapport aux sources des rejets résiduaires industriels, agricoles et urbains (Fig.
1) :
 Site 01 : caractérisé par une pollution urbaine et agricole au début de l’Oued
Méboudja à son embouchure au lac Fetzara,
 Site 02 : caractérisé par une pollution urbaine (présence de rejets des réseaux
d’assainissement des agglomérations limitrophes) et par une pollution agricole
(abondance des terres des exploitations environnantes).
 Site 03 : caractérisé par une pollution industrielle (sortie des rejets du pôle
d’industrie métallurgique Arcelor-Mittal).
 Site 04 : caractérisé par une pollution industrielle et lieu de stagnation des eaux
selon sa topographie.
Figure 1 : Localisation des sites de prélèvement le long de l’Oued Méboudja (Annaba, Nord-Est
Algérien)
Méthode de prélèvement des eaux résiduaires
Les échantillons des eaux usées sont effectués en Avril 2010 au niveau des 4 sites de
prélèvement de l’Oued Méboudja selon la norme d’échantillonnage AFNOR 90-512, 1988 à
une distance suffisante des points de rejets, en tenant compte de la dilution, afin d’obtenir
des prélèvements homogènes et représentatifs [6].
Analyse des paramètres physico-chimiques des eaux
Les eaux échantillonnées des 4 sites de l’Oued Méboudja ainsi qu’une eau témoin (eau du
robinet déchlorée provenant de la localité de Sidi Amar traversée par cet oued) sont
analysés, selon les normes AFNOR [6].
 Les paramètres physiques analysés sont : la température, le pH, les Matières en
Suspension (MES), la Conductivité et le Taux de Salinité (TDS).
 Les paramètres chimiques analysés sont : la Demande Chimique en Oxygène
(DCO), la Demande Biochimique en Oxygène (DBO), l’Ortho-phosphate, le
Phosphore total, le Phosphate total, le Nitrate, le Nitrite et le Fer.
RESULTATS
Les différents paramètres physico-chimiques analysés à partir des eaux échantillonnées des
4 sites de prélèvement de l’Oued Méboudja ainsi que l’eau témoin (eau du robinet
déchlorée) sont comparés aux normes définies par l’OMS pour chaque paramètre.
Paramètres physiques
La température
Les valeurs de la température mesurées dans les eaux des différents sites de prélèvement
affichent une hausse par rapport à celle du milieu témoin en étant toutefois en dessous de la
norme OMS (Fig. 2).
Figure 2 : Variation de la température des eaux analysées. Norme OMS = 30°C
Le pH
La teneur en pH évaluée au niveau des différentes eaux analysées ne dépasse pas la norme
OMS sauf au niveau du site de prélèvement 2, caractérisé par une pollution urbaine et
agricole, où le pH atteint 8,54 alors que le milieu témoin affiche une teneur plus faible de
7,9 (Fig. 3).
Figure 3 : Variation des teneurs en pH des eaux analysées. Norme OMS = 5,5 - 8,5
Les Matières en Suspension (MES)
La teneur en MES nulle dans l’eau témoin, est très élevée, dépassant la norme OMS
requise, dans les eaux résiduaires des 4 sites de prélèvement dans un ordre croissant (Fig.
4).
Figure 4 : Variation des MES des eaux analysées. Norme OMS = 30 mg/l
La Conductivité Electrique (CE)
La conductivité mesurée, faible au niveau de l’eau témoin, est pratiquement identique au
niveau des eaux résiduaires des 4 sites de prélèvement en étant supérieures à la norme OMS
(Fig. 5).
Figure 5 : Variation de la CE des eaux analysées. Norme OMS ≤ 1000 µs/cm
Le Taux de Salinité (TDS)
Le taux de la salinité au niveau de l'ensemble des milieux hydriques analysés est largement
en dessous de la norme OMS en étant toutefois très bas au niveau de l’eau témoin (Fig. 6).
Figure 6 : Variation du TDS des eaux analysées. Norme OMS = 7680mg/l
Paramètres chimiques
La Demande Chimique en Oxygène (DCO)
Les valeurs de la DCO dans l'ensemble des milieux hydriques analysés sont en dessous de
la norme OMS. Elles sont quasi identiques au niveau des eaux des 4 sites de prélèvement et
plutôt nulles au niveau de l’eau témoin (Fig. 7).
Figure 7 : Variation de la DCO des eaux analysées. Norme OMS = 120 mg/l
La Demande Biochimique en Oxygène (DBO)
Les valeurs de la DBO, nulles au niveau de l’eau témoin, sont dans la norme OMS dans les
eaux analysées des 4 sites de prélèvement (Fig. 8).
Figure 8 : Variation de la DBO des eaux analysées. Norme OMS = 40 mg/l
Le Nitrate
Les eaux analysées présentent toutes des teneurs en Nitrate largement inférieures à la norme
OMS avec une présence plus marquée au niveau des sites de prélèvement 2, caractérisé par
une pollution urbaine et agricole, et 3 présentant une pollution industrielle (Figure. 9).
Figure 9 : Variation des teneurs en Nitrate des eaux analysées. Norme OMS = 50 mg/l
Le Nitrite
La teneur en Nitrite des eaux analysées est largement au-dessus de la norme OMS à
l’exception du milieu témoin et du prélèvement du 4 ème site, caractérisé par une pollution
industrielle, qui sont dépourvu de cet élément (Fig. 10).
Figure 10 : Variation des teneurs en Nitrite des eaux analysées. Norme OMS = 0,1mg/l
L’Orthophosphate
A l’inverse du milieu témoin, la teneur en Orthophosphates dans les eaux des 4 sites de
prélèvement est supérieure à la norme OMS à des taux croissants essentiellement au niveau
du 4ème site de prélèvement (Fig. 11).
Figure 11 : Variation des teneurs en Orthophosphates des eaux analysées. Norme OMS = 0,5 mg/l
Le Phosphate total
Contrairement au milieu témoin, la teneur en Phosphate total des eaux des 4 sites de
prélèvement est au-dessus de la norme OMS. La plus marquée est celle du 1 er site alors que
la plus faible est observée au niveau du 2ème site de prélèvement (Fig. 12).
Figure 12 : Variation des teneurs en Phosphate total des eaux analysées. Norme OMS = 0,5 mg/l
Le Phosphore total
La teneur en Phosphore total dans l'ensemble des milieux hydriques analysés est en dessous
de la norme OMS et présente, tel observé pour le Phosphate total, une hausse au niveau du
site 1 et une baisse au niveau du site de prélèvement 2 alors que l’eau témoin marque
également un taux très faible (Fig. 13).
Figure 13 : Variation des teneurs en Phosphore total des eaux analysées. Norme OMS = 2 mg/l
Le Fer
La teneur en Fer est supérieure à la norme OMS au niveau des sites de prélèvement 3 et 4
caractérisés par des rejets industriels et est en dessous dans les sites de prélèvement 1 et 2
alors que ce métal n'existe pas dans l’eau témoin (Fig. 14).
Figure 14 : Variation des teneurs en Fer des eaux analysées. Norme OMS = 5 mg/l
DISCUSSION
La détection de la pollution dans les sites de prélèvement est effectuée par les analyses des
paramètres physicochimiques des eaux prélevées pour estimer la dégradation naturelle des
matières organiques contenues dans l’eau et expliquer le type et la source de la pollution. La
température hydrique joue un rôle dans la dissociation des sels dissous et la solubilité des
gaz. Elle influe donc sur la conductivité électrique et la détermination du pH [6]. Elle est
inférieure à la norme OMS (30°C) au niveau de l’ensemble des prélèvements des différents
sites, ce qui peut s’expliquer principalement par les fortes précipitations du printemps lors
de la période de prélèvement des eaux résiduaires au niveau de l’Oued Méboudja.
Le pH est un paramètre qui donne des indications sur l’acidité ou la basicité des eaux et
influe énormément sur la solubilité ionique et la précipitation des minéraux. Le pH des eaux
de l'ensemble des sites de prélèvement se situe dans les normes OMS conformément aux
travaux précédents effectués dans l’Oued Méboudja [7] [8].
Les Matières en Suspension (MES) représentent les matières flottantes de particules en
suspension qui ne sont ni à l’état dissous ni à l’état colloïdal, donc filtrables [9]. Elles sont
essentiellement organiques et/ou minérales et permettent une bonne évaluation du degré de
pollution des eaux. Les taux des MES sont supérieurs à la norme OMS au niveau des 4
sites de prélèvement, en augmentant successivement du 1er au 4ème ce qui peut être expliqué
par l’aspect des rejets ainsi que par la topographie et le débit de l’oued [8].
La Conductivité variant en fonction de la température, dépend de la concentration des
substances dissoutes et de leur nature, en l’occurrence les sels dissous conducteurs. Quasi
identique dans les eaux résiduaires prélevées, elle est supérieure à la valeur limite 1000
µs/cm ce qui a été également noté dans les résultats de précédents travaux [7].
Le Taux de Salinité (TDS), estimé à partir de la conductivité et la température du milieu,
exprime la salinité [6] qui suit l'évolution de la conductivité dans les prélèvements des 4
sites en mettant en évidence la minéralisation élevée des eaux de ce cours d’eau [6]. Ceci
est dû essentiellement à la nature de la roche mère de cette région et la salinité élevée du lac
Fetzara (36°47'30,09"N et 7°29'11,73"E) en amont de l’Oued Méboudja.
La Demande Chimique en Oxygène (DCO) correspond à une estimation des matières
oxydables présentes dans l'eau, quelle que soit leur origine, organique ou minérale [10]. Elle
est estimée en dessous de la norme OMS dans tous les sites de prélèvement, contrairement à
d’autres résultats [5], étant fonction des caractéristiques des matières présentes dans l'eau,
de leurs proportions respectives et des possibilités de l'oxydation.
De même pour la demande biochimique en oxygène (DBO) correspondant à la quantité
d'oxygène consommée par certaines matières présentes dans l'eau, principalement pour
assurer leur dégradation par voie biologique [6]. Constituant un moyen valable de l'étude
des phénomènes naturels de destruction des matières organiques, des variations se
produisent suivant les espèces de germes, leur concentration et leur âge, la présence de
bactéries nitrifiantes et celle de protozoaires consommateurs d'oxygène et se nourrissant de
bactéries. La pollution des eaux par les Nitrates est principalement issue des activités
humaines [11]. Cependant, la concentration du Nitrate est inférieure à la norme OMS pour
les eaux usées des 4 sites de prélèvement, inversement à ce qui a été trouvé dans de
précédentes études [5] [8]. Ceci s’explique également par la dilution due aux fortes
précipitations.
Les Nitrites représentant la forme du passage entre les Nitrates et l’Ammonium, sont un
élément toxique d'origine liée à l'agriculture et aux rejets urbains et industriels [12], ce qui
explique l'observation des valeurs élevées au niveau du site 3 où en plus des rejets
industriels s’accumulent les rejets urbains et agricoles du précédent site et ce malgré la
dilution par les fortes précipitations. Leur présence dans ces eaux est due à l’effet de
l’oxydation de la forme Ammonium [12].
La concentration des composés phosphoriques (Orthophosphate, Phosphate total et
Phosphore total) dans les eaux usées est très élevée par rapport au témoin et aux normes
OMS. Leurs variations observées dans les prélèvements des différents sites sont dus à la
nature des rejets et aux relations chimiques entre eux soit par réduction ou par oxydation,
ainsi qu’à l’absorption d’une petite quantité par les micro-organismes [13].
Les taux de l'Orthophosphate et du Phosphate total sont supérieurs à la norme OMS dans
tous les sites de prélèvement ce qui a été indiqué également par d’autres travaux [5] [8].
L'existence de ces composés phosphoriques dans les eaux usées serait liée aux rejets urbains
ainsi qu’à la dissolution des engrais chimiques [14] ce qui correspond aux caractéristiques
des sites de prélèvement. Le taux d’Orthophosphate estimé augmente successivement du
site 1 au site 4 selon la nature des éléments polluants des rejets et leur accumulation à cause
de la topographie et le débit de l’oued. Quant au Phosphore total, ses valeurs sont audessous de la norme dans l’ensemble des prélèvements, s'expliquant éventuellement par le
conditionnement du milieu et peut-être par la dilution suite aux fortes précipitations.
La présence du Fer dans l'eau peut avoir diverses origines: naturelle, par le lessivage des
terrains argileux, ou industrielles (métallurgique, sidérurgique) [3]. Ceci explique
l'existence de ce métal à des valeurs élevées par rapport à la norme au niveau des sites 3 et
4, caractérisés par une pollution industrielle spécifique notamment avec la présence du
complexe sidérurgique Arcelor-Mittal-Annaba et largement mise en évidence dans la région
de prélèvement [3] [8] [15].
CONCLUSION
L’impact de la présence des éléments polluants rejetés au niveau de l’Oued Méboudja sur le
milieu environnant peut être catastrophique par le fait que ce site naturel se situe dans une
zone urbaine et agricole surmontant une nappe phréatique sub-affleurante. De plus, les eaux
de l’Oued Méboudja se déversent directement dans la mer méditerranée par le biais de
l’Oued Seybouse sans traitement préalable.
BIBLIOGRAPHIE
[1] Nicolas J.P. : Cours Transports et environnement. Laboratoire d’Economie des Transports. Université
Lumière Lyon 2, 93 p. (2003).
[2] Hani A. : Analyses méthodologiques de la structure et des processus anthropiques : application aux
ressources en eau d’un bassin côtier méditerranéen. Thèse Doctorat Es-Sciences, Univ. Annaba. 214
p. (2003).
[3] Debièche T.H. : Evolution de la qualité des eaux (Salinité, Azote et Métaux lourds) sous l’effet de la
pollution saline, agricole et industriel. Application à la basse plaine de la Seybouse Nord-Est
Algérien. Thèse de Doct. Univ. de France comté, 199 p. (2002).
[4] Djabri L., Mani A., Mania J., Houll A. & Hessadi D. : Vulnérabilité à la pollution des eaux de la valle de
la Sybouse. Exemple de la zone Oued Méboudja – Laboratoire de la pollution de l’eau. Univ.
Annaba. 125 p. (1997).
[5] Djabri L. : Mécanisme de la pollution et vulnérable des eaux de la Seybouse, origine géologique
industrielle agricole et urbaine. Thèse Doctorat, Univ. Annaba. 188 p. (1991).
[6] Rodier J., Champsaur H., Bazin C., Broutin J.P., Chanbon P. & Rodi L. : Analyse des eaux : eaux
naturelles, eaux résiduaires et eaux de mers. Ed Dunod, 8ème Edition, Paris, 1383 p. (2005).
[7] Terfaya M. : Impact de l’utilisation des eaux de l’Oued Méboudja sur l’agriculture (les produits agricoles
et la santé des consommateurs). Mémoire d’Ingénieur d’Etat. Univ Annaba. 82 p. (2002).
[8] Bougherira N. : Impact des rejets industriels du complexe sidérurgique sur les eaux superficielles et
souterraines dans la plaine de Méboudja. Mémoire d’Ingénieur d’Etat en hydrogéologie. Univ.
Annaba. 101 p. (2008).
[9] Satin M. & Selmi B. : Guide technique de l’assainissement : Evacuation des eaux usée et pluviales,
conceptions et composants des réseaux, épuration des eaux et protection de l’environnement,
exploitation et gestion des systèmes d’assainissement. ISBN 2-281-1152-0, Edition Le Moniteur,
Paris, 75-86. (1995).
[10] Tardat-Henry M. : Chimie des eaux, Edition Le Griffon d’argile. ISBN2-920922-87-4. (1992).
[11] Rolland T. : Approche écophysiologique du rôle de l'azote ammoniacal dans la répartition de deux
macrophytes aquatiques, Elodea canadensis Michx et Elodea nuttallii St. John. Impact sur l'Activité
Nitrate Reductase et l'Activité Photosynthétique. Thèse de Doctorat, Strasbourg, 1-303. (1995).
[12] Nadeau I. : Nitrates, le laborieux tracé des zones vulnérables, Environnement Magazine, 1593, 37 p.
(2001).
[13] Blake G. : Rôle des végétaux aquatiques vis-à-vis du phosphore dans les écosystèmes et les systèmes
d'épuration in Le phosphore, ses dérivés et leur comportement dans le milieu naturel, Dijon, 1-14.
(1988).
[14] Marchand M. & Kantin R. : Contaminants chimiques en milieux aquatiques, aspects généraux nature,
origine effets et analyse, Oceanis, vol. 21, n° 2, 134 p. (1995).
[15] Aoudjehane M. : Distribution des gites à Pb-Zn et fer sidéritique dans le Nord-Est Algérien. In : Pagel
and Leroy (editors). Source, Transport and Deposition of Metals. Balkema, rotterdam, 419-422.
(1991).
Acetylcholinesterase activity as a biomarker response to
methylmercurychloride exposure in brain of Epinephelus coiodes
(orange spotted grouper)
Sharareh S., Alireza S., Bita A., Ahmad S. and Rahim A.
Marine Biology Department, Faculty of Marine Sciences, Khorramshahr Marine Science and Technology University
ABSTRACT
The activity of acetylcholinesterase in the brain of Epinephalus coioides was measured using Ellman's assay.
Fishes were exposed to 0, 10, 20, 40 and 80 µg/L of Methylmercury chloride (MeHgCl). The brains of fishes
were collected and the total protein was extracted in order to measure the activity of Acetylcholineasterase
(AChE) using Ellman's assay method. There was a significant difference between the exposures and the
control (non-treated) fishes. This activity was correlated with certain amount of MeHgCl exposed to the fish
at different time points to show the significance of this reaction. It was postulated that inhibition of AChE was
correalated with high levels of MeHgCl at different days of exposure. This experiment showed that AChE
activity can serve as a fine biomarker of methylmurcury ( MeHg) exposure in the cerebellum in response to
different times and doses of exposure. However the transcript levels should be assessed as a more accurate
indicator of MeHg exposure.
Key words: Methylmercury chloride, Epinephalus coioides, brain, Acetylcholineasterase, enzyme activity.
INTRODUCTION
Epinephalus coioides is a benthopelagic fish that lives in the Persian Gulf in Iranian waters
(Sheaves, 1996). Since it lives in close vicinity to the bottom of the sea, not only it is
surrounded with the water but it's also exposed to the sediments. Mahshahr Creeks (Musa
Creeks) of Persian Gulf are one of the hosts of this species. Musa Creeks are polluted due to
petrochemical companies and docks, oil tankers' transportation, agricultural and fisheries
activities of the area (Monikh et al., 2013, Safahieh et al., 2011, Shadi et al., 2012, Tehrani
et al., 2012). Methylmercury is one of the pollutants of the area which comes from these
activities. Studying the amount and effect of Methylmercury on fish was one of the aims of
this research. For better understanding the effects of methylmercury on fishes, they were
exposed to different concentrations of methylmercury chloride in tanks fed with water
coming from the creeks.
Methylmercury is the organic form of the heavy metal mercury which is much more toxic
compared to mercury itself. This is due to the lipophilicity of methylmercury that penetrates
the plasma membrane of cells and especially the blood-brain barrier and accumulates into
the tissues (Govindaswamy et al, 1992; Erni and Geier, 1979). This toxicant affects many
tissues of the fishes (Liao et al., 2006). The brain is the organ which is more susceptible and
sensitive to this pollutant (Liao et al., 2006). It has been shown that Methylmercury
accumulates more in the brain and affects the activity of acetylcholinesterase more than the
other tissues (Liao et al., 2006). Acetylcholinesterase is the biomarker of methylmercury
which upon exposure to such pollutant its activity decreases. Therefore AChE has been
postulated as a biomarker of MeHg exposure.
In our study we showed that orange spotted grouper brain is affected by methylmercury and
the activity of acetylcholinesterase enzyme reduces upon exposure to such toxicant. We
also wanted to show a correlation between the amount of reduction of enzyme activity and
the concentration of MeHgCl dissolved in water and time of exposure. This study was to
aim that acetychloinesterase is a good indicator of MeHg exposure and showed the
bioavailability of MeHg in the brain of orange spotted grouper in response to AChE enzyme
inhibition.
The orange spotted grouper fishes were adapted to fiberglass tanks for 1 week. A stock
solution of MeHgCl was made and certain amounts were added to the water in order to
make concentrations of 0, 10, 20, 40 and 80 µg/L. MeHg was renewed every the other day
in the tanks. There were 3 repeats of each tank coming up to a total of 15 tanks. Each tank
contained 15 fishes and 3 fishes were collected at each stage from each tank and stored in
liquid nitrogen. The brains of fishes were collected at days 7, 14 and 30 of exposure from
each tank. After the 30 days of exposure the depuration experiments were carried out for 14
days and the brains were collected at days 7 and 14 of depuration. There weren't any fishes
left for concentratrion 80 µg at day 14 of depuration since 1/5 of the fishes at concentration
80 µg/L at day 30 died, therefore none were left for depuration day 14 experiments. The
total protein content was extracted from the brains using 0.1 M phosphate buffer (0.1 M
sodium phosphate monobasic dihydrate, NaH2PO4·2H2O, and 0.1 M sodium phosphate
dibasic heptahydrate, Na2HPO4·7H2O, pH 8.0). The 20 mg of brain tissue was dissolved in
1 ml of 0.1 M phosphate buffer pH 8.0 and centrifuged at 12000 rpm for 30 min at 4˚C. The
supernatant was collected and stored at -20 until the actual experiment. The concentration
of the proteins was measured using Bradford assay (Bradford, 1976). 50 µg protein was
used for the experiments. The proteins were placed in a water bath for 10 min at 25˚C
before the experiment. The Ellman's assay was used using 0.32 mM 5,5’-dithiobis-(2nitrobenzoic acid) (DTNB) and addition of 56 mM of sodium bicarbonate (NaHCO3), and
0.48 mM Acetylthiocholine, the substrate (Ellman et al, 1961). The reaction color change
was measured using a spectrophotometer at 412 nm in order to calculate the activity of
AChE. The absorbance of a blank sample containing all the reagents except for the protein
was measured and deducted from the protein absorbances in order to subtract the
background substrate spontaneous hydrolysis. Each absorbance was measured with 3o sec
intervals for 10 min. The equation used was:
R = 5.74x 10 -4 x A/CO
Where, R = Rate in moles of substrate hydrolyzed /minute / µg protein
A = Change in absorbance / min (absorbance of min 10 – absorbance of min 2)
CO = Original concentration of the tissue (50 µg).
The Ratio was calculated for 50 µg which at the end was divided by 50 to calculate the ratio
of 1 µg protein. The statistical analysis was used to calculate the significance of the reaction
using SPSS.
RESULTS
The AChE kinetics of whole brain minus Cerebellum, referred as to the brain, is shown
figures 1-5. In figure 1 the kinetics of brain AChE is shown upon exposure of MeHg at day
7. The Absorbance of reporter dye of enzyme-substrate activity is plotted verse 20 second
time intervals starting from 120 sec (min 2) to 600 sec (min 10). The reason that this plot
has been drawn is to show the slope of the trend line of the kinetics of enzyme activity. The
sharper the slope the more the rate of AChE activity upon MeHg exposure. The variant of
the function which is timed by x is different in all trend lines. It is less in all exposures
compared to the control except for B40-7. This means that MeHg inhibits the activity of
MeHg. The bar graph of these activities have also been shown in figures 11 and 12.
In figure 1, the rate of AChE enzyme activity (moles/min/µg) is shown in the brain samples
exposed to different concentrations of MeHg at certain days. There is a decrease in AChE
activity in all times and doses. However, the more the concentration of MeHg and the time
of exposure the more decrease in enzyme activity.
AChE Activity (moles/min/µg)
in Brain of E.Coioides
0.0000016
0.0000014
0.0000012
0.000001
0.0000008
0.0000006
0.0000004
0.0000002
0
0
10
20
40
80
0
10
20
40
80
0
10
40
80
Day 30
Day 14
Day 7
20
Figure 1: Rate of brain AChE activity (moles/min/µg) at different concentrations of exposure (µg/L) at
different days of exposure
AChE Activity (moles/min/µg) in
Cerebellum of E.coioides
The rate of AChE activity (moles/min/µg) of cerebellum at different doses and times of
exposure to MeHg is shown in figure 2. There is an inhibitory effect on AChE activity in all
exposures except for day 14 which irregularly the activity of AChE upon MeHg increases.
0.0000007
0.0000006
0.0000005
0.0000004
0.0000003
0.0000002
0.0000001
0
0
10
20
Day 7
40
80
0
10
20
Day 14
40
80
0
10
20
40
80
Day 30
Figure 2: Rate of AChE activity (moles/min/µg) in cerebellum at certain doses and times of exposure.
MeHg has an inhibitory effect on the activity of AChE in all exposures except for day 14
To better understand the decrease pattern of AChE activity, the ratio of treatment groups
were plotted verse their control group, therefore a better comparison is shown in figure 3.
AChE Activity compared
to control (%)
10
20
80 µg/L
40
180
150
120
90
60
30
0
0
7
14
21
28
35
Day
Figure 3: Percentage of AChE Activity compared to control group in the brain of E.coioides
Fig. 4 shows the percentage of AChE activity in all times and doses compared to its control
group in order to have a better comparison between the groups.
AChE Activity compared to
control (%)
125
10
20
40
80
µg/L
100
75
50
25
0
0
7
14
21
28
35
Day
Figure 4: Percentage of AChE Activity compared to control group in the cerebellum of E.coioides
10
20
40
80
AChE Activity
compared to control
(%) in brain
The depuration experiments show an increase in activity once MeHg has been eliminated
from the experiments. Fig. 5 shows the activity of AChE at days 30, 37 and 44 meaning the
last day of exposure and day 7 and 14 of depuration studies. The activity of AChE rises at
depuration studies compared to exposure and exceeds the control groups in order to
compensate for the loss. The increase in activity is more obvious at day 7 compared to day
14 which it drops to compromise the rise.
-5
500
400
300
200
100
0
2
9
16
23
30
37
44
51
Day
Figure 5: AChE activity compared to the control group in brain at depuration period (%)
10
20
40
80
AChE Activity in
cerebellum
compared to control (%)
The ratio of the activity of AChE in cerebellum compared to their control groups have been
depicted in fig. 6. The activity of AChE in cerebellum increases more compared to the
brain.
800
600
400
200
0
-5
2
9
16
23
30
37
44
51
Day
Figure 6: Ratio of AChE activity in cerebellum compared to control (%)
DISCUSSION
The activity of AChE enzyme reduces upon methylmercury exposure. This reduction is
obvious in the cerebellum and rest of the brain in all the doses and times of exposure.
However it is more obvious and significant in the cerebellum, therefore it can be used as the
part of the brain for AChE activity as a biomarker of MeHg exposure. In Cerebellum the
activity of AChE at day 7 decreases to 60% of the control at high doses. At day 14 there is a
stimulation of enzyme activity at low doses which its amount exceeds the amount of the
control (155%). This trend has been seen among other researcher's works and it's an unusual
regulation of day 14-16 of exposure perhaps due to the onset of MeHg reduction after this
day or a repair mechanism at the beginning to compensate for the fall (Liao et al., 2006),
Although it does not last long since there is a major fall at day 30. However at concentration
80 µg/L at day 14 its activity falls to 90%. The amount of the AChE activity reduces at
day 30 and this decrease is seen in all doses from 73% to 43% of the control groups. Once
Comparing the highest doses and exposure periods we can see that the activity of AChE
decreases from 69% of control at day 7 (C80-7) to 60% of control at day 43 (C80-30). This
shows that time of MeHg exposure affects the inhibition rate. This might be due to binding
of MeHg to the sulfur group of the protein and inhibiting its activity.
The reason AChE activity reduces more in the cerebellum compared to rest of the brain
might be due to the tissue specific accumulation of MeHg in cerebellum meaning that it
accumulates more MeHg in itself than the rest of the brain. However protein specific feature
of cerebellum for AChE may be another reason that in expresses more AChE in the
cerebellum rather than the rest of the brain. Therefore the changes upon this part is more
severe (decrease and increase) since cerebellum is more sensitive to MeHg, that's why we
see more decrease upon MeHg during exposure period and more increase at depuration
studies. The fluctuations are more obvious.
The reason for AChE activity upon high exposure levels could be that inhibition may vary
at different doses perhaps due to the concentration of MeHg and its accessibility. MeHg can
bind thiol (-SH) groups mainly on Cysteine amino acids and forms covalent bonds in
proteins containing cysteine. However more than one cysteine group may bind to
methylmercury and it can migrate to othr metal-binding sites in proteins .Therefore the
accessibility of MeHg may be the reason to different activities of AChE due to different
conformations of it in vicinity of thiol groups (Govindaswamy et al, 1992; Erni and Geier,
1979). Another reason to this variation may be because of the detoxification rate of liver.
Liver tries to detoxify the effect of MeHg by producing cysteine containing proteins
(metalothionines) and this may affect our expressions since the rate of detoxification might
vary at different doses and times (Yoshida et al, 2011).
In the depuration experiments an increase of activity is observed at days 7 and 14 which is
expected since AChE activity should recover after the elimination of MeHg from water.
The increase observed at day 7 is to compensate for the loss however, at day 14 it slighty
compromises to reach to the control level. Our findings correlate with other studies. In a
research juvenile trout fishes were exposed to 0.08 µg metal/L of MeHg and the activity of
AChE was reduced up to 89.5%. When the MeHg concentration was increased up to 0.93
µg metal /L, the amount of AChE was reduced to 64%. Interestingly there was no AChE
activity seen in the embryos (Christensen, 1975).
Since Cerebellum is a good location to monitor AChE activity upon MeHg exposure and
the exposure days such as day 7 and day 30 at the highest dose rime with other findings,
therefore temporal and spatial factors of exposure are chosen based on these factors in order
to choose AChE as a biomarker of MeHg exposure. The correlation coefficient was -0.783
in our expriments and this shows 70% negative correlation between AChE activity and days
of exposure. In conclusion the activity of AChE upon MeHg exposure is time depent at high
doses except for day 14 which shows an irregular pattern. The reason we don't see a
consistant decrease pattern among our concentration experiments may be due to the
different detoxification rates of the liver at certain time points and dose, althoug there is a
90% correlation between the doses chosen. In the water the amount of accumilation of
MeHg over time reaches the amount of accumilation of MeHg at high doses of exposure
(publication in press), therefore the acute bioavailability of MeHg through exposures for the
brain is equal to the chronic accumilation of MeHg in nature and the function and trend line
can be a good estimate for the concentration of MeHg.
REFERENCES
Alves Costa, J.R. M., Mela, M., Silva de Assis, H. C. D., Pelletier, É., Randi, M. A. F. & Oliveira Ribeiro, C.
A. D. 2007. Enzymatic inhibition and morphological changes inHoplias malabaricus from dietary
exposure to lead (II) or methylmercury. Ecotoxicology and Environmental Safety, 67, 82-88.
Christensen, G. 1975. Biochemical effects of methylmercuric chloride, cadmium chloride, and lead nitrate on
embryos and alveins of the brook trout, Salvelinus fontinalis. Toxicology and applied pharmacology,
32, 191-197.
Erni, I., Geier, G. 1979. "Kinetics of Extremely Fast Ligand Exchange Reactions with Methylmercury(II)complexes of 1-Methylpyridine-2-thione and 1-Methyl-quinaldine-4-thione: Rate-Equilibria
Correlations". Helv. Chim. Acta. 62 (4): 1007
Govindaswamy, N., Moy, J., Millar, M., Koch, S.A. 1992. A distorted mercury [Hg(SR)4]2− complex with
alkanethiolate ligands: the fictile coordination sphere of monomeric [Hg(SR)x] complexes". Inorg.
Chem. 26, 26,: 5343
Kobayashi, H., Yuyama, A., Matsusaka, N., Takeno, K. & Yanagiya, I. 1980. Effect of methylmercury on
brain acetylcholine concentration and turnover in mice. Toxicology and applied pharmacology, 54, 18.
Liao, C.-Y., Fu, J.-J., Shi, J.-B., Zhou, Q.-F., Yuan, C.-G. & Jiang, G.-B. 2006. Methylmercury accumulation,
histopathology effects, and cholinesterase activity alterations in medaka (Oryzias latipes) following
sublethal exposure to methylmercury chloride. Environmental Toxicology and Pharmacology, 22,
225-233.
Monikh, F. A., Safahieh, A., Savari, A. & Doraghi, A. 2013. Heavy metal concentration in sediment, benthic,
benthopelagic, and pelagic fish species from Musa Estuary (Persian Gulf). Environmental monitoring
and assessment, 185, 215-222.
Oliva, M., Perales, J. A., Gravato, C., Guilhermino, L. & Galindo-Riaño, M. D. 2012. Biomarkers responses
in muscle of Senegal sole (Solea senegalensis) from a heavy metals and PAHs polluted estuary.
Marine pollution bulletin, 64, 2097-2108.
Roex, E. W., Keijzers, R. & Van Gestel, C. A. 2003. Acetylcholinesterase inhibition and increased food
consumption rate in the zebrafish, Danio rerio, after chronic exposure to parathion. Aquatic
toxicology, 64, 451-460.
Safahieh, A., Monikh, F. A., Savari, A. & Doraghi, A. 2011. Heavy Metals Concentration in Mullet Fish, Liza
abu from Petrochemical Waste Receiving Creeks, Musa Estuary (Persian Gulf). Journal of
Environmental Protection, 2.
Sancho, E., Ferrando, M. & Andreu, E. 1997. Response and Recovery of Brain Acetylcholinesterase Activity
in the European Eel, Anguilla anguilla, Exposed to Fenitrothion. Ecotoxicology and Environmental
Safety, 38, 205-209.
Shadi, A., Mazandarani, M. K. & Nikpour, Y. 2012. Concentrations of polycyclic aromatic hydrocarbons
(PAHS) in sediments of Khowre-Musa System (Persian Gulf). World, 4, 83-86.
Sheaves, M. 1996. Habitat-specific distributions of some fishes in a tropical estuary. Marine and Freshwater
Research, 47, 827-830.
Straus, D. L. & Chambers, J. E. 1995. Inhibition of acetylcholinesterase and aliesterases of fingerling channel
catfish by chlorpyrifos, parathion, and S, S, S-tributyl phosphorotrithioate (DEF). Aquatic toxicology,
33, 311-324.
Tehrani, G. M., Hshim, R., Sulaiman, A. H., Sany, T., Belin, S., Jazani, R. K. & Tehrani, Z. M. 2012.
Assessment of Contamination by Petroleum Hydrocarbons in Sediments of Musa Bay, Northwest of
the Persian Gulf-Iran. International Proceedings of Chemical, Biological & Environmental
Engineering, 33.
Yoshida, E., Toyama, T., Shinkai, Y., Sawa, T., Alaile, T., Kumagai, Y. 2011. Detoxification of
methylmercury by hydrogen sulfide-producing enzyme in Mammalian cells. Chem Res Toxicol.
24(10):1633-5
THEME 3: The Impacts Associated with Human Activities
and Responses to Coastal Change
The Human Impact: a Principal Factor of the Environment Disturbance in Algeria
Example of Algiers Coast
The human impact: a principal factor of the environment disturbance in
Algeria, example of Algiers coast
1
Bouhadad R1
USTHB- BP 32 El Alia Bab Ezzouar, 16111 Algeria – Fax + 213 21 247217 http://www.usthb.dz [email protected]
SUMMARY
Algeria is a large country facing the Mediterranean sea in the north with a coast of 1200 Km. on this fringe of
the country lives an important population part and the most industrial sites are gathered. In this survey,
Algiers coast is considered where two important sites are selected (The ramsar aquatic site of Reghaia and
Zemmouri bay) according to the large impact of human disturbance observed. Among the factors: industry
and agronomic pollution, sand abstraction in beaches and the anthropogenic impact constitute an important
factor of disturbance. The results confirm the presence of a critical disturbance, the abusive exploitation of
the sand provoked serious problems as the plant carpet destruction, the risk of underground water
contamination with sea water in Zemmouri site, either chemical and human wastages is suffering the lake in
Reghaia region.
Keywords: pollution, Algiers coast, disturbance, ecosystems
INTRODUCTION
There is no doubt that several ecosystems in Algeria and around the world had been highly
disturbed by the human activity. Obviously, the disturbance and the direct or indirect
impact influences wildlife continental and aquatic populations worldwide and alters their
ecology in various ways (1; 2). The human induced events create disturbance which could
have both negative (major case) and positive effect on wildlife ecology of species affecting
the use of habitat (3; 4) and population density (5; 6), the richness of the biodiversity and
modification of the ecological traits (7;8).The anthropogenic impact create disturbance on
natural environment caused by the unsustainable exploitation of available natural, animal
genetic and vegetal genetic resources. These human induced events affects several
ecosystems (biodiversity) at high rates that far exceed the speed at which regeneration and
replenish could be possible. Several factors induced human disturbance have been gathered:
uncontrolled and excessive natural resource exploitation, presence of a diversified and
aggressive pollution(industrial, domestic, others), deforestation and destruction of vegetal
carpet, man-made fires, overgrazing(pastoral management system, example of the Steppe in
Algeria), proliferation of invasive and alien species(the accidental introduction of an Asiatic
invasive cyprinid fish Pseudorasbora parva probably from Tonga lake in Algeria could
expose the freshwater fish to a threat (9; 10) ,agricultural areas loss to costs of an anarchical
urbanization, irresponsible tourism (destruction of natural ecosystems).However, humaninduced disturbance alters seriously pollinators communities, which have a negative effect
on the vegetation and for pollinators(11). Anthropogenic alterations of natural hydrobiology
are common in wetlands, Reghaia Ramsar site is a real example in Algeria. The aquatic
ecosystems are threatened by diversified pollution, regardless of specific factors considered
amphibians (12; 13) molluscs and fish have used as good environmental stress indicators.
The increase of irresponsible tourism and other forms of land resource exploitation such as
mining can have a profound effect on the natural environment (the abstraction of sand in
beaches and rivers is common in Algeria).
The goal of this survey is to assess the effects of human induced disturbance on the
biodiversity particularly on aquatic communities (Reghaia site) and the abstraction of sand
beaches (Zemmouri region) on molluscs populations and vegetal carpets. Human impact is
extremely visual and solutions should be proposed to avoid the destruction of two inshore
ecosystems. We followed the evolution of dune population mollus and vegetal carpet in
Zemmouri site, even if the perturbation affecting the chemical and physical parameters and
the state of the fish population is a good indicator of environmental stress in Reghaia Lake.
However the increase of recreational activities added to major problems of pollution
constitute a threat to the local biodiversity(an important population of birds frequent this
lake).Our objectives are to propose recommendations as how to manage these two
important sites, seriously perturbed which has a negative effect on biodiversity. In
definitive, there is a widespread concern about the human disturbance induced on several
continental and coastal ecosystems and the negative effect on the biodiversity. Habitat
alteration, chemical pollutants, overexploitation of natural resources, introduction of exotic
species and climate change are all factors responsible of the biodiversity decline
(14).Tourism and recreational activities has been added to the major threats to biodiversity
worldwide (15;16). The unsustainable exploitation of available natural resources and the
management of coastal ecosystems should be analyzed and understood to avoid
environmental problems in a near future.
Study area
Zemmouri site (Figure 1). It’s a balneal station distanced 70km eastern of Algiers town.
This site is limited eastern by the Merdja ‘oued, from the south by the forest of ‘Zemmouri’
and Western by the Bergouga oued.
Figure1. Map of Zemmouri bay
Ramsar site of Reghaia reserve (figure 2).The natural reserve of Reghaia (1500ha) is
located in Algiers Wilaya (30 km eastern of Algiers town); it gathers several ecosystems
(marine, continental, lake (freshwater 150ha).The site is considered the alone wetland area
of the region, it characterizes by a high richness of birds (200 species had been
inventoried).Three stations had been explored (Rehaia1,Reghaia 2 and Reghaia 3).
Methods
The study examined the effects of the anthropogenic disturbance according to the ecological
traits:


Zemmouri site: Three (03) ecological traits were visual: a) diversity and density of
malacological fauna) destruction of the habitat (destruction of sand dunes, vegetal
carpet), c) geological aspect.
Reghaia site: 02 ecological traits were considered a) activity pattern and quality of
water b) diversity of fish species.
Figure 2:
Map of the reghaia natural reserve (reference TCY/INT/031. MAGHREB ZONES
HUMIDES (2005). (Stations selected: S1, photo 1;S2 photo 2; S3 photo 3)
DATA ANALYSIS
Scoring system: indicators used were assigned a score from 0 to 3 based on the degree of
disturbance (17): 0- no human impact, 1- presence but no major disturbance, 2- highly
disturbed with widespread impact, 3- major disturbance. Usual data analysis was performed
to estimate the diversity (Shannon index) and the coefficient of variation (CV) to compare
the elasticity phenotypic of Gambusia affinis sampled in various habitats. The score of
disturbance was calculated according to (18).
Zemmouri site (table 1)
Table 1: General index of disturbance in Zemmouri bay (station 1 & station 2)
Habitat disturbance: according to the 2 ecological traits considered in Zemmouri site ,the
general index estimated was a) GD= 0.65 in the first station (Zemmouri 1) and b) GD=0.45
in the station 2 (near the forest).The area of native site is seriously changed (disturbed) with
respect to the historical data’s (19;20).The severe disturbance, characterizing the station (1)
is a consequence of the abstraction of the sand dunes for several decades even if the station
(2) is affected by an uncontrolled human frequentation.
Impact on the malacological fauna and vegetal carpet
Destruction of the dunes and vegetal carpet: a strong abstraction of the dune sand drives to
the destruction of these last and the destruction of the vegetal carpet (station 1).
Loss of biodiversity and reduction of population density (molluscan assemblage): The
mollusc fauna is represented by several groups in this region as wild populations: (Helix
aspersa M.,Helix aperta Born, Helix melanostoma Darparnaud, Eobania vermiculata M.),
dominated by a dune Mediterranean snail Euparypha pisana (M.).The dune snail, very
frequent on the Mediterranean coast lives in colonies of individuals (30-40), very visible on
the fringe of the coastal dunes, particularly at the end of the spring, in summer and in the
beginning of the autumnal season. In summer, in reaction to the high temperatures, this
snail climbs on plants (21) where it can form clusters. The mollusc fauna seems to be the
alone represented on the sand dunes by some sparse populations of Euparypha pisana (M.),
the Mediterranean snail. However, the total absence of mollusc colonies (station 1) and the
sparse aspect of these colonies in (station 2) indicate the existence without ambiguousness
of human disturbance exercises on this site induced by the abstraction of the sand and other
factors (22).
Natural events induced disturbance in Zemmouri site
Meteorological environment: The observation of the statistical data, relative to the surge at
the algerian coasts show that the studied site is submissive to the action of the surges from
two main directions: surges of NE and the surges of NW. the surges of NW are the most
active on the coasts of Boumerdes - Zemmouri (site studied).
Sedimentary survey: the goal of this sedimentary survey allows to understand the hydro
sedimentary mechanisms of the Zemmouri region, consequently of the studied site. In
order to could reconstitute the assignation of the superficial sediments and seeking their
mode of stake in places. The results will allow understanding the impact of the exploitation
of the sand from this site in relation with the sedimentary transit, there; we should be able to
make recommendations on the problems which could emanate of it.
Data’s analysis of granular curves: the exam of the accumulate curves show that the totality
of these curves are only with one mode, except for three samples; this situation could be
explained by the homogeneous nature of sediments; these results are confirmed by the
medians values (personal communication).
Reghaia site (Table 2)
Table: General index of disturbance in Reghaia reserve (station 1, station 2 and station 3)
With respect to the 02 ecological traits considered two levels of disturbance had been
observed a) moderate disturbance observed on the station 3 (Quadous chenal, GD= 0.46)
and station 2 (north of the lake, GD = 0.47) b) a severe disturbance characterize the station1
(Reghaia), this last station suffers of various pollutant rejects(domestic wastage, industrial,
grazing by livestock, etc.).
We examined the evolution of physico -chemical parameters and nutrients during
observations obtained over 10 years. The aquatic zone of the reserve is under increasing
pressure from anthropogenic impacts added to the climate change effects. Human activity
(domestic, agricultural, delivers a high level of chemical elements, microbial contaminants
and other metals which affects seriously the lake water used abundantly for agricultural
irrigation. The level of disturbance is increasing according to a gradient South-North. The
station 1 (Reghaia 1) is the most exposed to the disturbance, it suffers from industrial
pollutant, an uncontrolled urbanization and an important tourist activity. The disturbance
degree decrease significantly in the rest of stations (Reghaia 2 and Reghaia 3).
Evolution of physic parameters
Temperature: Globally, the temperatures values, greatly correlated to air temperatures
follow season temperatures (low in winters, increasing in spring, summer, not stable in
autumn).
 pH: The concentration of the activity of the hydrogen ion [H+] in a solution
determines the pH. A pH evaluated between 6 and 9 permits to assure the protection
and the survival of freshwater fish and other aquatic organisms (macro
invertebrates).The range of pH value (7.00 to 8.9) – at the limits values.
 Conductivity: the gotten values oscillate between 1200 s/m and 1500s/m which
characterizes an unsettled environment. It results in a strong mineralization,
consequence of agricultural and domestic dismissal,
 Oxygen (O2): the presence of dissolved oxygen guarantees the quality of water. It is
a necessary element to the development of the life. The process of natural
purification of rivers and lakes requires levels of oxygen adequate to assure the
aerobe life aerobe. The range of values varies from 2.5 mg/l to 10mg/l (low in
winter, increase in spring).
Chemical parameters
Nitrate: the azote compounds serve as nourishing substances in aquatic biotopes (lakes,
rivers, etc.. Reactions to the nitrate [NO3 -] in lake water can provoke an impoverishment in
oxygen. Therefore, the aquatic organisms depending on the present oxygen won’t be able to
survive. The recorded values are important, particularly in the lake (station 1 and station 2),
the main ways of nitrogen penetration in water are the urban and industrial worn-out waters,
the septic pits etc.
Fecal Bacteria
The presence of fecal bacteria was reported. It reveals water polluted by the human and
animal fecal matter. This pollution could entail the apparition in the water of pathogen
microorganisms, knowing that the water of the lake is used by agriculturists for the
irrigation.
What about the biodiversity?
Fish species:
Genus Gambusia: populations of Gambusia affinis are abundantly observed in the north
part of the lake (station 2) and the canal (station 3) even if no presence of this last in the
south part (disturbed).
European eel: The European eel(A.anguilla) was regularly captured (by electro fishing)
until 2007 year in Quadous canal (station 3), since there, no capture has been achieved. The
explanation would be the effect of pollution that increases gradually each year and probably
the effects of the climatic changes.
Bird’s populations: It signals more than 200 species winter in the lake with 55 species
reproducing in the reserve. In the lake populations of birds occupy the north part
characterized by very dense aquatic vegetation. The strong human company can influence
negatively on populations, notably during the spawning period.
Phenotypic elasticity: the coefficient of variation comparison between a population of
Reghaia (disturbed site) and a population from a non disturbed site (El Hamma garden)
shows a large difference (Cv Reghaia > Cv El Hamma),this situation explain the induced
effect of the environment on the phenotypic plasticity.
CONCLUSION
Disturbance is an important component of all ecosystems, it provokes disturbance in every
level of life organization. Through the two examples reported in this survey, the origins of
disturbances could be diverse but dominated by anthropogenic effect.
In Zemmour bay: for the needs of preserving the local environment, we will make the
following recommendations.
The region of the site explored counts several sources of sand. Among these three sources
the beaches are the most vulnerable for the following reasons:
- The process of reconstitution is very slowness.
- It could provoke physics process which evolves independently to real ecological
disasters, as the advanced of the sea and its action on the coast.
Pollution process: the mixed underground freshwater with the salty waters of the sea, the
deterioration of the agricultural earth; are likely events.
It would be important of privileging the natural vocation of the beaches (tourist and
ecological site) with notably the reforestation of sites explored in the beaches which would
allow protecting the agricultural earth of the advanced sands of the beach under the action
of the wind.
Reghaia site: The reserve natural of Reghaia, the main wetland of Algiers region. Its
biodiversity seems to be threatened according the increasing level of pollution. It is urgent
to institute a rigorous planning plan in order to avoid damages that can prove to be
irreversible.
ACKNOWLEDGEMENTS
This contribution would not have been possible without the contribution of several
anonymous, during the visits on sites. Y Bouhadad has a large contribution in the
interpretation of geological data’s.
reduces in summer. Winter in Siah Kashim coincides with death of many macrophytes,
which provide space for aggregation of insect larvae as benthic animals. This may cause a
reduction in benthos of Siah Kashim in winter.
REFERENCES
[1] Baillie JEM, Hilton-taylor C, Stuart S N(2004):IUCN red list of threatened species.A global species
assessment .IUCN, Gland, Switzerland/Cambridje, UK.
[2]Agetsuma N,koda R, Tsujino R , Agetsuma-yanagihara Y(2014):Imact of anthropogenic disturbance on the
density and activity pattern of deer evaluatedwith respect to spatial scale-dependancy. Mammalian
biology 79, 44-51.
[3]Coulon A, Morellet N, Goulard M, cargnelutti B, Angibault J , Hewisson AJM (2008): inferring the effects
of landscape structure on roe deer
[4]Fletcher R J J , Hutto RL (2008):partitioning multi-scale effects of human activity on the occurrence of
riparian forest birds. Landsc. Ecol. 23, 727- 739.
[5]Hockin D, ounsted M, Gorman M, Hill D, Keller V, barker MA (1992):Examination of the effects of
disturbance on birds with references to its importance in ecological assessment. J. environm.
Manage. 36, 253-286.
[6] Silva-Rodriguez EA, Sieving KE(2012):Domestic dogs shape the landscape-scale distribution of a
threatened forest ungulates. Biol. Conserv.150, 103-110.
[7] Kilgo JC,Labisky RF, Fritzen DE(1998) :influences of hunting and the behavior of white –tailed
deer:implications for conservation of the Florida Panther. Cons. Biol. 12, 1359-1364.
[8] Gill JA, Norris K, Sutherland WJ( 2001):Why behavioral responses may not reflect the population
consequences of human disturbance.Biol. Cons.97,265-268
[9]Gozlan, R. E., Andreou, D, Asaeda, T., Beyer, K., Bouhadad, R., Burnard, D., Caiola, N., Cakic, P.,
Djikanovic, V., Esmaeili, H.R., Falka, I., Golicher, D., Harka, A., Jeney, G., Kovac, V., Musil, J.,
Nocita, A., Povz, M., Poulet, N., Virbickas, T., Wolter, T., Tarkan, S., Tricarico, E., Verreycken, H.,
Witkowski, A., Zhang, C.G., Zweimuelle, I. and Britton, J.R., 2010. Pan-continental invasion of
Pseudorasbora parva: towards a better understanding freshwater fish invasions. Fish and Fisheries, 11
(4), pp. 315-340.
[10] Bouhadad R (2010) :Impact des espèces invasives et des hangements climatiques sur laperte de la
diversité de la faune ichtyologique : qu’en est-il de laperte de la diversité de la faune ichtyologique :
qu’en est-il de laréalité algérienne ?international Congress Systemic Management of Fisheries
Resources,29 - 30 November 2010.
[12] Blaustein A R (1994):Chicken little or nero’s fiddle: a perspective on declining amphibian populations.
Herpetological 50, 85-97.
[13] Blaustein AR, wake DB (1995): the puzzle of declining amphibian populations . Scientific American
272, 52- 57.
[14] Collins JP,Storfer A(2003): global amphibian declines: sorting the hypotheses. Diversity & Distribution
9, 89-98.
[15] Christ C, Hillel O, Matus S, Sweeting G (2003):tourism and biodiversity: mapping tourism’s global foot
print. Conservation international, Washington/Durban.
[16] Rodriguez-Prieto and al.,2004
[17] van Beynen P, Bialkowska-Jelinska E( 2012) : Human disturbance of the waitomocatchment, New
Zealand. Journal of Environment Management 108: 130- 140
[18] North L A, van Beynen P E, Parise M(2009):Interregional comparison of karst disturbance: west central
florida and south east italy. J. Environ. Manag. 90(5), 1770-1781
[19] SadkiI,N.,Khelifi,H., et Djebaili,S., 1991.La végétation des dunes maritimes de l’Est d’Alger.colloque
phyto-sociologique XX, phytodynamique et biogéographique (historique des forêts.pp. 370-375.
[20] Bouhadad R., 1987- Polymorphisme et génétique des populations d’un mollusque gastéropode pulmoné
E. pisana (M.) thèse de Magister, FSB, USTHB, 91 p.
[21] Sacchi, C.F. 1986. Les gastéropodes dunicoles de la Sardaigne méridionale: essai écologique. Rev.
d'Ecol. Biol Sol 123, 77-88.
[22]Terlizzi A, scuderi D, fraschetti S, Anderson MJ(2005): Quantifying effects of pollution on biodiversity: a
case study of highly diverse molluscan assemblages in the Mediterranean. Marine Biology 148: 293305.
Effect of Anthropogenic Activities on the Costal Waters of Persian Gulf
Effect of Anthropogenic Activities on the costal waters of Persian Gulf
Aliakbar Hedayati
Gorgan University of Agricultural Sciences and Natural Resources (Gorgan, Iran)[email protected] ; [email protected]
SUMMARY
Modern human life result to the increasing use of a wide range of chemicals. These chemicals are most
produced near the water systems, and their breakdown products, by-products and waste generated as part of
the production process finally end up into the water. Five sampling stations from Mahshahr coastal waters
which were considered important for their commercial and recreational potential were selected to enumerate
the presence of mercury and its synergetic action on the liver of Acanthopagrus latus. Mercury concentrations
were determined by using a standard cold vapor atomic absorption method equipped with Hg cold vapor
generator. Accumulation factors were calculated by the ratio between metal concentrations in liver and water.
All stations had higher levels of mercury contamination in all measurements that were noticeably close to an
area of industrial activities (oil and petrochemistry). The range of mercury concentrations found in the costal
waters was high. Water mercury concentrations ranged between 3 and 10 µg/l. The bioaccumulation factor
observed with respect to the water ranged between 1152 and 3041 (median value ≈ 2000). The observations
strongly suggest that increase of mercury in the surrounded water will be accumulating much more in liver
tissue. Mercury concentrations in the liver ranged between 4000 to 26000 µg/l in different costal confirm
mercury accumulation in the liver of Yellowfin seabream in closed costal with different source of pollutant.
Our results show that anthropogenic activities can significantly increased mercury levels in the water in
closed costal waters. These differences denote a contamination gradient according to the distance to the point
source of mercury into the system.
Keywords: Costal water, Global change, Fish, Marine pollution, Mercury.
INTRODUCTION
Physiological stress indicators such as some hematological and blood parameters could be
useful to evaluate the effects of contaminants such as heavy metals in fish, but the
application of these findings to preparation of environmental diagnoses will need a more
detailed investigation and must be validated in situ before establishing them as biomarkers
[1]. The finding of suitable biomarkers for the best possible diagnoses is very critical for
ecotoxicological studies. Blood indices are considered pathophysiological parameters of the
whole body and therefore are important in diagnosing the structural and functional status of
fish exposed to xenobiotics [2]. Although fish blood indices have been increasingly
examined in ecosystem monitoring programs as valuable parameters of physiological
changes in the presence of xenobiotics, the lack of basic knowledge about the blood
response to stressors mainly from tropical species is the most important leakage to using
these indices in environmental monitoring programs [3]. Physiological changes induced by
xenobiotics are also apparent at the biochemical and physiological level, such as in the
carbohydrate and protein metabolism and in hematology. In cases where these alternations
are adaptive they are referred to as stress responses, while they are considered effects when
they have a negative cause on the physiological condition or even survival of the fish [4].
Hematotoxins change quantitative and qualitative characteristics of blood cells to produce
toxic symptoms. Hematotoxicity happen when some of these different blood components
are present or structural anomalies occurring in blood components interfere with normal
functioning.
Several biochemical and physiological responses occur when a fish exposed to the
xenobiotics, if fish cannot tolerate and acclimatized it may lead to toxicity [5]. Fish blood is
sensitive to pollution-induced stress and changes in the hematological and metabolic
parameters can be used as toxicity indices of xenobiotics [6].
Glucose is a carbohydrate that has a major role in the bioenergetics of animals, being
transformed to chemical energy (ATP), which in turn can be expressed as mechanical
energy [7]. Levels of glucose were measured as conventional stress markers to assess the
reliability of stress response triggered under our test condition.
Most biochemical defenses respond to cellular injury by increasing levels of defenses
through self-regulating signal transduction mechanisms. These defenses are usually proteins
that serve numerous cellular functions [8]. Thus, measuring these systems may provide
early warning of danger to the cell as well as help elucidate potential mechanisms of
cellular injury.
To date, little is known about the blood parameters of stressed fish. In current study blood
biomarkers were measured in order to investigate patterns of response and to quantify the
extent of alterations caused by the mercury pollution, so in this study, a multi factorial
approach, involving determining bloods parameters along with serum metabolites during
the environmental exposure of mercury pollution was used. The information gained from
this study may be useful for future strategies in monitoring and predicting the effects of
mercury exposure and also in developing indices to measure stress during sea bream
culture.
Environmental test
In natural condition, at first with mercury analysis of water and sediment (method details in
bellow) of 26 creeks in Mahshahr region (northwest of Persian Gulf) (Fig. 1) we choose
four more pollutant (Jafari, Ghazaleh, Majidieh and Petroshimi) and one less pollutant
creeks (Zangi). For every creek we choose three station and in every station one water and
sediment sample collected, also two yellowfin sea bream with the same size (200 g) and
same sexually (all immature male) were caught.
Figure 1. Environmental test area
Mercury analysis
In laboratory water samples were filtered with Millipore strainer mesh size 0.45 µm, the
filtrate was then acidified with 2mg/l of 20% K2Cr2O7 (w/v) prepared at nitric acid (APHA,
2005) and soluble store at -4 ºC until mercury analyses. For stabilize of weight, the
sediments were freeze-dried [9], then were sieved through 63 µ mesh and were allowed to
settle, the supernatant water decanted and homogenized, finely powdered sediment
subsamples were dissolved in 60 ml container 4 ml of concentrated nitric acid and 2 ml of
concentrated sulfuric acid. The mixture was digested at 90°C for l-2 h in hot plate. Upon
cooling, 1 ml K2Cr2O7 or 0.5 ml BrCl was added. The solution was filtered using Whatman
No.1 filter paper and diluted to 50 ml with deionized water [10] and preserved prior to Hg
analysis. Mercury concentrations were determined by the Department of Marine Chemistry
Laboratory, Khorramshahr University of Marine Science & Technology using a standard
cold vapor atomic absorption (CV-AAS) method (Unicam 919) equipped with Hg cold
vapor generator (VGA 77) [11].
Blood Sampling
To obtain blood samples, fish were quickly taken out from the water and held firmly on a
bench with a cloth covering the head and blood was withdrawn from caudal vessels (Savari
et al., 2010). were for hematology and leukocyte analysis, and the second were centrifuged
to obtain serum. The serums were separated into aliquots and were frozen and stored at −80
°C until metabolite analyses.
Hematological analysis
Numbers of Blood leukocytes (Lk count 104 cells ml_1) was performed by diluting
heparinized blood with Giemsa stain at 1:30 dilution and cells were counted using a
hemocytometer Neubauer under the light microscope [12]. The leukocyte differential count
was made in peripheral blood smears stained by Merck Giemsa [13], giving the Neutrophils
value of differential neutrophils (100 leukocytes count) and the Mononuclear value of
differential lymphocytes plus monocyte and eosinophile (100 leukocytes count).
Blood centrifuged in a microhematocrit centrifuge (Hettich, Germany) then measuring the
packed cell volume [13]; Hematocrit readings were performed with the aid of a
microhematocrit reader. Hemoglobin levels (Hb mg/l) were determined colorimetrically by
measuring the formation of cyanomethemoglobin according to [14]. MCHC Mean cell
hemoglobin concentration; relative quantity of Hb per erythrocyte; measured directly from
the optical properties of the cell, or derived as MCHC (mg l-1) = Hb (mgdl-1) / Ht (ratio)
[15].
Metabolite analyses
Serum glucose was measured photometrically according to a method modified from
Banauch et al. [16] based on the quantification of NADH after a glucose oxidation
catalyzed by glucosedehydrogenase. The quantity of NADH formed is proportional to the
glucose concentration. Serum total protein levels were determined using Pars Azmoon, Iran
(1 500 028) kit, with bovine serum albumin serving as standard by the method of Lowry at
546 nm and 37C [17].
Statistical procedures
For each biomarker, the data were tested for normality and homogeneity. One-way analysis
of variance ANOVA with Duncan Post Hoc was used to determine significant differences
to evaluate the effect of mercury on parameters. To investigate associations between
bioaccumulation and its effects, Pearson correlation coefficients (r) were calculated between
mercury concentrations and blood parameters. The differences between means were
analyzed at the 5% probability level. Data are reported as means ± standard deviation (
X  SD ).
RESULTS
Mercury
In different creeks significant differences were found between the sampling stations. The
range of mercury concentrations found in the creeks water and specially sediments along
the Mahshahr coast was high. From the stations it was possible to observe a gradient of
metal contamination. Station Zangi had lower levels of mercury contamination in all
measurements and choose as clean station. Other Stations had higher levels of mercury
contamination in all measurements and were choosed as infected station. Stations Majidieh
and Petroshimi were noticeably close to an area of industrial activities (oil and
petrochemistry respectively) and higher amount were predictable.
The analytical data were normalized to the distance from the creeks with water and
sediment mercury (Fig. 2). Concentrations of both water and sediment mercury were
strongly higher in infected creeks than the clean one, however this increase in water
mercury was realizable. In general, the highest concentrations of mercury for water and
sediment had same progress. These observations strongly suggest that anthropogenic
activities can significantly increased mercury levels in the water and sediment even in
closed creek. These differences denote a contamination gradient according to the distance to
the point source of mercury into the system, Petroshimi and Majidieh being the closest and
Zangi and Jafari the furthest creeks to the anthropogenic activities near the Mahshahr coast.
2000
14
sediment mercury (ppb)
Water mercury (µg/l)
12
10
8
6
4
1000
2
0
0
zangi
jafary
ghazaleh
Creeks
majidieh
petroshimi
zangi
jafary
ghazaleh
majidieh
petroshimi
Creeks
Fig. 2. Environmental concentration of mercury chloride (µg/l) in the water & sediment of different
creeks in Mahshahr coast with different source of pollutant (box plots contain mean and standard
deviation).
Hematological & Immunological analysis
Results of environmental hematological and immunological analysis are presented in table
1. All in indices exhibited high significant analysis of variance (P<0.05) except differential
eosinophils. Environmental result declared significance increase of differential monocyte
and neutrophil within higher considerable values than those of the control group, beside
significance decrease of Hb, Ht, leukocyte count, differential lymphocyte, eosinophyle and
MCHC (P>0.05) with lower considerable values than those of the control group.
Table 1: Environmental hematological and immunological activities of yellowfin seabream
exposed to water mercury
Hb (mg/l)
Ht (%)
MCHC(mg/l)
Leukocyte (/ml)
Lymphocyte (%)
Monocyte (%)
Neutrophil (%)
Eosinophils (%)
Zangi
8.98±0.3b
26.1±1.9bc
0.34±0.02a
12141±1313a
78.3±2a
1.83±0.75b
16.8±0.7b
4.5±1.5a
Jafari
9.56±0.1a
30.1±1.7a
0.31±0.01b
10821±526b
71±4b
3.16±0.75a
20.3±2.1a
4.5±1.5a
Ghazaleh
7.66±0.3c
24.1±1.1cd
0.31±0.01b
11385±262ab
71.8±3b
2.83±0.75ab
22±3.2a
3.1±1.1a
Majidieh
7.8±0.6c
23.1±2d
0.33±0.007ab
11381±952ab
74.6±2ab
3.33±1.63a
19.3±2.5ab
2.6±1.6a
Petroshimi
8.68±0.3b
26.6±1.5b
0.32±0.01ab
10563±1161b
72.6±2b
3.66±0.81a
19.6±1.5a
3.1±1.1a
Correlation coefficients between water mercury concentrations and hematological and
immunological indices were significant in Hb, Ht, Monocyte, Neutrophil and Eosinophils
(P<0.05), that among significant parameters Monocyte, Neutrophil, Eosinophils were
positive and Hb, Ht correlation were negative in correlate with water mercury and among
insignificant indices only Monocyte had positive and other indices had negative correlation
(table 2).
Table 2: Environmental correlation of hematological and immunological activities of yellowfin
seabream with water mercury
Hb
Ht
MCHC Leukocyte
Lymphocyte
Monocyte
Neutrophil
-0.47**
-0.66**
-0.53**
0.43*
0.46*
**
**
0.70
0.49
(p) 0.00
0.00
0.00
0.00
0.00
0.01
0.01
* Correlation is significant at the 0.05 level, ** Correlation is significant at the 0.01 level
(r)
Eosinophils
0.49**
0.00
Result of sediment correlation show only Leukocyte had significant negative correlate
whereas within insignificant parameter Hb, MCHC, Monocyte and Eosinophils had positive
correlation with sediment mercury and Ht, Lymphocyte and Neutrophil had negative
correlation (table 3).
Table 3: Environmental correlation of hematological and immunological activities of yellowfin
seabream with sediment mercury
(r)
(p)
Hb
0.13
0.49
Ht
-0.14
0.46
MCHC
0.26
0.15
Leukocyte
-0.62**
0.00
Lymphocyte
-0.38*
0.04
Monocyte
0.23
0.21
Neutrophil
-0.32*
0.05
Eosinophils
0.08
0.67
* Correlation is significant at the 0.05 level,
Biochemical analysis
Values recorded for activity of total protein show significant depletion in infected creeks
with respect to clean creek. Glucose was significantly increased in infected creeks with
respect to clean creek (Fig. 3).
6.5
300
5.5
Total Protein (mg/dl)
Glucose (mg/dl)
6.0
200
100
5.0
4.5
4.0
3.5
3.0
0
zangi
jafary
ghazaleh
Creeks
majidieh
petroshimi
zangi
jafary
ghazaleh
majidieh
petroshimi
Creeks
Figure 3: Metabolites response (Glucose & Total protein) of the yellowfin seabream during
environmental exposed to different concentration of mercury chloride (box plots contain mean and
standard deviation for glucose, beside line chart for total protein).
Correlation coefficients between water mercury concentrations and biochemical indices
wasn’t significant (P<0.05), however both correlation were negative in correlate with water
mercury (table 4). Result of sediment correlation show only glucose had significant positive
correlate whereas glucose parameter had negative correlation with sediment mercury (Table
5).
Table 4: Environmental correlation of metabolites activities of yellowfin seabream with water
mercury
Glucose
Total protein
Pearson correlation (r)
-0.29
-0.38*
sig (p)
0.11
0.03
Table 5: Environmental correlation of metabolites activities of yellowfin seabream with
sediment mercury
Glucose
Total protein
Pearson correlation (r)
0.39*
-0.22
sig (p)
0.03
0.24
DISCUSSION
The range of mercury concentrations founded in the creeks water and specially sediments
along the Mahshahr coast was higher than other marine environment, so it reveals that is an
area requiring a special concern in order to avoid future environmental problems.
Correlation results and analytical results show that there weren’t high correlation between
surrounded mercury and candidate indices, and all indices show admissible correlate in total
condition. So eventually it was declared that between hematological indices MCHC gain
suitable qualification to become a suitable biomarker, and between immunological indices
leukocyte count, neutrophil and lymphocyte can consider as suitable and effective
biomarker of mercury pollution in yellowfin seabream. Also between metabolite indices we
can introduce Total protein as suitable and effective biomarker of mercury pollution.
The most common hematology findings in toxicology studies are mild decreases in RBC
count, hemoglobin concentration, and hematocrit. Although specific mechanisms for the
erythrocyte effects are typically not identified, there appears to be a generalized reduction
of anabolic processes, including erythropoiesis. Decreased physical activity and
correspondingly decreased tissue oxygen demand can also contribute to reduced
erythropoiesis [2]. For example, Palackova et al., [18] found an elevation in both
parameters after exposure to Cadmium. Therefore, the effects of heavy metal on these two
blood parameters appear variable and dependent on the exposure scenario and
acclimatization conditions of the fish [19]. Some toxicants (e.g., heavy metals) can cause
RBCs to be released from the kidny. Proportionate increases in red cell numbers,
hemoglobin, or hematocrit generally reflect hemoconcentration and dehydration [20]. An
intracellular mean cell hemoglobin concentration (MCHC) of approximately 0.34 mg/l
appears to be an important factor that limits cell divisions, and this MCHC value of
approximately 0.34 mg/l is found across all of the healthy adult common laboratory
animals, whereas other erythrocytic parameters differ more between species [15]. Oliveira
Ribeiro et al [1] find no significant effects in MCHC for all tested metals in fish Hoplias
malabaricus. This parameter reflect increased production and release of reticulocytes that
are larger in size and have decreased hemoglobin content compared to mature RBCs [20].
The cell population numbers may be increased and termed cytosis or philia; reductions of
cell numbers are termed penia. Our result show decreased in lymphocyte and eosinophils in
contrast to increase of monocyte and neutrophil during mercury exposure, so
Lymphocytopenia, Eosinopenia versus Monocytosis and Neutrophilia were happened in
current results that bellow are explained.
It is believed that neutrophils and monocytes have phagocytic activity which might explain
their increased percentage during infectious situations. Lee et al. [14] also found an increase
of neutrophil counts in channel catfish exposed to high doses of potassium permanganate.
Adhikari et al [2] find a reduction in some immunological parameters (leukocyte and
lymphocyte counts) and the increase in neutrophil and monocyte percentages were
demonstrated in HgCl2 exposed. It is known that changes in leukocyte counts after exposure
to pollutants may be associated to a decrease in nonspecific immunity of the fish. Lohner et
al [21] find Leukopenia (reduced Leukocyte counts) and increase in both Neutrophils and
Monocyte of Sunfish Populations (Lepomis sp.) in different creeks. WBC abundance
provides an indication of fish health and a high WBC count may indicate a subclinical
infection. An extremely low WBC count indicates either suppression of circulating
lymphocytes, a characteristic acute stress response, or that an active bacterial infection has
induced leukocytolysis [15]. Result of current study show same progress of biochemical
indices in both test condition with elevation in glucose and depletion in total protein
(Hyperglycemia and Hypoproteinemia respectivelly).
Levels of glucose often increase during the first phase of the stress response due to an
elevated breakdown of glycogen [22]. Significant increases in glucose were observed as a
result of toxic effect of Cu [23].These results may be attributed to the hepatocellular
damage. The plasma glucose concentration of gilthead sea bream exposed to acute
confinement was increased [24]. From aspect of increase, our observations show no
disagreement with the literature values.
Some studies indicate a decrease in total protein content during heavy metal exposure. Such
decreases were, for example, found in the edible crab Scylla serrata exposed to cadmium or
in the freshwater fish Sarotherodon mossambicus and the common carp exposed to mercury
(Canli, 1996). Depletion in the protein content of the Catla catla exposed to mercury
chloride sub-lethal concentrations were estimated (Prasath and Arivoli, 2008).
CONCLUSION
The major findings of this study are that mercury is a toxic substance in yellowfin sea
bream, with many severs change on blood parameters to various concentrations. Results of
the present investigation indicated that chronic mercury concentrations tested may cause
several changes in the hematological and metabolite parameters of the studied fish and we
can use these changes as biomarkers of mercury detection.
ACKNOWLEDGEMENTS
The authors are thankful to the Khorramshahr University of Marine Sciences and
Technology and National Elite Foundation for providing financial support and necessary
facilities.
REFERENCES
[1] Oliveira Ribeiro, C.A., Filipack Neto, F., Mela, M., Silva, P.H., Randi, M.A.F., Costa, J.R.A., & Pelletier,
E. (2006). Hematological findings in neotropical fish Hoplias malabaricus exposed to subchronic and
dietary doses of methylmercury, inorganic lead and tributyltin chloride. Environ. Res. 101, 74–80.
[2] Gad, S.C. (2007). Animal Models in Toxicology. CRC Press. pp: 950.
[3] Affonso, E.G., Polez, V.L.P., Correa, C.F., Mazon, A.F., Araujo, M.R.R., Moraes, G., & Ratin, F.T.
(2002). Blood parameters and metabolites in the teleosts fish Colossoma macropomum exposed to
sulfide or hypoxia. Comp. Biochem. Physiol. C 133, 375–382.
[4] Barton, B.A., & Iwama, G.K. (1991). Physiological changes in fish from stress in aquaculture with
emphasis on the response and effects of corticosteroids. Annu. Rev. Fish Dis. 1, 3-26.
[5] Begum, G. (2004). Carbofuran insecticide induced biochemical alterations in liver and muscle tissues of
the fish Clarias batrachus (Linn.) and recovery response. Aquat. Toxicol. 66, 83–92.
[6] Sancho, E., Ceron, J.J., & Ferrando, M.D., 2000. Cholinesterase activity and hematological parameters as
biomarkers of sublethal molinate exposure in Anguilla anguilla. Ecotoxicol. Environ. Safe. 46, 81–
86.
[7] Lucas, A. (1996). Physical concepts of bioenergetics. In: Lucas, A. (ed). Bioenergetics of aquatic animals.
English edition, Taylor & Francis, France.
[8] Safahieh, A., Hedayati, A., Savari, A., & Marammazi, J.G., 2010. Effect of in vitro exposure to mercury
chloride on phosphatase enzymes in Yellowfin sea bream. American-Eurasian Journal of
Toxicological Sceince. 2(3): 162-168.
[9] Shi, J., Liang L., Jiang G. & Jin X., 2005. The speciation and bioavailability of mercury in sediments of
Haihe River, China, Environment International 31: 357–365.
[10] MOOPAM, (Manual of Oceanographic Observations and Pollutant Analyses Methods). (1999). ROPME,
Kuwait.
[11] EPA (U.S. Environmental Protection Agency). (1992). Quality Criteria for Water 1992. U.S. EPA, Office
of Water, Criteria and Standards Division, Washington, DC.
[12] Stevens, M.L., 1997. Fundamentals of Clinical Hematology. WB Saunders, Philadelphia, PA.
[13] Beutler, E., Lichtman, M.A., Coller B.S., & Seligsohn, U. ( 2001). Hematology, sixth ed. McGraw-Hill,
USA.
[14] Lee, R.G., Foerster, J., Jukens, J., Paraskevas, F., Greer, J.P., & Rodgers, G.M. (1998). Wintrobe’s—
Clinical Hematology, 10th ed. Lippincott Williams & Wilkins, New York, USA.
[15] Evans, G.O. (2009). Animal Hematotoxicology. CRC Press. pp: 204.
[16] Banauch, D., Brummer, W., Ebeling, W., Metz, H., Rindfrey, H., Lang, H. (1975). A glucose
dehydrogenase for the determination of glucose concentrations in body fluids. Z Klin Chem Klin
Biochem.13:101–7.
[17] Hedayati, A., Safahieh, A., Savar, A., & Ghofleh Marammazi, J. (2010a). Detection of mercury chloride
acute toxicity in Yellowfin sea bream (Acanthopagrus latus). World Journal of Fish and Marine
Science. 2(1): 86-92.
[18] Palackova, J., Pravda, D., Fasaic, K., & Celechovska, O. (1994). Sublethal effects of cadmium on carp
(Cyprinus carpio) fingerlings. In Sublethal Chronic Effects of Pollutants on Freshwater Fish (R. MuK
ller and R. Lloyd, Eds.), pp. 53-61. Arnette Blackwell SA, France.
[19] Smet, H., & Blust, R., 2001, Stress Responses and Changes in Protein Metabolism in Carp Cyprinus
carpio during Cadmium Exposure, Ecotoxicology and Environmental Safety 48, 255-262 .
[20] Haschek, W.M., Walling, M.A., & Rousseaux, C. (2010). fundamental of toxicologic pathology.
Academic Press. pp:686.
[21] Lohner, T.W., Reash, R.J., Willet, V.E., & Rose, L.A. (2001). Assessment of tolerant sun fish
populations (Lepomis sp.) inhabiting selenium-laden coal ash efluents. Ecotoxicol. Environ. Saf. 50,
203–216.
[22] Wendelaar-Bonga, S.E., 1997. The stress response in fish. Physiol. Rev. 77, 591-625.
[23] Abdel-Tawwab, M., Mousa, M., & Abbass, F. (2007). Growth performance and physiological response
of African catfish, Clarias gariepinus (B.) fed organic selenium prior to the exposure to
environmental copper toxicity. Aquaculture 272. 335–345.
[24] Saera-Vila, A., Calduch-Giner, J., Prunet, P., & Pérez-Sánchez, J. (2009). Dynamics of liver GH/IGF
axis and selected stress markers in juvenile gilthead sea bream (Sparus aurata) exposed to acute
confinement Differential stress response of growth hormone receptors Comparative Biochemistry
and Physiology, Part A 154. 197–203.
La Conchyliculture en Algerie : Situation Actuelle et Perspectives de Développement
La conchyliculture en Algerie : situation actuelle et perspectives de
developpement
Meslem-Haoui N.1, Boubechiche Z. 2, Lourguioui H. 3, Rebzani C. 4
Ecole Nationale Supérieure des Sciences de la Mer et de l’Aménagement du Littoral, Alger, Algérie
4
Laboratoire de Biologie Marine, Faculté des Sciences Biologiques, Université des Sciences et de la
Technologie Houari Boumediene, Alger, Algérie
1, 2, 3
RESUME
En Algérie, la conchyliculture est de pratique ancienne : elle a démarré en 1880 par des essais d'ostréicultures
menée à Mars El-Kabîr (W. Oran) et à oued Sebao (W. Tizi Ouzou). En 1921, une station expérimentale pour
l'aquaculture et la pêche est construite à Bou Ismail afin de mettre en place les meilleures techniques de
production et identifier les sites favorables à la conchyliculture. Dans le cadre d’une coopération avec la
FAO, l’élevage sur tables conchylicoles est réalisé au lac El Mellah (El-Kala) dans les années 70, avec des
résultats encourageants obtenus jusqu'à la fin des années 80. A partir de 1991, la conchyliculture en mer
ouverte démarre et actuellement deux professionnels algériens, sont en phase de production. Néanmoins, la
production de bivalves, représentée essentiellement par celle des moules, est faible et reste inférieure à 45
tonnes/an. Quant à la production d’huitres, elle est inférieure à 374 kg/an. Cette faible production est due à
plusieurs raisons dont l’approvisionnement en naissain, problème majeur qui freine le développement de la
filière conchylicole et notamment ostréicole. Ce travail a pour objectif de présenter la situation actuelle de la
conchyliculture en Algérie, les problèmes empêchant le développement de la filière ainsi que les perspectives
de développement.
Mots clés : Crassostrea gigas, Performances de croissance, Ostréiculture, Elevage en suspension
INTRODUCTION
La culture de mollusques bivalves est un secteur important. En 2010, la conchyliculture
mondiale produit 14.2 millions de tonnes soit 18 % de la production aquacole mondiale
pour un chiffre d'affaire de 14,4 milliards d'US $ [1]. En Algérie, malgré un environnement
favorable, la production de coquillages est actuellement insignifiante comparée à celle
d’autres pays de la méditerranée. Avec plus de 1200 km de côte, la façade maritime
algérienne offre plusieurs sites potentiels pour l’implantation et le développement de la
conchyliculture.
Histoire et aperçu de la conchyliculture
En Algérie, la conchyliculture est de pratique ancienne, son histoire peut se résumer comme
suit:
 1880 : initiation de l’ostréiculture menée à titre expérimentale à Mars El Kabîr (w.
Oran) et à Oued Sebao (w. Tizi Ouzou)
 1921 : création de la station de Bou-Ismail (Est d'Alger) afin de déterminer les
meilleures sites et méthodes pour l’élevage de l’huitre Crassostrea gigas et de la
moule (Mytilus galloprovincialis).
 1940 : début de l’exploitation des mollusques Mytilus galloprovincialis, Crassostrea
gigas, Ruditapes decussatus et Céraste dermaglacicum au niveau du Lac El Mellah
(El-Kala, Ouest d’Alger).
 1973 : mise en valeur du lac El Mellah par des essais d’élevage de moules,
d’huitres, d’exploitation de coques et de palourdes et implantation de tables
conchylicoles.
 1987 : mise en place de la première filière de Sub Surface, à titre expérimental pour
la production de moule Mytilus galloprovencialis au niveau de la baie d’Alger.




1991 : naissance de la mytiliculture en eau profonde à Ain Taya (w. Alger) et mise
en place de soucoupes ballastables à titre expérimentale.
1992 : mortalité massive des bivalves mis en élevage au lac El-Mellah pour diverses
raisons (modifications physicochimiques du milieu, Maladies…)
2001 : Naissance de l’ostréiculture en mer ouverte à Ain Taya (W. Alger) [2].
2013 : Création d’un Centre Pilote à Bou Ismail (W. Tipaza), pour le développement
de la filière Conchylicole
Quelques entraves au développement de la filière conchylicole [3]
 Absence d’écloseries de mollusques bivalves destinées à alimenter des fermes
conchylicoles en naissain
 Absence d’installations d’accompagnement (stations d’épurations et d’expédition)
 Concurrence avec d’autres activités pour l’obtention d’une concession : Tourisme,
Agriculture
 Absence de structures de démonstration et de vulgarisation de l'activité conchylicole
 Manque de connaissances techniques pour l’élevage des bivalves et le captage de
naissain
 Absence d’un dispositif d’encadrement technique et de soutien aux professionnels
 Non identification des gisements naturels exploitables
 De par le passé, la non classification des zones d’élevage conchylicole
 Contraintes institutionnelles
Situation actuelle
Espèces élevées
Deux espèces de bivalves sont produites : la moule Mytilus galloprovincialis et l’huître
creuse Crassostrea gigas
Structure d’élevage
En Algérie, la conchyliculture est actuellement pratiquée en eau profonde, en filières de sub
surface de 200m de long, immergées à – 5 m de profondeur.
Sites de production
Deux fermes sont actuellement en phase de production:
 Orca marine est une entreprise conchylicole privée située à Ain chrob dans la wilaya
d’Alger, productive depuis 1991.
 SEAM (Sarl d’Elevage Aquacole Méditerranéen) est une entreprise conchylicole
privée située à Ain Tagourait dans la baie de Bou Ismail, productive depuis 2010
(figure 1).
Figure 1 : Localisation géographique des sites de production
Production
Depuis 2011, la conchyliculture est limitée à la mytiliculture, les producteurs ayant été
confronté au problème d’approvisionnement en naissains. La production mytilicole est
faible et reste inférieure à 45 tonnes/an. Quant à la production d’huitres, elle est
insignifiante, elle ne dépasse pas les 374 kg/an « figure 2 ». Le produit conchylicole est
destiné au marché intérieur. Le Tri, le calibrage, le conditionnement et la commercialisation
sont assurés par les fermes.
Figure 2 : Production conchylicole (tonnes/an) de 2000 à 2011
Environnement conchylicole
Sur le plan microbiologique, les eaux des sites conchylicoles, actuellement en production
(Ain Tagourait et Ain chrob) sont de bonne qualité à acceptables [4]. De même, l’aspect
physico chimique et biologique semble favorable pour une croissance positive des bivalves
mis en culture [5]. Néanmoins, 14 espèces d’algues toxiques et 18 génératrices
d’effluorescence ont été identifiées dans la baie de Bou Ismail [6] ce qui implique un suivi
rigoureux et régulier des sites d’élevage.
Performance de croissance
Un suivi expérimental d’un élevage d’huitre creuse placé à Ain Tagourait de 2011 à 2013,
révèle des performances de croissances intéressantes aussi bien en taille (+ 41,65 mm), en
poids (+ 32,1 g) qu’en qualité [5].
Perspectives : Projets et production
Selon le schéma directeur de développement des activités de la pêche et de l’aquaculture
[7], à l’horizon 2025, il est envisagé la mise en place de :
 76 projets d’élevage de Moules Mytilus galloprovincialis et d’huître creuse
Crassostrea gigas répartis le long du littoral algérien. L’élevage se fera en eau
profonde en filière de sub surface sur toute la façade maritime « figure 3 ».
 12 structures d’appui à la production dont cinq centres de traitement de mollusques,
trois écloseries, trois unités de fabrication de matériel et un centre conchylicole de
vulgarisation et d’apprentissage pratique.
 Une production de 7.600 tonnes/an de moules et d’huitres soit 14,3 % de la
production aquacole globale, pour un chiffre d’affaire estimé à 2280 millions de DA.
 En termes d’investissement, les projets prévus sont évalués à 1834,45 millions de DA
dont 75 % intéresse le secteur privé.
Figure 3 : Répartition géographique des projets conchylicoles ( ) avec structures d’appui à la
production ( )
CONCLUSION
L’Algérie présente des potentialités conchylicoles réelles. De nombreux atouts pour le
développement de la conchyliculture existent tels : un environnement favorable à la
croissance et à la production; des sites appropriés pour l’élevage aussi bien en mer ouverte
qu’en lagunes et diverses espèces susceptibles à la culture. Le lac El Mellah offre des
possibilités pour la réintroduction et l’élevage des espèces produites par le passé à savoir la
palourde, la coque, la moule et l’huitre.
REFERENCES
[1] FAO, Département des pêches et de l’aquaculture, (2012).
[2, 3, 7] Ministère de la Pêche et des Ressources Halieutiques. Schéma Directeur de Développement des
Activités de la Pêche et de l’Aquaculture, Horizon 2025 (2008)
[4] S. Alouache, M. Kada, Y.Messai, V. Estepa, C. Torres, R. Bakour : Antibiotic Resistance and ExtendedSpectrum β-Lactamases in Isolated, Bacteria from Seawater of Algiers Beaches (Algeria) Microbes
Environ. Vol. 27, No. 1, 80–86 (2012)
[5] N. Meslem-Haoui, N. Bourehael, D. Bouslimane, C. Rebzani : Elevage de l’huitre creuse, Crassostrea
gigas (thunberc), en Algerie. Bull. Soc. Zool. Fr., 2013, 138 (2013)
[6] H. Illoul, M. Mazo, J Fortuno, L. Cros, R. Seridji : Potentially harmfull microalgae in Coastal waters of
the Algiers area (Southern Mediterranean Sea). Cryptogamie, Algol, 29 (3) : 261-278 (2008).
Etude Socio-Economique pour la Mise en Place d’une Aire Marine Protégée au Cap de
Garde à Annaba, Nord-Est Algérien
Etude socio-économique pour la mise en place d’une Aire Marine
Protégée au Cap de garde à Annaba, Nord - Est Algérien
Seridi A., Boubekri I. et Djebar A. B.
Laboratoire d’Ecobiologie des Milieux Marins et Littoraux «EMMAL», Département des Sciences de la Mer,
Faculté des Sciences, Université Badji Mokhtar-Annaba- Algérie. www.univ-annaba.dz.
RESUME
La mer Méditerranée, héritage naturel et culturel, est une zone riche en biodiversité et aux caractéristiques
uniques qui au cours du siècle dernier, a connu l’augmentation de l’impact anthropique dans des proportions
extrêmes: la surpêche persiste, l’habitat côtier se détériore et la perte de la biodiversité s’accélère. Face à ces
constats, la plupart des pays méditerranéens dont l’Algérie, se sont engagés dans le cadre de la Convention
de Barcelone et de son Protocole ASP/DB, a contribué à un objectif visant la protection d'ici 2020, d’au
moins 10% des zones côtières et marines, avec des systèmes nationaux et régionaux d'Aires Marines
Protégées(AMP), complets, bien gérés et écologiquement représentatifs. C’est dans cette dynamique de
préservation, de protection et de conservation de la diversité biologique que se situe notre travail. Nous nous
sommes fixés pour objectif l’établissement d’un projet de mise en place d’une AMP dans la région Ouest du
golf d’Annaba «Cap de garde», qui sera un espace non seulement pour l’équilibre de l’avifaune mais aussi,
de la diversité biologique marine dans la région Est Algérienne. Dans cette étude nous présentons les
résultats préliminaires obtenus au cours de notre enquête socio-économique réalisée à partir de 800
questionnaires. Pendant 15 mois, entre mars 2013 et juin 2014, cette étape primaire dans la mise en place
d’une AMP a nécessité l’exploitation de 5 sources d’information: bibliographie, auprès des usagers, des
entretiens semi-ouverts et en groupe d’usagers et des questionnaires. Ainsi, l’analyse des données issues de
l’enquête atteste de l’intérêt que porte les usagers à ce milieu et dans cet élan nous sommes passés à la
deuxième étape de notre projet d’étude qui consiste à étudier, inventorier et caractériser les oiseaux marins,
la végétation côtière et la biodiversité sous marine. Afin de pouvoir mettre en place un plan de zonage
adéquat, afin de donner une définition territoriale a notre projet d’étude et ceci sous la forme d’une
cartographie SIG.
Mot-clés: AMP, Enquête socio-économique, biodiversité, méditerranée, Annaba, Algérie.
INTRODUCTION
La gestion des ressources et des habitats marins de la planète entre dans une nouvelle phase.
Un des principaux aboutissements du sommet mondial pour le développement durable de
2002 a été l’engagement portant sur la création de zones marines protégées conformes au
droit international. Cet engagement a permis de convertir en impératif politique un des
objectifs à long terme de la Commission Mondiale des Aires Protégées (CMAP) de l’UICN
a Montréal en 1996, dans le cadre de son programme pour la surveillance du milieu marin.
Sachant que Le défi n’est plus désormais d’établir un système représentatif d’AMP mais
qu’elles soient gérées efficacement à long terme. Sachant que seulement 1,17 % des océans
de la planète sont déclarés aires marines protégées et que moins de 10 % des aires marines
protégées actuelles atteignent leurs buts en matière de gestion [1]. Sachant que, les AMP ne
peuvent servir les objectifs fondamentaux et ambitieux de conservation de la biodiversité,
d’utilisation durable des ressources marines et de meilleure qualité de vie pour les
communautés côtières que si elles sont gérées de façon efficace. Les AMP répondent à des
buts distincts, dont la protection des espèces et des habitats marins, la conservation de la
biodiversité marine, la restauration des stocks de pêche, la gestion des activités touristiques
et la limitation des conflits entre les différents utilisateurs des ressources. L’AMP est
considérée comme un système de gestion capable de régler les dysfonctionnements
observés entre les différents systèmes écologiques, sociaux, et économiques dans les
espaces marins et côtiers. Souvent, ces systèmes ne fonctionnent pas en harmonie [2]. Le
système écologique est affecté par le système socioéconomique via les pressions
anthropiques et la pollution générées par les communautés locales et les acteurs qui
interviennent dans le milieu [3].
En Méditerranée, comme au niveau mondial [4], le type de protection appliqué dans les
AMPs est très varié et reflète les différences culturelles et politiques qui existent entre les
pays. La majorité d’entre elles a été classée en aires marines à usages multiples recherchent
un équilibre entre la protection de la biodiversité et la préservation des usages [5],[6],[7].
Historiquement, le classement des espaces a été principalement motivé par la présence
d’espèces emblématiques et des caractéristiques ou d’opportunités uniques plutôt que par
une approche écologique globale [7],[8]. La création d’un réseau d’aires protégées
interconnectées constitue une étape allant au-delà de l’approche traditionnelle de
planification des AMP comme entités uniques indépendantes. La création d’un réseau
écologique d’AMP efficace est la base fondamentale des stratégies qui ont pour but de
protéger la biodiversité d’une écorégion toute entière et d’offrir les services de l’écosystème
aux populations qui y vivent [9],[10].
Désormais On sait par expérience que les facteurs sociaux, culturels, économiques et
politiques, plus que les facteurs biologiques ou physiques, influencent le développement, la
gestion et les performances des AMP et ont comme conséquences l’échec de cette dernière
[11]. Dans certains cas, le manque de transparence aussi lors de l’établissement, peut
perturber la réussite d’une AMP en rendant les autorités publiques incapables de convaincre
les acteurs locaux pour en accepter et respecter son plan de gestion. Les acteurs voient alors
l’AMP comme un moyen de contrôle entravant leurs activités [12].
En conséquence, La réussite de la gouvernance des AMP est dépendante de 2 défis
principaux. Le 1er est la réussite de la politique de conservation des écosystèmes et la
protection de la biodiversité[13], le 2d défi est celui de résoudre des conflits d’intérêts
intersectoriels et intra-sectoriels entre les acteurs impliqués et l’assainissement des
perturbations affectant négativement l’état environnemental du milieu marin et côtier générées par les usagers et la population locale [14]. Il est donc indispensable de
comprendre le contexte socioéconomique des parties prenantes impliquées et/ou influencées
par la mise en place d’une AMP dans leur région (individus, ménages, groupes,
communautés, organisations) afin d’évaluer, prévoir et gérer l’AMP.
En Algérie, un plan d’action national pour la mise en place d’aires marines et côtières
protégées en Algérie qui a été élaboré en 2002 et qui avait ciblé 12 AMP le long de la côte
algérienne avec des objectifs à court, moyen et long terme, notamment à l’horizon 2015
[15]. Alors, qu’aujourd’hui l’Algérie ne compte légalement qu’une seule aire marine
protégée, en l’occurrence la réserve naturelle marine protégée des iles Habibas (classée par
le décret n° 03-147 du 28 mars 2003). En plus des AMP en cours de préparation,
notamment l’extension de la zone de protection terrestre des parcs nationaux d’El Kala
(wilaya d’El Tarf), de Taza (wilaya de Jijel) et de Gouraya (wilaya de Béjaia) à la zone
marine de ces parcs nationaux [16].
Le retard dans la mise en œuvre du plan d’action dans les délais planifiés en 2002 est lié à
diverses raisons, dont les plus importantes sont ; l’absence d’un cadre juridique approprié,
mais cette question a été partiellement réglée par la promulgation le 17 février 2011 de la
loi sur les aires protégées dans le cadre du développement durable. Le manque de
sensibilisation et le faible niveau de prise de conscience des acteurs par rapports aux enjeux
de la mise en place des AMP ont été et demeurent des facteurs qui ralentissent la mise en
place effective de ces AMP. Le déficit en expertise nationale et la non mise en place de la
Commission Nationale des aires protégées constituent, en outre, les autres facteurs de ce
retard [17].
Ainsi, dans se présent travail nous avons accordé une attention particulière à la prise en
compte explicite de la dimension socioéconomique dans le projet de protection de la région
« Cap de Garde » wilaya de Annaba. En effet, la définition du cadre général de la relation
entre préservation du milieu marin et le développement socioéconomique est au cœur de la
problématique de notre projet d’étude.
Présentation générale de la zone d’étude
Situation géographique et administrative
Le projet de création d’une AMP dans la région d’Annaba Nord Est Algérien (Fig. 1) se
situe du «Cap de Garde au promontoire du Pain de Sucre». Cette zone localisée au nord est
de l’Algérie à l’ouest du golf d’Annaba, dans la métropole littorale du même nom, à
environs 8 km d’Annaba. Sur le plan administratif, elle fait partie de la daïra d’Annaba,
commune de seraidi (Fig.1).
Figure 1 : Carte de localisation du projet de la réserve marine du cap de garde. A l’échelle 1/100 000
Délimitation
et argumentaire du choix de la zone d’emprise du projet d’AMP.
N
La zone d’étude couvre une superficie de 3800 ha avec un linéaire côtier de 9,5 km, elle est
limitée par la Méditerranée au Nord, bordée au sud par la réserve naturelle de l’Edough,
dont 480 ha de terre sont protégés [18]. La zone d’emprise du projet a été délimitée par
rapport aux enjeux de la zone côtière. En termes biologiques et écologiques, elle est
typiquement méditerranéenne et présente un bon état de conservation. Il convient de
souligner l’importance de cette aire en raison de son rôle potentiel en termes d’éducation et
de recherche environnementales et de sa facilité d’accès pour les nombreux visiteurs de la
ville d’Annaba et sa région. Elle présente également une valeur esthétique et revêt un intérêt
symbolique pour une ville fortement industrialisée qui souffre d’importants problèmes
environnementaux. A cela on ajoute, les menaces existantes liées à la pêche de loisir non
contrôlée et au nombre croissant de touristes fréquentant la région [19].
METHODOLOGIE
Récolte des données
Pour la mise en place d’une évaluation socio-économique, considérée comme l’étape clé de
mise en place de notre projet de classement de l’aire marine au cap de garde -Annaba,
Plusieurs sources d’information ont été prises en compte dans le cadre de l’étude:
- sources d’information secondaires, c’est à dire la bibliographie que constituent les
ouvrages, rapports, les sites internet…
- sources d’information primaires, c’est à dire la collecte des données directement auprès
des usagers par trois moyens :
 Des entretiens semi-ouverts, c’est à dire une discussion libre avec la personne, mais
où l’enquêteur a quand même des objectifs dans son guide d’entretien,
 Des entretiens en groupe d’usagers, c’est à dire des réunions avec un petit nombre
de personnes ayant un intérêt commun, par exemple la pêche,
 Des enquêtes fermées ou questionnaires, dans lesquels les questions sont
essentiellement des questions fermées, plus facile à analyser. Un questionnaire
commun à tous les usagers, qui aborde uniquement des généralités, a été élaboré.
 En complément, lors des entretiens, des questions spécifiques par type d’usager ont
été posées.
Dimension temporelle et déroulement des questionnaires
L’enquête a eu lieu de Mars 2013 jusqu’à juin 2014 période caractérisée par de nombreuses
interruptions, compte tenu des spécificités de l’activité de pêche et des difficultés
rencontrées dans la réalisation des enquêtes. On a pris on compte un échantillon
représentatif de la population étudiée durant notre travail. Globalement nous avons essayé
de collecter le maximum d’informations aussi bien pour les points économique et sociaux
dans un but de création d’une AMP au cap de garde.
RESULTATS
Indicateurs sociodémographiques
Administrativement la Wilaya d’Annaba est organisée en 12 Communes et 6 Daïras, on
remarque que les trois communes ou se situe notre zone d’étude (Annaba, Chétaibi,
Séraidi) occupent 21% de la superficie totale de la willaya, avec la plus forte densité de
population qui est de 401.484 représentant 63% de la population totale [20].
Infrastructures économiques
L’ouverture de l’économie nationale sur le marché mondial offre aujourd’hui à la région des
opportunités d’investissements réels, compte tenu de sa position géographique et des utilités
nécessaires dont elle dispose:
 Un port de dimension internationale modernisé s’étalant sur une superficie de
95 ha et doté d’un terminal à containers d’une capacité de 1712 unités,
 Un aéroport international,
 Un Réseau d’énergie assez développé avec plusieurs infrastructures à impact
régional,
 Des infrastructures routières et ferroviaires importantes,
 Une université et un pôle technologique important avec un large éventail de
spécialités réparties en 7 facultés et plus de 40 000 étudiants.

Un réseau de formation professionnelle diversifié composé de 03 instituts, 09
centres, 06 annexes et 13 écoles agréées, d’une capacité totale d’accueil de
 6850 places pédagogiques.
 Un tissu industriel très riche composé principalement de complexes intégrés et
autres unités de production de tailles telles que le complexe sidérurgique d’El
Hadjar, le complexe d’engrais phosphatés et azotés ASMIDAL, FEROVIAL,
PROMECH, ENGI, BATICIC, TRIFILLEST, COPRAC... et qui recèlent des
capacités de sous-traitance multiformes.
 Agriculture, forêts et pêche avec des ports spécialisés: Annaba et Chétaïbi.
 Une petite et moyenne entreprise (PME / PMI) très dynamique, d’activités
diverses, à prédominance agro-alimentaire :
 Minoterie – semoulerie, fabriques de pâtes alimentaires, conserveries de
tomates, ainsi que d’autres créneaux tels que la transformation du papier,
plastique et verre.
On remarque que les secteurs qui ont une richesse très importante en nombre de travailleurs
sont les secteurs de commerce, agriculture, pêche, BTP et travaux publique et on trouve le
dernier en tête de liste [20].
Le tourisme
En ce qui concerne le secteur du tourisme, malgré que la wilaya d’Annaba possède un
écosystème très favorable par sa richesse et sa diversité bioclimatique. Avec un littoral
encore vierge et parsemé de belles petites plages ceinturées d’anses rocheuses, qui
cohabitent harmonieusement avec des espaces forestiers véritable Havre de paix ; ce secteur
reste peut développer, avec une capacité hôtelière de seulement environ 4000 lits malgré
des potentialités attrayantes. Des sites tels que la baie ouest de Chétaïbi, Oued Bagrat et la
corniche d’Annaba, avec 36 hôtels nom classées et 5 hôtel classées et un nombre d’emploie
de 1755 dans l’hôtellerie et la restauration [21].
La pêche
Lorsqu’on parle de pêche au niveau de la wilaya de Annaba les communes ou l’activité est
la plus développée sont les communes de Annaba et chétaibi, qui disposent d’un
environnement maritime d’une superficie de 8 089 km 2, d’un linéaire côtier d’une longueur
de 80 Km, est favorable aussi au développement et la promotion du secteur. Les différents
projets lancés dans le cadre du soutien de l’État, l’Angem, l’Ansej et particulièrement le
programme de soutien à la relance économique (PSCE) ont permis au secteur de se
développer [22](tab.1).
Tableau 1 : Le développement du secteur de la pêche en 2013 [23]
Année
Collectif marin
Inscrits
2013 définitifs
1859
Les flottilles de pêches
Inscrits
Sardiniers
provisoires
2449
133
chalutiers
46
Petits
métiers
363
Production halieutique (tonnes)
Poisson Poisson crustacés mollusque
blanc
bleu
2232.65 6088.9
210
54.6
La communauté des pêcheurs, l’AMP et le processus décisionnel à l’échelon de la
communauté locale
La création d’une AMP, en tant qu’instrument d’aménagement durable, doit tenir compte
des aspirations des principaux usagers, en l’occurrence la communauté des pêcheurs, en les
associant à la conception et à la création du projet. Nous nous proposons de présenter les
résultats de l’enquête socio-économique sur les pêcheurs.
Les principaux indicateurs socio-économiques qui en découlent sont utiles à la prise de
décision concernant la création et la gestion de l’AMP.
Evaluation du stock de poisson durant la dernière décennie.
Selon la communauté des gens de la mer interrogée lors de notre enquête sur le terrain, ces
derniers notent une raréfaction de la ressource matérialisée par la diminution des captures.
En effet, 88% des gens de mer affirment la baisse des stocks de poissons. La surexploitation
n’est pas la principale raison de la raréfaction, il s’agit plutôt de l’effet synergique de
plusieurs paramètres nous citerons principalement :
 La surfréquentation de certains sites qui fait que le niveau des captures diminue.
 La pollution, telle qu’elle est comprise par les pêcheurs est la principale cause de
raréfaction de la ressource.
 Il existe un antagonisme d’usage entre les petits métiers et les chalutiers. Les
chalutiers infligent des dommages à l’écosystème et génèrent des effets
d’externalités négatives pour les petits métiers.
 Le non-respect de la réglementation et l’impunité sont les principaux motifs qui
encouragent des actions illicites et dévastatrices.
D’après cette même catégorie de personnes enquêtées, la gestion de la pêche et
l’intervention publique sont devenues une urgence cette situation pour faire face. La
réglementation de l’accès à la ressource et l’organisation de l’activité de pêche sont
commandées. Ainsi, dans ces conditions, la création d’une aire marine protégée représente
une solution techniquement viable et réalisable et socialement acceptable.
L’activité de pêche à l’heure actuelle.
A l’heure actuelle, 72% des pécheurs pensent que le stock de poissons est en dessous de
leurs attentes, 20% l’estime acceptable en fonction des saisons et enfin seuls 8% le trouvent
satisfaisant (fig. 1).
Figure 1: Etat de satisfaction des pécheurs du stock de poissons prélevé à l’heure actuelle
Avis des pêcheurs sur la création de l’AMP
Plus de 65%des pêcheurs considèrent que les limitations choisies pour la création de
l’AMP sont bien situées: c’est le lieu où elles gênent le moins. Le fond marin dans cette
zone est rocheux, donc la pêche est très risquée. Quand on se rend dans ces zones, on n’est
jamais sûr de revenir avec nos filets intacts, déclare un pêcheur. Donc les pécheurs du golfe
d’Annaba sont pour la mise en place d’une aire marine protégée dans le secteur pré
sélectionné Cap de garde. Un pourcentage de 76.19% pour les utilisateurs de sardiniers,
75% pour les chalutiers et 57.14% pour les petits métiers acceptent ce choix et le justifient
par les grandes richesses biologiques de cette zone.
La gestion de l’AMP
La plupart des pêcheurs estiment que les garde-côtes sont les seuls capables de gérer
l’AMP. Bien que l’on observe une confusion entre la gestion et la surveillance. En effet, 74
% des pêcheurs préfèrent que l’AMP soit gérée exclusivement par les garde-côtes et 14 %
proposent un groupe scientifique qui travaille avec tous les gens de la mer et les institutions
ayant une relation directe avec les activités marines et maritimes (fig.2). Seulement 12%
des pécheurs estiment qu’une administration ne peut pas prendre la responsabilité de la
gestion de l’AMP, ce qui témoigne de la fragilité des liens entre l’administration de la
pêche et les pêcheurs (fig. 2).
Figure 2: Représentation des taux de propositions de type de gestion de l’AMP
CONCLUSION
Les AMP sont communément reconnues comme des outils de gestion durable du milieu
marin, principalement destinés à la conservation de la biodiversité. L’évaluation de leur
efficacité et de leur performance constitue, aujourd’hui, un champ de recherche en pleine
expansion qui répond à une demande locale des gestionnaires, comme à une nécessité plus
globale de rapportage (reporting) auprès des décideurs et bailleurs de fonds. Jusqu’ici, la
plupart des recherches utilisent un angle d’analyse strictement biologique, laissant de côté
l’étude des impacts socio-économiques. Pourtant, la réussite des AMP repose sur 3 piliers
d’importance égale: la durabilité écologique, la faisabilité économique et l’acceptation
sociale [24]. Ainsi, ce travail s’intéresse aux impacts socio-économiques des AMP et à la
nécessité d’imaginer des outils pertinents permettant aux gestionnaires d’évaluer et de
suivre l’acceptation sociale. Sachant que les aires marines protégées sont en mesure de
jouer un rôle non négligeable dans l’amélioration du bien-être collectif des populations
locales et des principaux usagers [25].
REFERENCES
[1] Kelleher G, Bleakley C,Wells S, eds. 1995. A Global Representative System of Marine Protected Areas,
vols. 2–4.Washington (DC): Great Barrier Reef Marine Park Authority, World Bank, IUCN (World
Conservation Union).
[2] Jentoft S., chuenpadge R., 2009, “Governability assessment for fisheries and coastal systems: a reality
cheek”, human ecology, 37, pp. 109-120.
[3] Jentoft S., 2006, “limits of governability institutional implications for fisheries and coastal governance”,
marine policy, 31, pp. 360-370.
[4] Wood A M., Maltby J., Gillett R., Linley P A., Joseph S, 2008, “The role of gratitude in the
development of social support, stress, and depression: Two longitudinal studies”, Journal of Research
in Personality, 42, pp. 854-871.
[5] Harmelin J.G., 1999. Visual assessment of indicator fish species in Mediterranean marine protected areas.
Naturalista sicil.
[6] Badalamenti F., Ramos A. A., Voultsiadou E., Sanchez-Lizaso J. L., D’Anna G., Pipitone C., Mas J.,
Ruiz-Fernandez J. A., Whitmarsh D. and Riggio S. (2000). “ Cultural and socio-economic impacts of
Mediterranean marine protected area”. Environmental Conservation, 27 (2): 110-125.
[7] Francour P., Harmelin J-G., Pollard D and Sartoretto S. (2001). “A review of marine protected areas in the
northwestern Mediterranean region: siting, usage, zonation and management”. aquatic conservation:
marine and freshwater ecosystems, 11: 155–188.
[8] Fraschetti S., Terlizzi A., Benedetti-Cecchi L. (2005). “Patterns of distribution of marine assemblages
from rocky shores: evidence of relevant scales of variation”. Marine Ecology Progress Series,
296 :13-29.
[9] Airame S., Dugan J E., Lafferty K D., Leslie H., McArdle D A., Warner R R. (2003). “Applying
ecological criteria to marine reserve design: A case study from the California Channel Islands”.
Ecological Applications, 13(1), pp, S170-184.
[10] Meir E., Andelman S., Possingham H P. (2004). “Does conservation planning matter in a dynamic and
uncertain world?” Ecology Letters, 246 : 23-35.
[11] Mascia M B., Claus C A., and Naidoo R. (2010). “Impacts of marine protected areas on fishing
communities”. Conservation Biology, 24 :5, pp, 1424-1429.
[12] Stevenson T C., Tissot B N., Walsh W J. (2013). “Socioeconomic consequences of fishing displacement
from marine protected areas in Hawaii”. Biological Conservation, 160: 50-58.
[13] West P., Igoe J., Brockington D. (2006). “Parks and peoples: the social impact of protected areas”.
Annual review of Anthropology. 35, 251–277.
[14] Mascia M. (2001). “Social dimensions of marine reserves”. Marine Reserves: A Guide to Science,
Design, and Use, ed. J. Sobel & C. Dahlgren. Washington, DC, USA: Island Press.
[15] Hadj-jilani A. (2013). « Aires marines et côtières protégées : où en est l’Algérie ? ». Aquarev. 172 : 1013.
[16] Grimes S. (2013). « Aires marines et côtières protégées : où en est l’Algérie ? ». Aquarev. 172 :14-16.
[17] Grimes S, 2007. Etude de classement de l’aire marine du Parc National de Taza (Wilaya de Jijel).
(Rapport de synthèse).
[18] Grimes S, 2012. Stratégie nationale de gestion intégrée des zones côtières en Algérie. Rapport n°01 :
pèche, biodiversité marine et conservation des habitats côtiers remarquables.
[19] Programme des nations unies pour l’environnement/ plan d’action pour la méditerranée. (Grèce, 2005).
« Propositions pour inscription sur la liste des ASPIM ». WG.270/15.
[20] Rapport de synthèse sur les activités sociales de la wilaya d’Annaba-Algérie, (monographie, 2013).
Rubrique «population et emploi».
[21] Rapport de synthèse sur les activités économiques de la wilaya d’Annaba-Algérie, (monographie, 2013).
Rubrique « activités touristiques ».
[22] Rapport de synthèse sur les activités économiques de la wilaya d’Annaba-Algérie, (monographie, 2013).
Rubrique «foret, pêche et agriculture».
[23] statistiques de la direction de la pêche et des ressources halieutiques, (2013).
[24] Costanza R., D’arge R., DE Groot R., Farber S., Grasso M., Hannon B., Limburg K., Naeem S., O’neill,
R.V.O., Paruelo J., Raskin R.G., Sutton P., Van Den Belt M. (1997).“The value of the world’s
ecosystem service and natural capital”. Nature, 387: 253-260. (Classé dans evaleco/exemples autres
que coraux/costanza).
[25] Chakour S.C, 2007, «Sustainable Development of Fisheries in Algeria: The Necessity of a participative
and multidisciplinary Approach”. Océanis. 33-3/4.
Elasmobranchs Bycatch in Trawl Fisheries in the Gulf of Gabès
(Southern Tunisia, Eastern Mediterranean)
Elasmobranchs bycatch in trawl fisheries in the Gulf of Gabès
Enajjar Samira1, Saidi Bechir1, Saadaoui Abdesselem 1, Mohamed Nejmeddine Bradaï 1
1
National Institute of Science and Technology of the Sea (Sfax, Tunisie) BP. 1035-3018.
[email protected]; [email protected]; [email protected];
[email protected];
SUMMARY
According to recent study of the fish fauna in Tunisia, 63 elasmobranchs occurs in Tunisian waters. 25 sharks
and 21 rays are recorded in the Gulf of Gabès. More than 2000 tones are landed every year. 70% of national
production of cartilaginous fish is caught in the Gulf of Gabès. This region appears to be a nursery for many
species. Elasmobranchs are captured mainly by the bottom trawl, gillnets and longlines. 6 sharks and 8 rays
are landed throughout the year and have an economic value. Several other species listed as endangered
species in the IUCN list are captured as by catch in the Gulf of Gabès.
The impact of trawling on common elasmobranchs (Carcharhinus plumbeus, Rhinobatos cemiculus,
Rhinobatos Rhinobatos, Isurus oxyrinchus and Dasyatis pastinaca) was studied by analyzing fish landings in
the port of Sfax from 2004 to 2010. The analysis shows that all sizes are captured: neᴡ born, immature,
maturing and matures. Immature dominate captures; frequency of juveniles can reach sometimes 100% some
species. The biological characteristics of this group of fish: late sexual maturity, low fecundity and long
sexual cycles…added to the fisheries impact could prejudice stocks.
Keys words: Elasmobranchs, bycatch, trawl, Gulf of Gabès.
INTRODUCTION
Cartilaginous fish are declining in abundance and diversity all over the world. This
diminution is due to the intense fishing activity and to their vulnerable biological
characteristics (low fecundity, late maturity and slow growth rates). The reduction concerns
essentially large predatory sharks. This loss of top predators could hold serious implications
for the maritime ecosystem 9. In Tunisian coast, elasmobranchs are known by their
diversity, in fact, 63 species were recorded 2.
The Gulf of Gabès area is known to be
an important habitat and is through to encompass breeding ground for many species such as
Carcharhinus plumbeus, Carcharodon carcharias, Raja clavata 1, 3. They constitute an
important bycatch of commercial fisheries targeting bony fishes and shrimps, rare are
fisheries targeting sharks and rays. In Tunisia, elasmobranchs are landed mainly by the
bottom trawl, gillnets and longlines as bycatch. A specific fishery targeting sharks and rays
using a specific gillnet locally named “Garracia” and “Gattatia” still exists in the Gulf of
Gabès (Southern Tunisia) during spring and summer. The sandbar shark, the smouth-hound
and the blackchin guitarfish are among species landed throughout this specific campaign.
This study is attempted to show the impact of trawling on five common elasmobranchs
from the Gulf of Gabès (Southern Tunisia): Carcharhinus plumbeus, Rhinobatos cemiculus,
Rhinobatos Rhinobatos, Isurus oxyrinchus and Dasyatis pastinaca.
This work is based on observation on trawl landing in the port of Sfax which sheltered the
largest trawlers fleet in Tunisia (Figure 1). A shrimp trawl type is widely used in the Gulf of
Gabès. It target shrimps, cephalopod and some finfish as Mullus surmeletus, Pagellus
erythrinus… This gear landed important quantity of elasmobranchs as by catch.
A total of 3750 sharks and rays were collected between 2004 and 2010 from commercial
bottom trawlers. Sampling included species, sex determination, measurement (total length
or disc width and clasper length for males). Several specimens were dissected to examine
the genital tract for maturity stage.
Gabès Gulf
Figure 1: Geographical position of the Gulf of Gabès (southern Tunisia, central Mediterranean Sea)
Five species are selected for this studies: Isurus oxyrinchus considered as critically
endangered (CR), Carcharhinus plumbeus, Rhinobatos cemiculus and Rhinobatos
rhinobatos as endangered (EN) and Dasyatis pastinaca as near threatened species (NT) in
the Mediterranean Sea 4 (Table 1). The determination of maturity stage (Neᴡ born,
juveniles and adults) of specimens was based on bibliographic related to the study area 7,
8, 10.
Table 1: Elasmobranches examined from the Gulf of Gabès
Species
Females
Males
Total
C. plumbeus
178
162
340
R. cemiculus
R. rhinobatos
370
1225
354
1119
724
2344
D. pastinaca
176
151
327
I. oxyrhincus
8
7
15
25 sharks and 21 rays are recorded in the landing of trawl in the studies area (Table 2) from
which two are recorded only one time: Carcharhinus limbatus, C. obscures. 6 sharks and 8
rays are landed around the year and have an economic value (Mustelus mustelus, M.
punctulatus, Carcharhinus plumbeus, Squalus megalops, S. blainvillei, Scyliorhinus
canicula, Rhinobatos rhinobatos, R. cemiculus, Dasyatis pastinaca, Dasyatis sp.,
Pteromelaeus bovinus, Teanuira grabata, Torpedo torpedo and Raja clavata).
Table 2: Shark and rays recorded in the port of Sfax (Southern Tunisia)
cc: very common; c: common; r: rare ; rr: very rare
Sharks
Heptranchias perlo
r
Hexanchus griseus
Squalus blainvellei
Rays
Gymnura
altavella
cc Raja clavata
rr Raja radula
Raja
r
miraletus
Leucoraja
c
melitensis
Rostroraja
r
alba
rr Raja asterias
Dipturus
cc
oxyrinchus
rr
Dasyatis pastinaca
r Isurus oxyrhinchus
cc Squatina aculeata
c
rr
Dasyatis sp.
Squalus megalops
cc Squatina oculata
rr
Dasyatis marmorata
Scyliorhinus canicula
cc Squatina squatina
r
Taeniura grabata
Scyliorhinus stelaris
r
Oxynotus centrina
r
Peroplatytrygon violacea
Mustelus asterias
r
Galeorhinus galeus
rr
Myliobatis aquila
Mustelus mustelus
cc Prionace glauca
rr
Pteromylaeus bovinus
Mustelus punctulatus
cc
rr
Mobula mobular
r
Carcharhinus plumbeus
cc Carcharhinus limbatus
rr
Torpedo marmorata
cc
Carcharhinus brevipinna
c
Carcharhinus obscurus
rr
Torpedo torpedo
cc
Carcharodon carcharias
r
Centraphorus granulosus
rr
Rhinobatos rhinobatos
cc
Cetorhinus maximus
rr
Rhinobatos cemiculus
cc
Alopias vulpinus
Carcharhinus melanopterus
Dasyatis centroura
cc
c
cc
c
c
c
c
rr
c
The common guitarfish R. rhinobatos was landed a round the year by trawl in the port of
Sfax essentially during shrimps campaign. Size of fish examined varied between 31.5 and
115 cm TL. The most common sizes in the landing fish measured vary between 650 and
900 mm TL (Figure 2). 58.7% of the specimens sampled were mature. The size at first
sexual maturity in the area is respectively 70 and 80 cm TL for males and females 7.
Only 22.1% of the blackshin guitarfish R. cemiculus, sampled is mature. Sizes landed
fluctuated between 40.5 and 205 cm TL. The mean size observed in the port of Sfax is
955.36 cm TL and the most size landed varied between 60 and 100 cm TL (Figure 2). The
sexual maturity is reached at 111 and 138 cm TL respectively for males and females 8.
The sandbar shark Carcharhinus plumbeus, is the most commonly landed carcharhinids in
the Gulf of Gabès. No more than 1.2 % of specimens catches by trawl during this study are
mature. The most size landed in the port of Sfax vary between 65 and 85 cm TL (Figure 2).
The sexual maturity is reached at 160 and 172 cm TL respectively for males and females
10.
Sizes of the common stingray D. pastinaca observed in the gulf of Gabès vary between 14.2
and 70 cm DW respectively for males and females. The most frequent size observed during
this study varies between 32 and 42 cm DW. Therefore, 64% of the total samples examined
are matured (Figure 2). The sizes at sexual maturity are respectively 32 and 42 cm DW 6.
The shortfin mako shark Isurus oxyrinchus is an epipelagic species. It is rarely landed by
trawl. Only 15 specimens were recorded in the Gulf of Gabès during this study. Specimens
total length landed vary between 74 and 135 cm. The most common sizes vary between 80
and 92 cm TL. All the capture are immature. Sexual maturity is reached for males and
females respectively between 203-215 and 275-293 cm TL 5.
25
Females: N=1225
Mm Mf
Frequency %
20
Males: N=1119
Mf
15
a
10
5
0
40
45
50
55
60
65
70
20
75 80 85
TL (cm)
90
95 100 105 110 115
Females: N=370
18
Males: N=354
16
Frequency (%)
14
b
12
Mm
10
Mf
8
6
4
2
0
TL (cm)
60
Females: N= 178
Males: N= 162
50
Frequency %
40
Mm
Mf
c
30
20
10
0
15
20
25
30
40
35
40
45
50
DW (cm)
55
60
65
70
75
Femelle: N=176
Mâle: N=151
Frequency (%)
30
d
20
Mf
Mm TMf
TMm
10
Mf
0
55
75
95
115
135
TL (cm)
155
175
195
Fig. 2: Size distribution in trawl of elasmobranchs species in the Gulf of Gabès
Mm and Mf: Size at first maturity respectively of males and females;
a: R. rhinobatos, b: R. cemiculus, c: D. pastinaca, d: C. plumbeus,
In the Gulf of Gabès, trawl landed important quantity of neonate and juvenile essentially for
species how reached large total lengths. While, data concerning others small species as
Rajidae, torpinidae, Scliorhinidae…. are fragmentary. In fact, important quantities of
juvenile are release in the water because of their lower commercial value.
The sustained increase in trawl fishing effort in the area contributed to a decline in
biodiversity of elasmobranchs (stock and habitat). Many species as cacharhinus, plumbeus,
mustelus mustelus Carcharodon carcharias, Rhinobatos cemiculus, Raja clavata… using
the Gulf of Gabès area as a primary nursery will be certainly endangered if any measure of
conservation is not retained.
REFERENCES
1 Bradaï, M.N., Saidi, B., Bouaïn A., Guelorget, O. & Capapé, C. 2005. The Gulf of Gabès (Southern
Tunisia, Central Mediterranean): a nursery area for sandbar shark, Carcharhinus plumbeus (Nardo,
1827) (Chondrichthyes: Carcharhinidae). Annales, Series Historia Naturalis, 15: 187–194.
2 Bradaï, M.N., Saidi, B., Enajjar, S. & Bouaïn, A. 2006. The Gulf of Gabès: a spot for the Mediterranean
elasmobranchs. In N. Basusta, Ç. Keskin, F. Serena, B. Seret, eds. The Proceedings of the
International Workshop on Mediterranean Cartilaginous Fish with Emphasis on Southern
andEastern Mediterranean, Istanbul, 2005, Turkish Marine Research Foundation, Turkey. pp. 107–
117.
3 Bradai, M. N. & Saidi B., 2013. On the occurrence of the great White shark (Carcharodon carcharias) in
tunisian coasts. Rapp. Comm. int. Mer Medit., 40.
4 Cavanagh, R.D. & Gibson, C. 2007. Overview of the conservation status of cartilaginous Fishes
(chondrichthyans) in the Mediterranean Sea. IUCN, Gland (Switzerland) and Malaga (Spain).vi + 42
pp.
5 Compagno, L.J.V. 2001. Sharks of the world. An annotated and illustrated catalogue of shark species
known to date. Bullhead, mackerel, and carpet sharks (Hterodontiformes, Lamniformes and
Orectolobiformes). FAO Species Catalogue for Fishery Purpose N. 1, Rome, 2: 269 pp.
6 Enajjar, S., Bradai, M.N. and Bouain, A. 2003. Données préliminaire sur la reproduction de la pastenague
commune Dasyatis pastinaca (Linnaeus, 1785) du golfe de Gabès. Bull. Inst.natn. Scien. Techn. Mer,
Salammbô, 8: 26 – 30
7 Enajjar, S., Bradaï, M.N. & Bouaïn, A. 2008. New data on the reproductive biology of the common
guitarfish of the Gulf of Gabès (southern Tunisia, central Mediterranean). Journal of the Marine
Biological Association of the United Kingdom, 88: 1063–1068.
8 Enajjar, S., Bradai, M. N. & Bouain, A. 2012. Age, growth and sexual maturity of the blackchin guitarfish
Rhinobatos cemiculus in the Gulf of Gabès (southern Tunisia, central Mediterranean). Cahiers de
Biologie Marine, 53: 17– 23.
9 Ferretti, F., Myers, R.A., Serena F. & Lotze H.K. 2008. Loss of large predatory sharks from the
Mediterranean Sea. Conservation Biology, 22: 952–964.
10 Saidi, B., Bradaï, M.N., Bouaïn, A., Guélorget, O. & Capapé, C. 2005. Reproductive biology of the
sandbar shark, Carcharhinus plumbeus (Chondrichthyes: Carcharhinidae) from the Gulf of Gabès
(southern Tunisia, Central Mediterranean). Acta Adriatica, 46: 47–62.
Concentration, Enrichment and Distribution of Heavy Metals in Sediments
of the Tafna Estuary (Algeria)
Concentration, enrichment and distribution of heavy metals in sediments
of the Tafna estuary (Algeria)
Amel Fellah 1 and Nacéra Dali Youcef 2*
1
2*
University of Tlemcen - Faculty of Science - [email protected]
University of Tlemcen - Faculty of SNV and STU - [email protected]
SUMMARY
The distribution, enrichment, and accumulation of heavy metals in surface sediment of the Tafna estuary
(Wilaya of Ain Temouchent) were investigated. Surface sediments samples from four stations in the estuary
were collected during the period between October 2009 and March 2010, and characterized for grain size
and metal content (e.g. Cd, Co, Cr, Cu, Fe, Mn, Pb and Zn). A speciation study was also carried out using the
BCR (Community Bureau of Reference) protocol to evaluate the availability of these contaminants. The
technique used for analysis is the atomic absorption spectrophotometry method (AAS). The results reveal
relatively low metallic content in sediments, except for Cd, which reached particularly high concentrations in
the four sampling points, and peaked in the carbonated fraction (≈ 42%) implicating its bioavailability in the
environment. The results of geoaccumulation index (Igeo) reveal that sediments are uncontaminated with Co,
Cr, Cu, Fe, Mn; moderately contaminated with Pb and Zn; and moderately to heavily contaminated with Cd.
The enrichment factors showed that Co, Cr, Cu, and Mn are depleted whereas Cd, Pb, and Zn are enriched.
ANOVA and principal component analysis (PCA) were used to compare the data for different months and
sampling points. The results showed high positive correlations. The main sources of contamination are
domestic, agricultural, and industrial effluents along the wadi Tafna, which arise due to the lack of sewage
treatment. However, these sampling points could not be classified as polluted when the data were compared
with sediment quality guidelines.
Key words: Heavy metals, Sediment, Enrichment factors, Geoaccumulation index, Tafna estuary, Algeria.
INTRODUCTION
Estuaries, or freshwater-saltwater interface zones, are areas of great ecological and
economic importance. They are among the most exposed zones to different types of
pollution, including metal, whether as a direct result of industrialization and urbanization,
or as indirect contributions by rivers and the atmosphere. Among the chemical substances
often at the source of metal pollution are heavy metals. They are distinguished from other
chemical pollutants by their low biodegradability and their large bioaccumulation capacity
throughout the trophic chain, which can cause major ecological damage. Wadi Tafna is 170
km long and is located in the north-western region of Algeria, draining a basin of 7245 km2.
Tafna estuary, the terminal part of wadi Tafna, is located in the beach of Rachgoun (Wilaya
of Ain Temouchent), at approximately 30 km west of the town of Ain Temouchent (Fig. 1).
This estuary is characterized by the development of basaltic tuff of volcanoes which are
present on all its sites. This region has a Mediterranean climate. This study was carried out
to determine the current state of metal contamination in the Tafna estuary (Rachgoun), in
order to complete and update previous works on metal pollution in the far west of Algeria
and to gain more knowledge on the system of estuaries which is unfortunately not very well
developed in our country [1,2]. Indeed, it was interesting to measure the heavy metal
pollution levels of surface sediments of Tafna estuary by working out the temporal-spatial
distribution of eight metals (Cd, Co, Cr, Cu, Fe, Mn, Pb and Zn) during the period between
October 2009 and March 2010. Subsequently, a correlation was established between the
sites, months and contamination.
The purpose of this correlation is to explain the phenomenon of heavy metal supply to
sediments. The description of these variations is beyond the scope of the paper. The
assessment of the mobility of a pollutant is of particular relevance in the estimation of the
effects of contamination.
Sampling, Sample Treatment and Analysis
Sampling was carried out monthly between October 2009 and March 2010. Four sampling
points were selected along the estuary. “A” is located on the estuary part the most affected
by the sea. “B” is located 100 m away from point “A” and “C” 200 m away from the same
point (close to the uncontrolled dumpsite). Its survey will allow us to see the impact of
domestic waste on the contamination of estuarine sediments. “D” is located at 400 m from
point “A” (Fig.1).
1/25000
A
B
C
D
Tafna Estuary
O
UE
D
C
HO
UL
Y
BENSEKRANE
KHEMIS
EL
ABED
ALGERIA
0
200km
Figure 1: Map of study area and location of the sampling sites
The surface sediments (the first five centimeters) were scraped with a small spade, stored in
transparent plastic bags, labeled and transported to the laboratory in a cooler at 4 °C. Then,
they were dried in ambient air for a few days. The samples were crushed using a porcelain
mortar to obtain a fine powder, followed by separation through a sieve to obtain the lower
fraction (i.e.: < 63 µm). This fraction represents more than 95 % of the sediments. The
lower fraction is kept and mineralized with aqua regia (3 ml of HCl: 1ml of HNO 3,
Suprapure, Merck) in Teflon flasks at 120 °C. The whole was heated on a plate at about
70°C for 2 hours until the disappearance of red nitrous fumes and the appearance of clear
smoke. Then, the sample was dry-evaporated, a few drops of double distilled water
introduced on the Teflon walls to solubilise the metals, and again the excess acid
evaporated as before [3,4].
Speciation of metals
For each sampling point, six total digestions were performed and the overall value recorded
as the average of these tests with their respective standard deviations.
Heavy
metal
mobility was tackled through the adapted sequential extraction scheme of the BCR. Table 1
shows the operating procedure used to which we have added a fourth extraction found in
most sequential extraction schemes, namely “the residual phase”. A mechanic shaker was
used for all extraction experiments and the extracts were separated by centrifugation.
Table 1: BCR sequential extraction method [5]
Step
Reagents
1
2
CH3COOH 0,11M
NH2OH.HCI 0,1M
Acidified with HNO3 2M
H2O2 8,8M
3
NH4OAc 1M, (pH = 2)
volume of the
solution (ml)
40
40
Temperature
(°C)
22 ± 5
22 ± 5
10
22 ± 5
10
50
85 ± 5
85 ± 5
22 ± 5
Extraction time
16 hours of agitation
1hour of occasional
agitation
1 hour
1hour
The resulting solutions were filtered with a 0,45 µm filter (Millipore membrane filters and
acidified with HNO3), filled to 20 ml with bi-distilled water and kept at 4°C until analysis.
A flame atomic absorption spectrophotometer type IA AURORA 1200 was used to
determine the eight metals Cd, Co, Cr, Cu, Fe, Mn, Pb and Zn. All data were computed on a
milligram per kilogram dry weight basis. The accuracy of the analytical procedures for total
metal determinations was checked using MESS (1) (certified standards) provided by the
National Research Council of Canada. This was analysed under the same experimental
conditions. Replicate analysis of these reference materials showed good accuracy with
recovery rates for metals around 96 %. The absorption wavelengths were 228,8 nm for Cd,
240,7 nm for Co, 357,9 nm for Cr, 324,7 nm for Cu, 248,3 nm for Fe, 278 nm for Mn, 283,3
nm for Pb, and 213,9 nm for Zn. For each sampling point, six total digestions were
performed and the overall value was recorded as the average of these tests with their
respective standard deviations.
Geoaccumulation index and enrichment factors
Geoaccumulation index (Igeo)
A common approach to estimating the enrichment of metal concentrations above
background or baseline concentrations is to calculate the geoaccumulation index (Igeo) as
proposed by Müller [6]. The method assesses the degree of metal pollution in terms of
seven enrichment classes based on the increasing numerical values of the index. This index
is calculated as follows:
Igeo = Log2 (Cn / 1,5 Bn)
(1)
Where Cn is the concentration of the element in the enriched samples, and Bn is the
geochemical background concentration of metal n. The factor 1,5 is introduced to minimize
the effect of possible variations in the background values, which may be attributed to
lithological variations in sediments [7]. The geoaccumulation index consists of seven grades
or classes [6] (table 2).
Enrichment factor (EF)
It is common to estimate the anthropogenic impact on sediments by calculating a
normalized enrichment factor (EF) for metal concentrations above uncontaminated
background levels [8, 9]. The EF calculation seeks to reduce the metal variability associated
with variations in mud/sand ratios, and is a convenient tool for plotting geochemical trends
across large geographic areas, which may have substantial variations in the mud (i.e. clay
rich) to sand ratios.
This method consists in using a reference element of terrigenous origin, mainly Al, Fe or Si
(known as terrigenous metals) to determine the terrigenous portion of metal contribution
[10, 11]. If the EF is higher than one, it may be indicative that the sediment is of an
anthropogenic source and can be used for assessing the degree of pollution.
For our study, the enrichment factor of the sediments was calculated by dividing its ratio to
the normalizing element by the same ratio found in the chosen baseline [7]. Thus, EF is
computed using the relationship below:
EF = (Me / Fe)Sample / (Me / Fe)Background
(2)
Where EF is the enrichment factor, (Me/Fe)Sample is the ratio of metal and Fe concentration
of sample, and (Me/Fe)Background is the ratio of metal and Fe concentration of a background.
Many authors prefer to express the metal contamination with respect to average shale to
quantify the extent and degree of metal pollution [6, 12]. In this study, the background
concentrations of Cd, Co, Cr, Cu, Mn, Pb, and Zn were taken from [7]. The advantage of
using the enrichment factor (EF) analysis is that it allows establishing a contamination
guideline. This technique has been well applied in several studies to assess metal
contamination in marine sediments [13, 14] (Table 2).
Table 2: Geoaccumulation indexes [6] and Enrichment factor [13, 14]
Range
<0
0-1
1-2
2-3
3-4
4-5
>5
Igeo (geoaccumulation index)
Scale
Unpolluted
Unpolluted to moderate
Moderate polluted
Moderate to strongly
Strongly polluted
Strong to very strong
Very strong polluted
Class
0
1
2
3
4
5
6
EF (Enrichment factor)
Range
Scale
<1
Natural
1-3
Minor anthropogenic
3-5
Moderate
5-10
Moderately severe
10-25
Severe
25-50
Very severe
>50
Extremely severe
STATISTICAL METHODS
Statistical analysis was performed using Minitab 16 software. One-way ANOVA test was
used to compare the data for different months at the level of 0,05 and also a multivariate
analysis of the results was done using principal component analysis (PAC) and correlation
analysis on the mean metal concentrations each months and each stations in sediments.
Absorption analysis
Table 3 shows the average concentrations (± S.D) (mg/kg dry weight) of Cd, Cu, Cr, Cu,
Fe, Mn, Pb and Zn, in the sediments at the four stations (A, B, C and D), with averages, Igeo
index values, enrichment factors EF, and background values. The calculated standard
deviations do not show a large variability, which is satisfactory for the purpose of this
study. The results for cadmium indicate a very important accumulation, easily exceeding
the average reference level [7], which is found to be around 0,73 mg/kg, at the four points
A, B, C and D (table 3). This contamination may be related to the use of cadmium found in
batteries, in plating for protecting steel against corrosion, in plastics and pigment
stabilization. It could also be attributed to agricultural activities that make use of phosphate
compounds with large amounts of cadmium [15]. The amount of domestic sewage
emanating from the surrounding cities is directly discharged into the estuary. These factors
may explain the high levels of Cd found in surface sediments. Cantillo et al., [16]
established average Cd concentrations in the world from 1,5 to 7,7 mg/kg with maximum
values closest to industrial complexes and sewage pipelines. Atmospheric deposition may
also contribute to Cd enrichment in sediments [17, 18]. The monthly average Cd
concentrations in all sites ranged from A to D (A < B < C < D) and exceeded the
background values [7]. For the other metals, concentrations vary slightly from one point to
another, but do not exceed the international values. The average metal content of Tafna
estuarine sediments was found in order of Fe > Mn > Zn > Cr > Pb > Co > Cd, for sites: D
> C > B > A.
Table 3: Average concentrations (± S.D) (mg/kg dry weight) of Cd, Co, Cr, Cu, Fe, Mn, Pb,
and Zn in sediments at the four sites (A, B, C and D), with Igeo index values, enrichment
factors (EF) and background values [7]
Stations
Cd
Co
Cr
Cu
Fe
Mn
Pb
Zn
A
1,14 ± 0,59
8,34 ± 1,87
25,67 ± 5,42
12,86 ± 5,35
12547,44 ± 1900
278,97 ± 53,00
14,68 ± 6,48
59,28 ± 10,3
B
1,21 ± 0,64
8,53 ± 2,25
25,64 ± 4,54
14,18 ± 4,97
12757,69 ± 1840
284,98 ± 62,87
15,08 ± 7,13
61,29 ± 10,18
C
1,55 ± 0,94
10,14 ± 3,01
33,68 ± 4,55
26,23 ± 12,36
12712,68 ± 1860
294,71 ± 57,99
28,08 ± 12,45
99,75 ± 48,22
D
1,59 ± 1,03
10,49 ± 3,27
32,42 ± 4,36
24,11 ± 9,93
12894,97 ± 1880
302,93 ± 59,19
29,79 ± 12,11
120,32 ± 102,6
Average
1,38 ± 0,22
9,38 ± 1,09
29,35 ± 4,30
19,34 ± 6,80
12728,2 ± 143,29
290,39 ± 10,57
21,91 ± 8,14
85,16 ± 29,93
I geo
1,80
-0,42
-0,84
-0,61
-1,02
-0,79
0,32
0,13
Class
2
0
0
0
0
0
0-1
moderately
uncontaminated
uncontaminated uncontaminated
uncontaminated
uncontaminated
contamination
EF
Turekian and
0-1
uncontaminated
uncontaminated
to moderately
to moderately
10,81
1,84
1,21
1,60
-
1,27
4,10
3,33
sever
minor
minor
minor
-
minor
moderate
moderate
enrichment
enrichment
enrichment
enrichment
-
enrichment
enrichment
enrichment
0,3
19
90
45
47200
850
20
95
Wedepohl
background [7]
The overall results show that the sampling points C and D, which drain the discharge of
domestic wastewater and are located near the uncontrolled dump, exhibit significant
contamination. Conversely, the two other points A and B, influenced by the marine
environment, show less pollution. The results of the current study show that, with the
exception of Cd, Fe and Mn levels (P > 0,05), concentrations of most elements were
significantly high from one site to the next one (ANOVA 1).
Geoaccumulation index and enrichment factors
According to Müller scale [6], used by other authors, i.e. [19], all sampling sites are classed
between 0 and 2, corresponding to uncontaminated to moderately contaminated (Table 3).
Then, they are subjected to polluting effects. Co, Cr, Cu, Fe and Mn exhibit average Igeo
values that correspond to an unpolluted situation. Cadmium can be considered as a
moderate pollutant in all sites (Igeo = 1,80). The results of the present study show a high Cd
index in sediments at sites “A” and “B” (5 < FE < 10), and it is higher in sediments at sites
“C” and “D” (10 < FE < 25) (Table 3). Pb and Zn are moderately high in sediments at both
sites “C” and “D”. The highest average EF is seen for Cd with a value of 10,81. Lead has
the second highest EF with an average value of 4,10 followed by zinc with an average value
of 3,33 (Table 3). This suggests that Cd, Pb and Zn originate from anthropogenic inputs
including fertilizers and pesticides used in agricultural activities. The difference in EF
values may be due to the difference in the magnitude of input for each metal in the sediment
and/or the difference in the removal rate of each metal from the sediment.
Speciation of metals
The study of the mobility of heavy metals was performed using the sequential extraction
scheme BCR for sediments extracted during January when results show the most important
metal accumulation. Full results as a percentage of metals extracted in each phase
(carbonate, oxide and hydroxides of iron and manganese, organic and residual) are
presented in figure 2. The study of speciation has allowed us to rank, in descending order of
mobility, metals within the sedimentary material as follows: Cd > Mn > Pb > Zn > Cu > Co
> Cr > Fe. Overall, the largest fraction is the residual fraction, which is not bioavailable in
the environment [15]. Also, the eight metals studied display in each of the four sedimentary
phases similar distributions, regardless of the sampling point. Cadmium is mainly hosted in
the carbonate-bound fraction. In relation to the other fraction, its rate of accumulation is
between 41,74 and 41,93 % in all the sites in this study, which indicates that cadmium can
be mobile and become bioavailable, and therefore affect the environment directly. Our
results are in agreement with the literature [20]. On the other hand, the residual fraction
covers only 6 – 6,5% while the remaining two phases, Fe-Mn oxides and organic, represent
32% and 20 to 21% respectively. Cobalt is mainly concentrated in the residual phase (≈
64%). Most of chromium and copper is prevalent in the residual fraction (80%). This
proportion does not pose a major environmental hazard. Increased levels of Cu and Cr in
the organic phase (≈ 8%) has been observed by Lourino-Cabana et al., [13], and may be
attributed to the domestic waste discharged into the estuary, which favors the formation of
organic compounds. Iron is widely present in the residual phase (82,6 to 96,2%). Unlike the
previous cases, the residual fraction is no longer dominant. Manganese does not represent
more than 30% of the total metal. Overall, the labile, residual and oxide fractions are
equitably distributed, which is not the case for the Manganese organic fraction (≈ 3,5 %).
Our results are not consistent with the literature [21, 22].
As noted in this study, lead of natural origin is essentially concentrated in the oxide and
residual fractions. It is connected respectively to the oxide fraction (≈ 37,5%), the residual
fraction (≈ 31%), the carbonate fraction (≈ 19%) and the organic fraction with the lowest
rate, thus precluding the possibility of the formation of very stable complexes in the
presence of humic material. Given the high content of zinc in the sediments of the Tafna
estuary (maximum value of 302,93 ± 57,19 mg/kg recorded at site “D”) and the fact that it
is also present in the residual form (≈ 57%), implies that it is not hazardous to the
environment. Our results are consistent with those of literature [23].
A
B
100%
100%
80%
80%
60%
60%
40%
40%
20%
20%
0%
0%
Cd
Co
Cr
Cu
Fe
Mn
Pb
Zn
Cd
Co
Cr
Cu
C
Fe
Mn
Pb
Zn
Fe
Mn
Pb
Zn
D
100%
100%
80%
80%
60%
60%
40%
40%
20%
20%
0%
0%
Cd
Co
Cr
Cu
Fe
Mn
Carbonate
Pb
Zn
Cd
Fe-Mn oxide
Co
Cr
Organic and Sulphide
Cu
Residual
Figure 5: Distribution of the metals in several phases of sediments according to BCR sequential
extraction method
100%
90%
Factor analysis
80%
70%
60%
50%
40%
30%
20%
10%
0%
In order to study inter-elemental associations, the correlation coefficients of the elements
analyzed were computed for all sediment samples. The total concentration data were also
subject to factor analysis to identify estuary sediment sources. The principal component
analysis (PCA) gives us 83,2 % of information. Variance information gives 75,3 % for
factor 1 and 7,9 % for factor 2. The variables have high positive loadings on factor 1. On
the other hand, Cd, Cr, Mn, Pb, and Zn have high positive loadings on factor 2. Two factors
with different factor loadings indicate that two different contributions are involved in
determining the heavy metal concentrations in estuarine sediments.
The correlation analysis of concentrations data (Table 4) shows a high positive correlation
between Cd, Co, Cr, Cu, Fe, Mn, Pb and Zn, may possibly be due to the same
anthropogenic sources and similar transformation and migration processes.
Cd
Co
Cr
Cu
Fe
Mn
Pb
Zn
Table 4: The correlation analysis of concentrations data
Variables
Cd
Co
Cr
Cu
Fe
Mn
Pb
Zn
Cd
1
0,839
0,799
0,657
0,696
0,883
0,858
0,788
Co
Cr
Cu
Fe
Mn
Pb
Zn
1
0,741
0,730
0,756
0,719
0,802
0,661
1
0,675
0,506
0,702
0,857
0,700
1
0,670
0,445
0,783
0,648
1
0,684
0,600
0,519
1
0,775
0,666
1
0,848
1
CONCLUSION
This study served to evaluate the distribution of seven heavy metals in selected sediments of
Tafna estuary. The results obtained are a first approach to assess the environmental levels of
these metals in function of their availability in the ecosystem. Concerning the total
concentrations in sediments, the results confirm that only cadmium exceeds the background
in sediments at all sites and in all period study. The results also show satisfactory agreement
between the total concentrations of metals and the sun of individual fractions. The impact of
anthropogenic heavy metal pollution in Tafna estuary was evaluated using the
geoaccumulation index (Igeo) and the enrichment factor (EF), for Cd, Co, Cr, Cu Mn, Pb and
Zn at four sites. The geoaccumulation indices (Igeo) are distinctly variable and suggest that
sediments in Tafna estuary range from uncontamined to moderately contaminated with
respect to metal analysis. The enrichment factor (EF) values were calculated using the
continental shale abundance of Fe. The results showed higher average EF values for Cd
(10,83), followed by Pb (4,10), and by Zn (3,33). The average enrichment factor EF was
between 1 and 11, which confirms the case of severe enrichment. The element whose
enrichment is most critical at present is cadmium. At the current state of the Tafna estuary,
the mobility of metals in sediments is low. The risk of bioavailability appears to be
relatively small due to the small quantity of metals present in the carbonate fraction.
Overall, only cadmium presents a critical situation. Likewise, its high rate in the carbonate
phase (≈ 42%) enhances its direct impact on the environment. A relationship was found
between the metals. Strong correlation among these metals may possibly be due to the same
anthropogenic sources.
REFERENCES
[1] Cheggour, M - Chafik, A - Fisher, N.S - Benbrahim, S : (“ 59, 2, 119-137”) (Marine Environmental
Research) (2005).
[2] Dassenakis, M - Andrianos, H - Depiazi, G - Konstantas, A - Karabela, M - Sakellari, A - Scoullos, M:
(“18, 781-794”) (Applied Geochemistry) (2003).
[3] Agemian, H - Chau -A.S.Y: (“80,1, 61-66”) (Analytica Chimica Acta) (1975).
[4] Rauret, G - Lopez Sanchez, J.F - Sahuquillo, A - Rubio, R - Davidson, C - Ure, A.- Quevauviller, P: (“1,
57-61”) (Journal Environmental Monitoring) (1999) .
[5] Quevauviller, Ph - Rauret, G - López-Sánchez, J.F - Rubio, R - Ure, A - Muntau, H:
(“http://www.sciencedirect.com/science/article/pii/S0048969797002052 205,
2–3,
223-234”)
(Science of The Total Environment) (1997).
[6] Müller, G: (“2, 3, 108-118”) (Geojournal) (1969).
[7] Turekian, K.K - Wedepohl, K.K : (“72, 2, 175-192”) (Geological Society of America Bulletin) (1961).
[8] Kalantzi, I- Shimmied,- Pergantis, S.A. - Papageorgiou, Black K.D - Karakassis, I : (“444, 128-137”)
(Science of total Environment) (2013).
[9] Zahra, A - Hashmi- M.Z - Malik, R.N - Ahmed, Z: (“470-471, 2, 925-933”), (Science of total
Environment) (2014).
[10] Carruesco, C - Lapaquellerie, Y : (“16, 12, 493-497”) (Marine Pollution Bulletin) (1985).
[11] Sterckeman, T- Douay, F - Baize, D - Fourrier, H - Proix, N - Schvartz, C : (“136, 4, 912-926.
(Geoderma) (2006).
[12] Förstner, U - Müller, G: (“14, 17, 53 – 61”) (Geoforum) (1973).
[13] Lourino-Cabana, B- Lesven, L - Charriau, A - Billon, G - Ouddane, B - Bourghriet, A: (“186, 3, 21292137”) (Journal of Hazardous Materials) ( 2011).
[14] Yang, Y - Chen, F- Zhang, L - Liu, J - Wu, S - Kang, M : (“ 64, 9, 1947-1955”) (Marine Pollution
Bulletin) (2012).
[15] Gao, X - Chen, S - Long, A : (“56, 770–797”) (Marine Pollution Bulletin) (2008).
[16] Cantillo, A.Y - O’Connor, T.P : (“7, 1, 31-50”), (Chemistry and Ecology) (1992).
[17] Pacyna, J.M : In J.O. Nriagu and C.I. Davidson (Ed.) (Toxic elements in the atmosphere) (New York:
Wiley, 33- 52) (1986).
[18] Migon, C - Morelli, J - Nicolas, E - Copin-Montegut, G :(”105, 135-148”) (The Science of the total
environment) (1991).
[19] Bhuiya, M.A.H - Parvez, L - Islam, M.A - Dampare, S.B - Suzuki, S (“173, 2, 384-392”) (Journal of
Hazardous Materials) ( 2010).
[20] Boughriet, A - Proix, N - Billon, G - Recourt, P - Ouddane, B (“180, 83–95”) (Water Air Soil
Pollution) (2007).
[21] Leleyter, L - Probst, I. L : (”73, 109-128”) (International Journal Environmental Analytical Chemistry)
(1999).
[22] Ouddane, B - Skiker, M - Fischer, J.C - Wartel, M : (“1, 489-496”) (Journal of Environmental
Monitoring) (1999).
[23] Ma, Y.B - Uren, N.C : (“26, 3291-3303”) (Communication in soil science and plant analysis) (1995).
Etude Quantitative et Qualitative des Protéines Gonadiques de Donax trunculus
(Mollusca: Bivalvia) de la Baie d’Annaba (Algérie)
Etude quantitative et qualitative des protéines gonadiques de Donax
trunculus (Mollusca: Bivalvia) de la baie d’Annaba (Algérie)
1
Nadia Soltani-Mazouni1 & Amel Hamdani1
Laboratoire de Biologie Animale Appliquée, Faculté des Sciences, Département de Biologie, Université Badji
Mokhtar - E-mail: [email protected] - [email protected]
RESUME
Ce travail a porté sur l’étude des variations saisonnières des protéines gonadiques mâles et femelles chez
Donax trunculus. Il vise à évaluer l’impact de la pollution sur la quantité et la qualité des protéines
gonadiques. Les échantillons ont été collectés durant l’année 2011 au niveau de deux sites se trouvant dans
la baie d'Annaba (Sidi Salem et El Battah) différents par leur niveau d’exposition aux sources polluantes. Le
site de Sidi Salem étant relativement plus pollué comparativement à celui d’El Battah . Les principaux
résultats obtenus montrent des effets saison, site et sexe hautement significatifs. Ces effets sont en rapport
avec le cycle sexuel de D. trunculus dans la baie, le niveau de pollution des sites et également les besoins
énergétiques des sexes. L’analyse électrophorétique des protéines gonadiques a révélé pareillement des
effets saison, site et sexe. L'étude biochimique indique que les deux sexes réagissent de façon différente au
stress environnemental. En effet, les mâles de cette espèce sont plus sensibles que les femelles.
Mots clés : Pollution, Golfe d’Annaba, Bioindicateur, Donax trunculus, Protéines, Gonade.
INTRODUCTION
Le développement croissant des activités industrielles et domestiques a engendré de
nombreux types de pollution. La pollution liée aux métaux lourds, particulièrement en
milieu aquatique, suscite nombre d'inquiétudes tant pour la santé des populations aquatiques
que celle des humains [1, 2]. Les zones côtières algériennes, longues de 1200Km, sont
considérées sur un plan écologique comme un système aquatique d’une très grande
importance car hébergeant une très grande variété d’espèces animales et végétales [3 , 4].
La pollution de ces zones côtières par des substances chimiques diverses peut avoir des
conséquences graves sur l’équilibre écologique. Des travaux antérieurs ont montré que le
golfe d’Annaba est affecté par plusieurs polluants dont les métaux lourds [5-7]. En effet,
divers métaux lourds ont été détectés dans le golfe d’Annaba chez une espèce bioindicatrice
de la pollution D. trunculus [5, 8]. Dans le cadre d’un programme national de recherche
sur l’état de santé de la baie d’Annaba mené depuis l’année 2002, la présente étude, en
continuité avec les travaux antérieurs, vise à évaluer l’impact de la pollution sur la quantité
et la qualité des protéines gonadiques mâles et femelles de D. trunculus. L'échantillonnage a
été réalisé dans la baie d’Annaba durant les quatre saisons de l’année 2011 au niveau de
deux sites se distinguant par leur niveau de pollution.
Présentation des sites d’échantillonnage
Le golfe d’Annaba est situé à l'extrême Nord-Est du littoral algérien. Il est limité par le cap
Rosa (8°15’ E et 36° 58’ N) à l’Est, et par le cap de Garde (7° 16’ E et 36° 58’ N) à l’Ouest.
El Battah (36° 50' N - 7° 50' E) se situe à 30km à l’Est d’Annaba. Ce site est éloigné de
sources polluantes et est soumis à un régime hydrodynamique très important. Le site de
Sidi Salem (36° 50' N - 7° 47' E) se trouve à environ 1km de la ville d’Annaba et il est
exposé à différents types rejets.
Collecte des échantillons
L’échantillonnage a été effectué durant l’année 2011 au niveau des deux sites retenus (El
Battah, Sidi Salem). D. trunculus est ramené vivant le jour même au laboratoire dans des
bacs en plastique contenant de l’eau de mer. La dissection et le prélèvement de la gonade
sont réalisés sur des individus ayant une taille moyenne de 27 ± 1 mm le jour même de la
pêche afin d’éviter l’effet du jeûne et l’émission éventuelle des gamètes due au stress. En
effet, ces phénomènes biologiques diminuent le poids de la masse molle totale [9]. Le
prélèvement de la gonade a été réalisé par saison, par site et par sexe.
Dosage des protéines
L’extraction des protéines a été réalisée selon Shibko et al. [10]. Les tissus gonadiques
d’environ 45 ± 2 mg par individu sont homogénéisés dans 1 ml d'acide tricloroacétique
(TCA). L'homogénat obtenu est centrifugé (5000 tours/mn; 10 mn); une deuxième
centrifugation est effectuée (5000 tours/mn; 10 mn), après addition de 1 ml d’étherchloroforme (v/v). Au culot on ajoute 1 ml de NAOH (0,1N) qui servira pour le dosage des
protéines selon la méthode de Bradford [11] utilisant le bleu brillant de Coomassie (G 250,
Merck) comme réactif et le sérum d’albumine de bœuf (BSA, Sigma) comme protéine
standard. Les absorbances sont lues à une longueur d’onde de 595 nm.
Technique électrophorétique
La séparation des protéines est réalisée selon la technique de Laemmli [12]. Un pool de
fragments des gonades (2 à 3 de gonades différentes) est prélevé et mis dans 500µl d'une
solution de phényl méthyl sulfonyl fluoride (PMSF : 45mg/ml éthanol) à 0,1 %. Les
échantillons sont ensuite stockés au congélateur à -20°C jusqu’au jour du dosage.
L’extraction des protéines est effectuée à 4°C sous agitation pendant 24 heures.
L’homogénat est par la suite centrifugé (5000 tours/mn; 10 mn). Les protéines sont
quantifiées dans une fraction aliquote selon la méthode de Bradford [11]. Le volume restant
est lyophilisée et servira à l’étude électrophorétique. Les extraits secs sont repris dans un
tampon d’échantillon. Le profil électrophorétique des protéines gonadiques mâles et
femelles est effectué sur un gel de polyacrylamide additionné de SDS (sodium dodécyl
sulfate) à 12,5%. Après migration, les gels sont placés dans une solution de coloration
(0,025% Bleu de coomassie R 250 (Merck), 10% acide acétique et 25% de propanol 2) et
décolorés dans l'acide acétique à 10%. 10 protéines standards ont été utilisées (10–250 kDa)
(référence 161-0373, Bio-Rad, France).
Analyse statistique
Les résultats obtenus ont été exprimés par la moyenne arithmétique plus au moins l'écarttype (m ± SD) et différents tests statistiques ont été réalisés à l'aide du logiciel MINITAB
version 16 (PA State College, USA). Les moyennes ont été comparées deux à deux par le
test t Student. Pour les comparaisons intrasites, une analyse de la variance univariée suivie
du test de Tukey a été effectuée. Enfin, une analyse de la variance multivariée (trosi critères
de classification) a été également effectuée. Le seuil de signification est p< 0,05.
RESULTATS
Variation saisonnière des taux de protéines gonadiques
L’évolution saisonnière des taux de protéines au niveau des gonades mâles et femelles de
D. trunculus récoltés dans deux sites du golfe d’Annaba, montre des valeurs maximales en
été et des valeurs minimales au printemps (Fig. 1). L’analyse de la variance à un seul
critère de classification (saison) pour chaque sexe et au sein de chaque site montre un effet
saison hautement significative (P< 0,001) dans les deux sites d’études (El Battah : mâles
F=253,21; ddl= 3, 18; p<,001 ; femelles F=693,47; ddl = 3, 16; p< 0,001 ; Sidi Salem :
mâles F=171,20; ddl = 3, 15; p< 0,001; femelles F=118,36; ddl = 3, 18; p< 0,001). Le test
de Tukey classant les saisons par sexe montre l’existence de trois groupes pour les mâles (le
1ier groupe renferme l’été, le 2ième groupe renferme l’hiver et l’automne et le3iéme groupe
renferme le printemps) et quatre groupes pour les femelles à El Battah (le 1 ier groupe
renferme l’été, le 2ième groupe renferme l’hiver, le 3ième groupe renferme l’automne et le
4ième groupe renferme le printemps). A Sidi Salem, on note trois groupes pour les mâles (le
premier groupe renferme l’été, le 2ième groupe renferme l’automne et le 3ième groupe
renferme l’hiver et le printemps) et deux groupes pour les femelles (le premier groupe
renferme l’été, l’automne et l’hiver, le second groupe renferme le printemps). La
comparaison des moyennes entre les deux sexes et pour le même site par le test t de Student
montre des différences hautement significatives (P< 0,001) en été et en automne à El
Battah, et au printemps et en été à Sidi Salem. La comparaison des moyennes entre les
deux sites et pour le même sexe par le test t de Student révèle des différences hautement
significatives (p< 0,001) en hiver, printemps et été, et très significatives (p<0,01) en
automne pour les mâles. Pour les femelles, on enregistre des différences hautement
significatives (p< 0,001) en hiver et en été et très significatives (P<0,01) au printemps, des
différences significatives ont été également notées en automne. La station d’El Battah
présente des teneurs plus élevées en protéines comparativement à la station de Sidi Salem.
L’analyse de la variance à trois critères de classification (site, saison, sexe) révèle des effets
saison (F= 1040,13; ddl= 3, 55; p= 0,000),sexe(F=52,00; ddl= 1, 55; p=0 ,001) et
site(F=876,65; ddl= 1, 55; p=0,001) hautement significatives .
Figure 1 : Variations saisonnières des taux de protéines (µg/mg de tissu) au niveau des gonades mâles
(A) et femelles (B) de D. trunculus pêché dans deux sites dans la baie d’Annaba: El Battah et Sidi Salem
au cours de l’année 2011 (m ± SD; n=4-6) (** différence très significative*** différence hautement
significative).
Analyse électrophorètique des protéines gonadiques des protéines
Le suivi saisonnier de profil électrophorétique chez les mâles montre des poids moléculaires
variant de 13 à 250 kDa à El Battah et de 13 à 257 kDa à Sidi Salem (Fig. 2). En effet, les
résultats montrent en hiver: 7 fractions protéiques à El Battah et 6 à Sidi Salem (avec
l’absence des fractions de 200 et 110 kDa à Sidi Salem et 257 kDa àt El Battah), au
printemps: 13 fractions protéiques à El Battah et 11 à Sidi Salem. (avec l’absence des
fractions de 30 et 13 kDa à Sidi Salem), en été: 5 fractions protéiques à El Battah et 4 à Sidi
Salem (avec l’absence de fraction de 98 kDa à Sidi Salem) et en automne : 10 fractions
protéiques à El Battah et 7 à Sidi Salem (avec l’absence de fraction de 170, 140 et 97 kDa à
Sidi Salem).
Figure 2 : Séparation électrophoretique des protéines gonadiques mâles de D. trunculus récoltés au
niveau de deux sites dans la baie d’Annaba durant l’année 2011. A: Protéines standards (1), Hiver El
Battah (2), Hiver Sidi Salem (3), Printemps El Battah (4), Printemps Sidi Salem (5); B: Protéines
standards(1), Eté El Battah (6), Eté Sidi Salem (7), Automne El Battah(8), Automne Sidi Salem (9).
La séparation électrophorétique des protéines gonadiques chez les femelles est représentée
dans la figure 3. Elle montre en hiver, 4 fractions protéiques à El Battah et 7 à Sidi Salem
(avec l’absence des fractions de 200, 158, 124 et 67 kDa à El Battah). Au printemps, on
note la présence de 2 fractions protéiques à El Battah et 4 à Sidi Salem (avec l’absence des
fractions de 47 et 13 kDa à El Battah). En été, on observe 3 fractions protéiques à El Battah
et 4 à Sidi Salem (avec l’absence de fraction de 47 kDa à El Battah), et enfin en automne 3
fractions protéiques à El Battah et 4 à Sidi Salem (avec l’absence de fraction de 57 kDa à El
Battah).
Figure 3 : Séparation électrophoretique des protéines gonadiques femelles de D. trunculus récoltés au
niveau des deux sites dans la baie d’Annaba durant l’année 2011. Protéines standards (1), Hiver El
Battah (2), Hiver Sidi Salem (3), Printemps El Battah (4), Printemps Sidi Salem (5), Eté El Battah (6),
Eté Sidi Salem (7), Automne El Battah (8), Automne Sidi Salem (9).
DISCUSSION
La pollution de l’écosystème marin est l’un des problèmes majeurs posés à
l’environnement. Les organismes aquatiques présents dans ces milieux ont à faire face à de
très nombreuses sources de perturbations qui agissent le plus souvent de manière simultanée
engendrant ainsi des interactions plus ou moins néfastes [13]. La composition biochimique
des mollusques bivalves fournit une indication certaine sur les conditions nutritionnelles des
populations et sert également à évaluer la réponse de ces organismes aux conditions
environnementales [14,15]. Les bivalves marins manifestent également des variations
saisonnières marquées dans leur contenu biochimique ayant un rapport direct avec le
développement gonadique et la gamétogenèse [16,17]. L’évolution saisonnière des taux de
protéines dans les gonades mâles et femelles de D. trunculus péché dans deux sites dans la
baie d’Annaba a révélé des effets saison, site et sexe. Ces effets sont étroitement liés au
cycle de reproduction de l’espèce dans le golfe d’Annaba et aux conditions
environnementales du milieu ainsi qu’à l’état physiologique des deux sexes et leurs besoins
énergétiques.
Concernant le cycle sexuel de D. trunculus dans d la baie d’Annaba, des travaux antérieurs
ont montré que celui-ci présente une période d’activité sexuelle s’étalant dès le mois de
décembre jusqu'au mois d’août,et une période de repos sexuel automnal. Deux périodes de
recrutements ont été révélées, l’une au printemps et l’autre en automne [5, 18]. Nos
résultats montrent une diminution des taux de protéines au niveau des deux sites au cours
de la période printanière qui coïncide avec la période d’émission gamétique, et une
diminution de ces taux en période automnale durant le repos sexuel. Ce cycle est similaire
aux observations rapportées sur la même espèce ou d’autres espèces de bivalves dans
d'autres biotopes [19-21].
La détermination saisonnière des taux de protéines au niveau des deux sites d’étude et chez
le même sexe montre que les individus d’El Battah sont plus riches en protéines par rapport
à Sidi Salem. Ces résultats sont accords avec des études antérieures réalisées sur la même
espèce récoltée dans les mêmes sites et chez d’autres espèces bivalves [18, 22]. L'effet du
stress environnemental est plus marqué au niveau du site de Sidi Salem, proche des sources
polluantes. En effet, des travaux récents ont mis en évidence une inhibition de l’AChE et
une induction de la GST chez D. trunculus dans le site de Sidi Salem comparativement à
celui d'El Battah [23, 24]. Concernant l’effet sexe, les résultats montrent que les femelles
sont plus riches en protéines que les mâles, confirmant des observations antérieures [18,
22]. En effet, les mâles produisent de petits spermatozoïdes avec peu de réserve énergétique
comparativement aux femelles qui produisent plus de vitelline pour le développement des
ovocytes [25].
La séparation électrophorétique des protéines de D. trunculus nous a permis de relever des
effets saison, site et sexe. Ces effets pourraient être dûs soit aux variations des stades de
développement gonadique et leurs besoins protéiques soit aux conditions nutritionnelles qui
varient selon la saison [26]. En outre, les changements saisonniers des conditions du milieu
agissent sur les fonctions biologiques des organismes comme la respiration, la croissance ou
le régime alimentaire [27]. Ils déterminent en grande partie l’intensité des rapports avec le
milieu et la qualité d’eau filtrée. Concernant l’effet sexe et site, on a noté pour les femelles
une augmentation dans le nombre des fractions protéiques à Sidi Salem comparativement à
El Battah et ceci est en accord avec les travaux de Christopher Long et al [28] pour les
femelles bivalves de Macoma balthica. Selon ces mêmes auteurs cette augmentation dans le
nombre des fractions protéiques serait en rapport avec le degré de pollution qui provoque la
production de protéines du stress jouant un rôle de défense. Pour les mâles, on a enregistré
le contraire, c'est a dire une diminution dans le nombre des fractions à Sidi Salem
comparativement à El Battah. Cette différence entre les deux sexes pourrait être due aux
variations des réponses aux polluants entre les deux sexes [5, 29]. Les travaux Saravana
Bhavan et al [30] révèlent une diminution dans le nombre des fractions protéiques au
niveau de l’hépatopancréas suite à l’exposition à une toxicité de carboxyle chez les mâles
du mollusque bivalve Macrobrachium malcolmsonii. Par ailleurs, une dénaturation des
protéines suite à un stress environnemental provoque un affaiblissement polaire des bandes
protéiques [31].
CONCLUSION
L’analyse quantitative et qualitative des protéines gonadiques de D. trunculus nous a
permis de révéler des effets site, saison et sexe. L’effet site suggère un niveau de pollution
du site de Sidi Salem plus élevé comparativement à celui d'El Battah. De plus, les mâles
sont plus sensibles au stress environnemental que les femelles.
REMERCIEMENTS
deux projets (CNEPRU et PNR, Pr. N. Soltani-Mazouni) et a bénéficié du financement du
Fonds National Algérien de la Recherche et du Ministère de l’Enseignement Supérieur et de
la Recherche Scientifique.
REFERENCES
[1] Hamza-Chaffai: Usefulness of bioindicators and biomarkers in pollution biomonitoring. International
Journal of Biotechnology for Wellness Industries., 3:19-26, 2014.
[2] Copat,C-Maggiore,R-Arena,G-Lanzafame,S-Fallico,R-Sciacca,S-Ferrante,M: Evaluation of a temporal
trend heavy metals contamination in Posidonia oceanica (L.) Delile, (1813) along the western
coastline of Sicily (Italy). J. Environ. Monit., 14:187–192, 2012.
[3] Ounissi,M-Fréhi,H: Variabilité du microphytoplancton et des Tintinnides d’un secteur hautement eutrophe
du golfe d’Annaba (Algérie). Cahiers de Biologie marine., 40 : 141-153, 1999.
[4] Ounissi,M-Fréhi,H-Khélifi-Touhami,M: Composition et abondance du zooplancton en situation
d’eutrophisation dans un secteur côtier du golf d’Annaba (Algérie). Analyse de l’institut
océanographique, Paris., 73:53-67, 1998
[5] Beldi,H-Gimbert,F-Maas,S-Scheifler,R-Soltani,N: Seasonal variation of Cd,Cu,Pb and Zn in the edible
mollusk Donax trunculus (Mollusca, Bivalvia) from the gulf of Annaba, Algeria. Afric. J. Agri . Res.,
1(4): 85-90, 2006.
[6] Abdennour,C-Smith,B,D-Boulakoud,M,S-Samraoui,B-Rainbow,P,S: Trace metals in shrimps and
sediments from Algerian water. J. Catal. Mat. Env., 3: 9-12, 2000.
[7] Larba,R-Soltani,N: Use of the land snail Helix aspersa for monitoring heavy metal soil contamination in
Northeast Algeria. Environ Monitor & Asses., 186: 4987–4995, 2014.
[8] Drifi,F-Abdennour,C: Trace Metals in the Mussel Donax trunculus Linnaeus 1758 from Urban and
Industrial Contaminated Locations. Journal of Applied Sciences Research, 6: 2063-2067, 2010.
[9]
Gaspar,M,B-Chicharo,L,M-Vasconcelos,P-Garcia,A-Santos,A,R-Monteiro,C:
Depth
segregation
phenomenon in Donax trunculus (Bivalvia: Donacidae) population of the Algarve coasts (southern
Portugal). Sci. Mar., 66:111-121, 2002.
[10] Shibko,S-Koivistoinen,P-Tratyneck,C-Newhall,A-Freidman,L: A method for thevsequential quantitative
separation and glycogen from a single rat liver homogenate or from avsub cellular fraction. Anal.
Biochem., 19: 415-428,1966.
[11] Bradford,M: A rapid and sensitive method for the quantification of microgram quantities of protein
utilizing the principle of protein-dye binding, Analy. Biochem., 72: 248-254, 1976.
[12] Laemmli,U,K: Changes of structural proteins during the assembly of the head of bacteriophage T4.
Nature., 27: 680-685, 1970.
[13] Kankal,S,B-Gaikwad,R,W: Studies on noise and air quality monitoring at Shirdi Maharashtra, India.
Advances in Applied Science Research., 2: 63, 2011.
[14] De Coen,W,M-Janssen,C,R: The missing biomarker link: relationship between effects on the cellular
energy allocation biomarker of toxicant-stressed Daphnia magna and corresponding population
characteristics. Environ. Toxicol. Chem., 22:1632–1641, 2003.
[15] Voets, J-Talloen,W-DeTender,T-VanDongen,S-Covaci,A-Blust,R-Bervoets,L: Microcontaminant
accumulation, physiological condition and bilateral asymmetry in Zebra mussels (Dreissena
polymorpha) from clean and contaminated surface waters. Aquat. Toxicol., 79: 213–225, 2006.
[16] Paez-Osuna,F-Frias-Espericuetah,M,G-Osuna-Lopez,J,I: Trace metal concentration in relation to season
and gonadal maturation in the oyster Crassostrea iridescens. Mar. Environ. Res., 40:19-31, 1995.
[17] Nalepa,T,F-Cavaletto,J.F-M,For-Gordon,W,M-Wimmer,M: Seasonal and annual variation in weight and
biochemical content of the Zerba mussel Dreissena polymorpha in Lake St. Clair. Journal of Great
Lakes Research, 19: 541-552, 1993.
[18] Hamdani,A-Soltani-Mazouni,N: Changes in Biochemical Composition of the Gonads of Donax trunculus
L. (Mollusca, Bivalvia) from the Gulf of Annaba (Algeria) in Relation to Reproductive Events and
Pollution. Jordan J. Biol. Sci., 4 (3): 149-156, 2011.
[19] Hamdani,A: La reproduction chez un mollusque bivalve Donax trunculus L. dans le golfe d’Annaba.
Rapport entre les aspects cytologique et biochimique et la pollution. Thèse de Doctorat en Biologie
Animale, option: Reproduction et Développement, Université d’Annaba. p. 333, 2013.
[20] Ansell,A,D- Frankiel,L-Mouëza,M: Seasonal changes in tissue weight and biochemical composition for
the bivalve Donax trunculus L on Algerian coasts. J. Exp. Mar. Biol. Ecol., 45:105-116, 1980.
[21] Zandee,D,I-Kluytmans,J,H-Zurburgand,W-Pieters,H: Seasonal variations in biochemical composition of
Mytilus edulis with reference to energy metabolism and gametogenesis. Netherlands Journal of Sea
Research., 14:1-29, 1980.
[22] Sifi,K-Amira,A-Soltani,N: Oxidative stress and biochemical composition in Donax trunculus (Mollusca,
Bivalvia) from the gulf of Annaba (Algeria). Adv. Environ. Biol., 7(4): 595-604, 2013.
[23] Bensouda,L-Soltani-Mazouni,N: Measure of oxidative stress and neurotoxicity biomarkers in Donax
trunculus from the gulf of Annaba (Algeria): case of the year 2012. Ann. Res. Rev. Biol., 4:19021914, 2014.
[24] Sifi,K-Chouahda,S-Soltani,N: Biosurveillance de l’environnement par la mesure de biomarqueurs chez
Donax trunculus dans le golfe d’Annaba (Algérie). Mésogée., 63: 11-18, 2007.
[25] Beninger,P,G-Le Pennec,M: Reproductive characteristics of a primitive bivalve from a deep-sea reducing
environment: giant gametes and their significance in Acharaxaline (Cryptodonta: Solemyidae). Mar.
Ecol. Prog. Ser., 157: 195–206, 1997.
[26] Won,S, E-Novillo,A-Custodia, N-Fitzgerald,R, K-Osada, M-Callard,P: The Freshwater Mussel (Elliptio
complanata) as a sentinel species: vitellogenin and steroid Receptors. Integr. Comp. Biol., 45 :72–80,
2005.
[27] Claisse,D-Joanny,M-Quintin,J,Y: Le réseau national d’observation de la qualité du milieu marin (RNO).
Analysis., 20: 719-722, 1992.
[28] Christopher-Long,W- Kaattari,S-Bromage,E: Biomarkers of oogenesis in Macoma balthica determined
by subtractive immunization. Aquat. Biol., 3:139–145, 2008.
[29] Sokolowski,A-Bawazir,A-Wolowicz,S: Trace Metals in the Brown Mussel Perna perna from the Coastal
Waters Of Yemen (Gulf of Aden): How Concentrations Are Affected by Weight, Sex, and Seasonal
Cycle. Arch. Environ. Contam. Toxicol., 46:67–80, 2004.
[30] Saravana Bhavan,L,P-Geraldine,P: Manifestation of carbaryl toxicity on soluble protein and
histopathology in the hepatopancreas and gills of the prawn, Macrobrachium malcolmsonii. J.
Environ. Biol., 30: 533-538, 2009.
[31] Wedler,F,C: Determination of molecular heat stability in thermotolerace, In: Henle, K.J. (Eds.),
Thermotolerance, Vol. II, Mechanisms of Heat Resistance, CRC Press. Boca Raton. FL. pp. 2-18,
1987.

INOC

Transcription

Documents pareils

ici - Jeanne La Lorraine

PS-SSSU04 Surgical Scrub évier, Triple

PS-SSSU01 Surgical Scrub évier, Double

KELT 620 - LIBERTY MARINE

Reise Info - Offshore Sailing

Dossier de presse The Tanners

Télécharger le trousseau de camp

Télécharger la rencontre fouesnantaise avec Roger Argouac`h au

charpentier de marine - Lycée Professionnel Poinso Chapuis